MOLECULAR AND CELLULAR BIOLOGY, Sept. 1991,
p.
4441 4447
Vol. 11, No. 9
0270-7306/91/094441-07$02.00/0 Copyright X 1991, American Society for Microbiology
Repair of a Synthetic Abasic Site Involves Concerted Reactions of DNA Synthesis Followed by Excision and Ligation YOSHIHIRO MATSUMOTO* AND DANIEL F. BOGENHAGEN Department of Pharmacological Sciences, State University of New York at Stony Brook, Stony Brook, New York 11794 Received 28 November 1990/Accepted 12 June 1991
A synthetic analog of an abasic site in DNA is efficiently repaired by a short-patch repair mechanism in soluble extracts of Xenopus laevis oocytes (Y. Matsumoto and D. F. Bogenhagen, Mol. Cell. Biol. 9:3750-3757, 1989). We present a detailed analysis of the repair mechanism, using extracts depleted of endogenous nucleotide pools. ATP was required for repair with a sharp optimal concentration of 5 mM. The initial rate of repair was increased by preincubation of the DNA in the extract in the presence of ATP. During this preincubation, the DNA was cleaved on the 5' side of the lesion by a class II apurinic-apyrimidinic endonuclease, but removal of the abasic sugar residue was not observed prior to addition of deoxynucleotides to the reaction. Immediately folowing DNA synthesis, excision and ligation proceeded in a coordinated manner to complete repair. DNA preincubated in the extract in the absence of deoxynucleotides remained associated with repair enzymes during gel filtration. These observations suggest that the enzymes involved in concerted repair of the abasic site form a complex on DNA.
Abasic sites are common intermediate products in base excision repair. The 3-hydroxy-2-hydroxymethyltetrahydrofuran residue is a structural analog of the sugar residue in the natural apurinic-apyrimidinic (AP) site (11). Because of its chemical stability, this residue can be introduced into oligonucleotides during automated DNA synthesis and eventually inserted into covalently closed circular DNA (cccDNA). Using DNA substrates which contain this synthetic abasic site at a defined position, we have developed accurate and sensitive assays for reactions involved in repair of this lesion. In a previous report (7), we described the vigorous repair of tetrahydrofuran residues in a cell extract derived from Xenopus laevis oocytes. In this repair reaction the tetrahydrofuran site was rapidly incised by a class II AP endonuclease, while the slower step of DNA synthesis required ATP and was quickly followed by ligation. The repair-related DNA synthesis was localized to a patch of one to a few nucleotides surrounding the abasic site. Our preliminary characterization of this repair process did not address several aspects of the repair mechanism. We have focused our recent experiments on the following questions. First, is the abasic sugar residue removed before or after DNA synthesis takes place? Second, does the close timing of DNA synthesis and ligation result from coupling of these reactions? If so, does this coupling include any physical interaction between the enzymes involved in those reactions? To address these questions, we have studied the repair reaction in extracts depleted of endogenous nucleotides. These extracts made it possible to control the initiation of DNA synthesis during the repair reaction. In this report we have characterized the sequential reactions involved in the repair of tetrahydrofuran residues. We also discuss the model of a repair complex suggested by these results.
*
MATERIALS AND METHODS
Materials. The sources of materials used in this work were as previously described (7) except for adenosine 5'-O-(3thiotriphosphate) (ATP-yS), which was obtained from Pharmacia. Construction of DNA. Tetrahydrofuran-containing cccDNA was prepared by procedures essentially similar to those described by Naser et al. (8) and Stanssens et al. (10) (Fig. 1A). In a typical preparation, 50 ,ug of pBS- double-stranded DNA (Stratagene) was digested with AvaI and EcoRI, deproteinized by extraction with phenol-chloroform, and precipitated with ethanol. The linear DNA was mixed with 50 ,ug of pBS- single-stranded DNA in 200 [lI of water and incubated for 15 min at 70°C. Then 20 [lI of annealing buffer (0.1 M Tris-Cl [pH 7.5], 1.5 M NaCl) was added, and the sample was gradually cooled to room temperature to form a gapped heteroduplex. One nanomole of the tetrahydrofurancontaining oligonucleotide with a sequence complementary to the gapped region of the heteroduplex was added to the DNA mixture and ligated at 4°C with T4 DNA ligase. cccDNA was purified by equilibrium centrifugation in CsCl and ethidium bromide. The concentration of recovered DNA was determined by fluorimetry (TK0100; Hoefer Scientific Instruments) in the presence of the dye Hoechst 33258 (4). For preparation of cccDNA prelabeled on the 3' or 5' side of the lesion, either the dephosphorylated EcoRI site of the double-stranded DNA or the 5' end of the oligonucleotide, respectively, was labeled with T4 polynucleotide kinase and [y-32P]ATP prior to heteroduplex formation. Depurinated DNA was prepared by incubation of closed circular plasmid DNA in depurination buffer (0.1 M NaCl, 10 mM NaP1, 10 mM sodium citrate [pH 5.0]) for 4 h at 70°C (5). The rate of formation of depurination sites was measured as follows. Samples were withdrawn from the depurination reaction at various times during the early stages of heat treatment and treated with exonuclease III to nick at abasic sites. The rate of generation of exonuclease III-sensitive sites was determined by agarose gel electrophoresis. Extrapolation of the initial rate of depurination over the complete
Corresponding author. 4441
4442
MATSUMOTO AND BOGENHAGEN
MOL. CELL. BIOL.
A
B
PVif
PvuD Time
CCGGGFACCGAGCTCG \1
C AATTC GGGCCCATGGCTCGAGCTTAAG
pBS- multiple cloning site
2
4
B
15
v
R C
_
-
probe uleaved (252 nt)' Repaired (382 nt) FIG. 1. Construction of the tetrahydrofuran-containing plasmid and assay for its repair in the oocyte extract. (A) Plasmid structure. The oligonucleotide containing a tetrahydrofuran residue (designated F) is ligated into the gapped heteroduplex of a pBS- plasmid vector to produce a cccDNA as described in Materials and Methods. This DNA is rapidly cleaved at the 5' side of the tetrahydrofuran residue when incubated in the X. Iaevis oocyte extract (7). This initial product is detected as a 252-nucleotide fragment following digestion with PvuII, denaturing polyacrylamide gel electrophoresis, and blot hybridization to a single-stranded RNA probe as described in Materials and Methods. Repair results in conversion of nicked fragments to a 382-nucleotide PvuII fragment. (B) Time course of a standard repair reaction. The incubation time for the reaction is indicated in minutes above each lane. R, repaired fragments; C, fragments cleaved at the tetrahydrofuran.
4-h treatment interval indicated that the DNA contained 5 pmol of depurinated sites per ,ug. S150 extract. The S150 extract was prepared as previously described (1, 7). A Sephadex G-25 column was used to remove nucleotides from the S150 extract. The column (0.75 by 21 cm) was preequilibrated with buffer containing 20 mM N-2-hydroxyethylpiperazine-N'-2-ethanesulfonic acid (HEPES; pH 7.5), 60 mM KCI, 2 mM ethyleneglycol-bis(paminoethyl ether)-N,N,N',N'-tetraacetic acid (EGTA), 10 mM a-glycerol phosphate, 2.5 mM dithiothreitol, 0.2 mM phenylmethylsulfonyl fluoride, 1 mM benzamidine-HCI, and 10% glycerol and then pretreated with 2 mg of bovine serum albumin. One milliliter of S150 extract (7 to 10 mg of protein per ml) was loaded on the column, and the fractions containing the peak of protein were pooled in 1 to 1.5 ml. The pooled fraction (S150GF) usually had 2 to 4 mg of protein per ml and less than 5% of the initial concentration of free nucleotides. DNA repair assay. The standard repair reaction mixture contains 10 ,ug of S15OGF protein, 10 ng of tetrahydrofurancontaining cccDNA, 5 mM ATP, and 50 ,uM each dATP, dCTP, dGTP, and dTTP in a 20-pdl reaction mixture containing 20 mM HEPES (pH 7.5), 60 mM KCI, 10 mM MgCl2, 2.5 mM dithiothreitol, 2.5 mM p-glycerol phosphate, 0.5 mM EGTA, and 2.5% glycerol. In most cases, the repair reaction was started by the addition of substrate DNA to the reaction mixture which had been preincubated for 5 min at 25°C. Reactions were stopped by addition of sodium dodecyl sulfate to a final concentration of 0.4%. After incubation with 10 ,ug of proteinase K for 10 min at 37°C, the sample was extracted with phenol-chloroform and precipitated along with 0.5 ,ug of tRNA in ethanol. The extracted DNA was digested with PvuII and then subjected to electrophoresis on a 6% denaturing polyacrylamide gel. Blot hybridization with a 32P-labeled RNA probe was done as described previously (7) except that the RNA probe was prepared by transcription of the EcoRI-digested template with T7 RNA polymerase. Autoradiograms were obtained without intensifying screens, and bands were quantified by densitometry (Ultroscan XL; LKB). Gel filtration of the repair complex. A Bio-Gel A-lSm column (bed volume, 2 ml; Bio-Rad) was pretreated with 2 mg of tRNA and 0.4 mg of gelatin and then equilibrated with
repair reaction buffer containing 0.1 mg of gelatin per ml, 0.01% Triton X-100, and 1 mM ATP but without a-glycerol phosphate and EGTA. A 25-ng sample of the tetrahydrofuran-containing DNA was incubated in S15OGF (25 jig of protein) in a volume of 50 RI under standard conditions but without deoxynucleoside triphosphates (dNTPs) for 10 min and then loaded on the column, which was run at room temperature. In some experiments (e.g., Fig. 7A), the DNA was quickly mixed with the extract and directly loaded on the column to assess the importance of preincubation. Eluted fractions (50 RI) were collected, supplemented with 5 ,uM [a-32P]dTTP (40 Ci/mmol) and 50 jiM each of the other three dNTPs, and incubated for 20 min at 25°C. After phenol-chloroform extraction and ethanol precipitation, DNA was digested with Hinfl, electrophoresed in a denaturing 20% polyacrylamide gel, and subjected to autoradiography. When repair complexes were subjected to gel filtration, the tetrahydrofuran-containing DNAs were pretreated with exonuclease III to ensure that the initial incision by an AP endonuclease did not limit the rate or extent of repair. Control experiments showed that DNA pretreated with exonuclease III was repaired in a standard repair assay with the same efficiency as was untreated DNA (data not shown). RESULTS Nucleotide requirements for the repair reaction. We have previously shown that a tetrahydrofuran residue that represents an analog of an abasic site in DNA is efficiently repaired in an S150 extract of X. laevis oocytes. Since the S150 extract contains nucleotide pools carried over from oocytes, the optimal concentrations of ATP and dNTPs for repair could not be determined accurately. We used gel exclusion chromatography to prepare a nucleotide-depleted extract (S15OGF) with essentially no loss of repair activity compared with the original S150 (Fig. 1B) (7). This S1SOGF extract supports repair of the tetrahydrofuran residue in the presence of ATP at 5 mM and dNTPs at >5 jiM (Fig. 2). The omission of dNTPs from the reaction mixture suppressed the repair activity. In the sequence shown in Fig. 1A, a thymidine residue should replace the tetrahydrofuran residue in DNA during repair. Control experiments with this DNA
REPAIR OF A SYNTHETIC ABASIC SITE
VOL. 11, 1991
4443
100 -
100
B 80 -
80
0
.-
-.4
Z
.4
0
0
z 60-i 10 0 /
60
.p40
10 .Is 40
d4
0
L.
L.4 20 20
02
0
1
3 2 dNTPs
4
(AM)
5
2
3
4 5 6 ATP (mM)
7
8
FIG. 2. Nucleotide requirements for repair in the extract following gel filtration. (A) dNTP requirement. Repair reactions were performed for 15 min with increasing amounts of dNTPs under the standard conditions as described in Materials and Methods. The repair products were analyzed as shown in Fig. 1B and quantified by densitometric scanning of the autoradiogram. Slightly higher repair was observed at 50 F.M than at 5 ,uM (data not shown). (B) ATP requirement. Reactions were performed for 15 min under two conditions. In one set, ATP was varied from 3 to 7 mM in the presence of 10 mM MgCl2 under standard conditions (0). In the second set, 3 to 7 mM Mg-ATP was added to reactions containing an excess of 5 mM MgCl2 (0).
substrate demonstrated that 0.1 ,uM dTTP without any other dNTPs could support more than 40% of the extent of repair observed under standard conditions with 50 ,uM dNTPs (data not shown). This result is consistent with our earlier observation that a significant fraction of repair events involve replacement of only the single damaged residue (7). Figure 2B shows the results of repair reactions performed to determine the optimal ATP concentration under two conditions. In one set of reactions, the ATP concentration was varied between 3 and 7 mM in the presence of 10 mM MgCl2; in the second set, the concentrations of both ATP and MgCl2 were varied to maintain a constant excess of 5 mM MgCl2. Under both conditions, ATP was required at a relatively high and extremely sharp optimal concentration of 5 mM. Changing the ATP concentration to 4 or 6 mM dramatically reduced the efficiency of repair. The fact that the same ATP optimum was observed under both conditions in Fig. 2B indicates that the sharp ATP optimum is not an artifact resulting from chelation of Mg2' by ATP. The exogenous ATP concentration required for optimal repair activity varies slightly, between 3.5 and 5.0 mM, in different extracts prepared from individual frogs. However, all extracts that we have prepared show a sharp optimum in the ATP requirement that is not fully understood at present. Neither ATP-yS, GTP, nor dATP could be substituted for ATP in the range of 3 to 7 mM (data not shown). Effect of preincubation. The dNTP requirement for repair suggests that in the absence of dNTPs, the repair reaction might be stalled at the step preceding DNA synthesis and might be reinitiated by addition of dNTPs. We tested this possibility by comparing the initial rate of repair with and without preincubation in the absence of dNTPs. As shown in Fig. 3, a 10-min preincubation of the DNA substrate in the absence of dNTPs significantly increased the initial rate of repair. This effect required preincubation of the substrate
6
mLini. after dNTPs addition F
S15OGF
AL, 6
dNTPs
4
F S15OGF 1 5n1 0
dNTPs 10
F
S15OGF
L
M1
dNTPu 16
mm.L
FIG. 3. Effect of preincubation in the absence of dNTPs. The tetrahydrofuran-containing DNA (F) was incubated with the extract including ATP for 10 min prior to addition of dNTPs. The repair reaction was reinitiated by addition of dNTPs. The repair products were analyzed as described in the legend to Fig. 2. Two control experiments without preincubation of DNA in the extract were also performed with the time courses diagrammed. Symbols represent the three different preincubation protocols, as diagrammed at the bottom.
exogenous
DNA in the extract prior to addition of dNTPs. Preincubation of the extract without DNA did not increase the initial rate of the reaction. Other control experiments showed that ATP was required at a very early stage of the reaction. Preincubation of the extract in the reaction buffer without ATP greatly inhibited repair and did not allow activation of repair by the subsequent addition of ATP (data not shown). Analysis of intermediate products. Our previous experiments (7) showed that repair was initiated by rapid cleavage by AP endonuclease followed by slower steps involving excision of the tetrahydrofuran residue and DNA synthesis. In these early experiments, we observed that ligation quickly followed DNA synthesis. These observations suggested that either DNA synthesis or the excision of an abasic residue, if it indeed preceded DNA synthesis, might be a rate-limiting step for this repair process. The availability of the nucleotide-dependent extract provided an opportunity to determine whether exonucleolytic removal of the tetrahydrofuran residue precedes DNA synthesis. We performed experiments with DNA templates labeled on either the 5' or 3' side of the tetrahydrofuran residue to monitor the fate of intermediate products throughout the repair process. In these experiments, the tetrahydrofuran-containing cccDNA was prelabeled with 32P at a distance of a few nucleotides on either the 5' or 3' side of its abasic site as described in Materials and Methods. When such prelabeled substrates are incubated in the extract, the DNA is cut rapidly at the 5' side of the lesion by a class II AP endonuclease (7). To monitor the fate of the prelabeled DNA substrate, we recovered the DNA after various periods of incubation and cut the DNA with Hinfl to yield the initial fragments diagrammed in Fig. 4C. This strategy allows us to monitor
4444
MATSUMOTO AND BOGENHAGEN
MOL. CELL. BIOL.
A 1 2 345
8
7
8
B 9
10
2
3
4
5
8
_-'imm -R-
7
8 9 10 11 12 13 14
_
_ _ ..~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~....
C
-E
__tema
..... .%
C
-c
ml
6'
ACTCTAGAGGATCCCCGGG
I*
FACCGAGCTCGAATTCGCCCTATAGTG
3
AP endcD. M2 FIG. 4. Analysis of intermediate products during the repair reaction. (A) Analysis of the fragment on the 5' side of the lesion. The DNA prelabeled upstream of the tetrahydrofuran (at *C in panel C) was incubated in the reaction mixture without (lanes 1 to 5) or with (lanes 6 to 10) dNTPs for 1 min (lanes 1 and 6), 2 min (2 and 7), 4 min (3 and 8), 8 min (4 and 9), or 20 min (5 and 10). The extracted DNA samples were digested with Hinfl, electrophoresed in a denaturing 20% polyacrylamide gel, and autoradiographed. C, initial fragments produced by cleavage by AP endonuclease; E, fragments elongated by one nucleotide; R, repaired products. (B) Analysis of the fragment on the 3' side of the lesion. The DNA prelabeled downstream of the tetrahydrofuran (at *A in panel C) was incubated in the reaction mixture without (lanes 1 to 6) or with (lanes 9 to 14) dNTPs for 0 min (lanes 1 and 9), 1 min (2 and 10), 2 min (3 and 11), 4 min (4 and 12), 8 min (5 and 13), or 20 min (6 and 14). The extracted DNA was analyzed as described for panel A. Molecular weight markers Ml and M2 (see panel C) were loaded on lanes 7 and 8, respectively. (C) Sequence of the Hinfl fragment cleaved by AP endonuclease. Asterisks indicate the two prelabeling positions either upstream or downstream of the tetrahydrofuran. The 26-nucleotide fragment Ml, one of the molecular weight markers used in panel B, was generated by digestion of labeled DNA containing a T residue instead of the tetrahydrofuran with RsaI and Hinfl. The second marker, M2, is identical to Ml except that it includes the tetrahydrofuran residue. M2 was generated by digestion of labeled DNA containing the tetrahydrofuran residue with exonuclease III and Hinfl.
the sizes of fragments on the 5' side (Fig. 4A) or on the 3' side (Fig. 4B) of the initial cleavage by the AP endonuclease. In the presence of exogenous dNTPs, the 5' fragment was gradually elongated by one or a few nucleotides (Fig. 4A, lanes 6 to 10). These elongated products did not accumulate but were rapidly ligated to the 3' fragment to complete repair. At the same time, the 3' fragment was gradually ligated to the 5' fragment (Fig. 4B, lanes 9 to 14). We think it significant that we did not detect a reduction in size of the 3' fragment which would have accompanied removal of the tetrahydrofuran residue from its 5' terminus. As shown in lane 7, removal of the tetrahydrofuran residue results in a detectable mobility shift. This does not mean that excision of the abasic residue did not occur during the repair process. We suggest that the excision of a tetrahydrofuran was followed by ligation too quickly to be detected as an intermediate product. The final product of repair has a normal nucleotide at the tetrahydrofuran site and is resistant to AP endonuclease (7). In the absence of dNTPs, we observed inefficient repair, probably as a result of residual low amounts of dNTPs in the extract after gel filtration. In this case as well, we did not detect shortened products of the downstream fragment (Fig. 4B, lanes 1 to 6). As long as DNA synthesis did not occur, the tetrahydrofuran remained at the 5' terminus of the downstream fragment. This means that the excision of a tetrahydrofuran residue is dependent on DNA synthesis.
Taken together, these results indicate that DNA synthesis is rapidly followed by excision and ligation. Inhibition by depurinated DNA. A tetrahydrofuran residue is repaired by a base excision repair mechanism that may also be a common mechanism for repair of natural AP sites. To test this possibility, we sought to determine whether repair of the tetrahydrofuran residue would be inhibited by depurinated plasmid DNA. In the experiment shown in Fig. 5, 100 ng of depurinated DNA (about 0.5 pmol of AP sites) inhibited repair of the tetrahydrofuran residue by 90%, while 500 ng of normal plasmid DNA still allowed repair of 70% of the substrate DNA. This result indicates that the repair of tetrahydrofuran residues involves the same rate-limiting steps as does repair of natural AP sites. The initial rate of repair is accelerated by preincubation of the DNA in the extract in the presence of ATP (Fig. 3). Therefore, some rate-limiting ATP-dependent interaction between substrate DNA and factors in the extract is required for repair prior to DNA synthesis. We performed the experiment shown in Fig. 6 to determine whether preincubation might produce a complex that is resistant to inhibition by a large excess of depurinated DNA. The results confirm that a significant percentage of tetrahydrofuran-containing DNA was efficiently repaired if it was preincubated in the extract prior to the addition of depurinated DNA. Simultaneous addition of the depurinated DNA completely inhibited repair of the tetrahydrofuran residue. We conclude that some
REPAIR OF A SYNTHETIC ABASIC SITE
VOL. 11, 1991
A 100 -
75
._-.
1 23 4 5 6 78 910
4445
B 1 2 3 4 5 6 7 8 9 10
l_ 0-4
Q
aL)
50
._
25 .
0 0
100
10
1000
competitor DNA (ng) FIG. 5. Inhibition of repair by depurinated competitor DNA. The repair of tetrahydrofuran-containing DNA in 8 min in the presence of increasing amounts of depurinated DNA (0) or normal plasmid DNA (0) was measured. The relative repair activities were calculated as the percentage of the activity in the absence of competitor DNA.
repair enzymes, which could otherwise be titrated by depurinated DNA, might form a complex at a tetrahydrofuran site in DNA during preincubation. Gel filtration of a repair complex. To further characterize the putative repair complex, we attempted to detect repair activity associated with DNA following size exclusion chromatography on a column with a very high exclusion limit. The tetrahydrofuran-containing DNA was preincubated in the reaction mixture without dNTPs and loaded on a Bio-Gel A-15m gel filtration column as described in Materials and
40I--
IzI30
AA
la *0
20 U-
04
10 . A
0
8 12 4 min after dNTPs addition
F S15OGF depur.DNA 5
m1m
F
S15OGF
16
I
Mb
16
dNTPs 10mm.
depur.DNA 10
dNTPa
A, A
I
*
4
nin =i
FIG. 6. Evidence that preincubation of DNA in the extract alleviates inhibition by depurinated DNA. The tetrahydrofurancontaining DNA (F) was incubated with the extract including ATP for 10 min prior to addition of 200 ng of depurinated DNA. After further incubation for 1 min (A) or 4 min (-), the repair reaction was reinitiated by addition of dNTPs. In a control experiment (0), the depurinated DNA was added simultaneously with the tetrahydrofuran-containing DNA in the time course diagrammed.
vol.(ml) 0.8 0.9 1.0 1.1
0.8 0.9 1.0 1.1
FIG. 7. Coelution of repair activity with the tetrahydrofurancontaining DNA from a gel filtration column. (A) Bio-Gel A-15m chromatography of the DNA without preincubation in the extract. The tetrahydrofuran-containing DNA (nicked by pretreatment with exonuclease III) was loaded on a gel filtration column immediately after mixing with the extract in the absence of dNTPs. The repair activity of eluted fractions was analyzed as described in Materials and Methods. (B) Bio-Gel A-15m chromatography of the DNA preincubated in the repair reaction. The tetrahydrofuran-containing DNA (pretreated with exonuclease III) was incubated in S15OGF in the absence of dNTPs for 10 min and then loaded on a column. In lane 1 of each panel, the sample treated without gel filtration was loaded.
Methods. Plasmid DNA eluted from this column after about 0.9 ml, while most free proteins, including molecules as large as ferritin (molecular weight 440,000), eluted after 1.5 ml. Approximately 5% of the protein applied to the column coeluted with the DNA. The eluted fractions containing DNA were then incubated with radioactive dNTPs, and the repaired products were analyzed by gel electrophoresis. In this assay, if the activities of DNA synthesis and ligation coeluted with DNA, repair would be detected as incorporation of 32P into the restriction fragment containing the tetrahydrofuran residue. Figure 7 shows that a significant fraction of the DNA preincubated in the extract for 10 min prior to gel filtration was repaired during subsequent incubation in the presence of dNTPs. In contrast, essentially none of the DNA loaded on the gel filtration column immediately after mixing with S15OGF was repaired. This result suggests that enzymes involved in DNA synthesis, excision of the lesion, and ligation associate with DNA during preincubation in the absence of deoxynucleotides. However, the presence of a relatively large amount of unligated polymerization products in Fig. 7B is consistent with the possibility that these complexes are relatively deficient in either the tetrahydrofuran excision activity or DNA ligase. We were concerned with the possibility that the extent of DNA repair observed in Fig. 7B might result from coelution of protein associated nonspecifically with DNA rather than from assembly of a specific repair complex. We performed another experiment to distinguish between these two possibilities. In this experiment, cccDNA containing a single tetrahydrofuran residue was preincubated in the extract and recovered following gel exclusion chromatography on Bio-
4446
MATSUMOTO AND BOGENHAGEN
12 3 4
MOL. CELL. BIOL.
5 67 8 Incision AP endonuclease
R
Repair complex formation
Io11UVT DNA synthesis
E Excision & ligation
FIG. 8. Challenge of repair complexes by an excess amount of abasic DNA. Tetrahydrofuran-containing DNA (30 ng) was preincubated with 30 ,ug of extract in a volume of 60 ,ul and loaded on a Bio-Gel A-15m gel filtration column as described in Materials and Methods. The eluate from 0.8 to 1.1 ml was collected and divided into two aliquots; 200 ng of the depurinated DNA (pretreated with exonuclease III as a source of AP endonuclease) was added to one of the reactions. The aliquots were incubated at 25°C either without (lanes 1 to 4) or with (lanes 5 to 8) 200 ng of depurinated DNA. After various time points (1 min in lanes 1 and 5, 2 min in lanes 2 and 6, 4 min in lanes 3 and 7, and 8 min in lanes 4 and 8), aliquots were removed and added to radioactive dNTPs to allow repair reactions to resume. These reactions, containing 0.3 ,uM dNTPs and 8 ,uCi of [a-32P]dTTP, were continued for 20 min at 25°C. The extracted DNA from each sample was analyzed as described above. DNA was electrophoresed in a denaturing 20% polyacrylamide gel after digestion with Hinfl. R, repaired products; E, fragments elongated but not ligated. The depurinated DNA added after gel filtration does not produce the Hinfl fragment with the same size as the repair product from the tetrahydrofuran-containing DNA.
Gel A-15m. If repair following gel filtration required redistribution of proteins bound in a rather nonspecific fashion to the DNA, we would expect this repair to be inhibited by a large excess of DNA that had been extensively depurinated and nicked at the abasic sites. Repair of tetrahydrofuran sites was monitored after incubation of the excluded peak with excess depurinated DNA for time periods ranging from 1 to 8 min. As shown in Fig. 8, the tetrahydrofurancontaining DNA was repaired at a comparable level either with or without competitor DNA. These results show that some limiting component of the repair machinery binds persistently to abasic sites after cleavage by AP endonuclease. This association of repair proteins with the tetrahydrofuran residues can survive gel filtration and challenge by an excess of depurinated DNA.
DISCUSSION Significant progress has been made recently in describing DNA repair reactions in soluble extracts from eukaryotic cells. In these experiments, various well-defined DNA lesions were studied as substrates for repair reactions. The repair of pyrimidine dimers, acetylaminofluorene adducts, and psoralen monoadducts in human cell extracts were
FIG. 9. Pathway for repair of a tetrahydrofuran residue. See the text for discussion.
enhanced by Escherichia coli UvrABC proteins (2, 3), suggesting that their repair proceeds by a nucleotide excision pathway. In addition, several groups have reported in vitro repair of base pair mismatches (12-14). Additional experiments will be required to compare the mechanism of repair of these lesions with the repair of abasic sites. We have focused our attention on the repair of precisely positioned tetrahydrofuran residues in DNA in an X. laevis oocyte extract. This synthetic analog of an abasic site in DNA resembles the product of spontaneous depurination or base excision events that may represent the most common type of DNA damage (6). We have previously shown that the X. laevis oocyte extract is capable of repairing these lesions rapidly. Efficient repair requires addition of a precisely controlled concentration of ATP (Fig. 2). This observation has an important practical consequence for efforts to study DNA repair processes in vitro. If initial efforts to detect repair activity do not employ an optimal ATP concentration, repair might not be observed. The efficiency of repair under optimal conditions has allowed us to determine the order of events in repair of this lesion. The order of subreactions during repair of the tetrahydrofuran residue. Along with our previous experiments (7), the analysis of intermediate repair products has established the order of sequential reactions shown in Fig. 9. The initial incision by class II AP endonuclease can occur independently of the subsequent steps. Cleavage of the substrate is completed in 15 s (7) and requires neither ATP nor dNTPs. DNA which was cleaved at the tetrahydrofuran site by pretreatment with exonuclease III was repaired with the same efficiency as uncleaved DNA. In contrast, DNA synthesis occurs at a slower rate than incision and is coordinated with excision and ligation. The detailed kinetic analysis of intermediates in repair presented in Fig. 4 suggests that DNA synthesis precedes excision of the lesion from the DNA. The 5' -- 3' exonuclease activity that removes the tetrahydrofuran residue is dependent on deoxynucleotides and presumably on polymerization. Such a dNTP depen-
REPAIR OF A SYNTHETIC ABASIC SITE
VOL . 1 l, 1991 dence would not be
expected for the
5'
-+
ated
5'
--
3'
exonuclease
activity.
Although
5'
--
3'
exonuclease activity has not been documented for eukaryotic DNA polymerases, a potential damage-specific nuclease activity would not have been detected in routine assays for 5'
-*
3' exonuclease
activity.
ACKNOWLEDGMENTS
3' exonuclease
activity of a classical repair polymerase, such as DNA polymerase I of E. coli. The overall repair could be accomplished by any of several mechanisms. The DNA polymerase that accomplishes this repair may have a tightly associ-
A second alternative is sug-
gested by experiments examining the properties of purified enzymes that may be involved in DNA repair. These experiments have shown that exonuclease activity can follow limited displacement DNA synthesis (9). However, we are not aware of any previous evidence for this sort of strand displacement synthesis in the context of site-specific repair. The failure to observe an intermediate product in which the downstream fragment was shortened by exonucleolytic removal of the abasic residue requires that excision and ligation be very tightly linked reactions. Experiments are in progress to further characterize the DNA polymerase and exonuclease activities responsible for this repair. Wood et al. (15) have reported that the gap filling and ligation in the course of pyrimidine dimer repair proceed rapidly after the initial incision has occurred. This repair also requires a high concentration of ATP at a very early stage. However, the limited efficiency of this in vitro eukaryotic repair system has not yet permitted a detailed analysis of the order of events in the repair of pyrimidine dimers. Assembly of a repair complex. The nick introduced by the AP endonuclease appears to trigger the assembly of a repair complex on the DNA. The AP endonuclease is unlikely to be involved in this complex because the initial incision by this enzyme can be independent of the subsequent reaction steps. Several experiments suggest that the ATP-dependent formation of the complex might be a rate-limiting step in the repair reaction. Once it is assembled, the complex rapidly completes repair in the presence of dNTPs. This would appear to be a very reasonable strategy for the cell to adopt to repair its DNA, since the concerted action of the repair complex minimizes the exposure of intermediates in DNA repair to other nuclear proteins that might initiate aberrant repair activities. This complex can be maintained at least briefly at the synthetic abasic site in the absence of dNTPs. The data shown in Fig. 7 and 8 indicate that the repair complex assembled on the DNA can survive gel filtration. Although a fraction of the repair complexes survives challenge by a large excess of depurinated DNA, some component(s) of the complex probably dissociate in the absence of dNTPs, as shown in Fig. 6. Additional experiments will be required to identify the proteins required for repair and to determine which of these are most tightly bound in the repair complex that survives gel filtration. We expect that the characterization of the overall repair reaction described here will be helpful for developing a reconstituted repair system with purified enzymes.
4447
This research was funded by grant ES04068 from the National Institute of Environmental Health Sciences. We thank Rob Rieger for synthesis of the oligonucleotides bearing tetrahydrofuran residues that have made this work possible. We also thank Arthur P. Grollman for critical reading of the manuscript.
1. 2.
3.
4.
5. 6. 7.
8.
9. 10.
11.
12. 13.
14.
15.
REFERENCES Glikin, G. C., I. Ruberti, and A. Worcel. 1984. Chromatin assembly in Xenopus oocytes: in vitro studies. Cell 37:33-41. Hansson, J., L. Grossman, T. Lindahl, and R. D. Wood. 1990. Complementation of the xeroderma pigmentosum DNA repair synthesis defect with Escherichia coli UvrABC proteins in a cell-free system. Nucleic Acids Res. 18:35-40. Hansson, J., M. Munn, W. D. Rupp, R. Kahn, and R. D. Wood. 1989. Localization of DNA repair synthesis by human cell extracts to a short region at the site of a lesion. J. Biol. Chem. 264:21788-21792. Labarca, C., and K. Paigen. 1980. A simple, rapid, and sensitive DNA assay procedure. Anal. Biochem. 102:344-352. Lindahl, T., and B. Nyberg. 1972. Rate of depurination of native deoxyribonucleic acid. Biochemistry 11:3610-3618. Loeb, L. A. 1985. Apurinic sites as mutagenic intermediates. Cell 40:483-484. Matsumoto, Y., and D. F. Bogenhagen. 1989. Repair of a synthetic abasic site in DNA in a Xenopus laevis oocyte extract. Mol. Cell. Biol. 9:3750-3757. Naser, L. J., A. L. Pinto, S. J. Lippard, and J. M. Essigmann. 1988. Extrachromosomal probes with site-specific modifications. Construction of defined DNA substrates for repair and mutagenesis studies, p. 205-217. In E. C. Friedberg and P. C. Hanawalt (ed.), DNA repair. A laboratory manual of research procedures, vol. 3. Marcel Dekker, Inc., New York. Randahl, H., G. C. EUliott, and S. Linn. 1988. DNA repair reactions by purified HeLa DNA polymerases and exonucleases. J. Biol. Chem. 263:12228-12234. Stanssens, P., C. Opsomer, Y. M. McKeown, W. Kramer, M. Zabeau, and H.-J. Fritz. 1989. Efficient oligonucleotide-directed construction of mutations in expression vectors by the gapped duplex DNA method using alternating selective markers. Nucleic Acids Res. 17:4441-4454. Takeshita, M., C.-N. Chang, F. Johnson, S. Will, and A. P. Grollhman. 1987. Oligodeoxynucleotides containing synthetic abasic sites: model substrates for DNA polymerases and apurinic/apyrimidinic endonucleases. J. Biol. Chem. 262:1017110179. Thomas, D. C., J. D. Roberts, and T. A. Kunkel. 1991. Heteroduplex repair in extracts of human HeLa cells. J. Biol. Chem. 266:3744-3751. Varlet, I., M. Radman, and P. Brooks. 1990. DNA mismatch repair in Xenopus egg extracts: repair efficiency and DNA repair synthesis for all single base-pair mismatches. Proc. Natl. Acad. Sci. USA 87:7883-7887. Wiebauer, K., and J. Jiricny. 1990. Mismatch-specific thymine DNA glycosylase and DNA polymerase 1B mediate the correction of G:T mispairs in nuclear extracts from human cells. Proc. Natl. Acad. Sci. USA 87:5842-5845. Wood, R. D., P. Robins, and T. Lindahl. 1988. Complementation of the xeroderma pigmentosum DNA repair defect in cell-free extracts. Cell 53:97-106.
p.
4441 4447
Vol. 11, No. 9
0270-7306/91/094441-07$02.00/0 Copyright X 1991, American Society for Microbiology
Repair of a Synthetic Abasic Site Involves Concerted Reactions of DNA Synthesis Followed by Excision and Ligation YOSHIHIRO MATSUMOTO* AND DANIEL F. BOGENHAGEN Department of Pharmacological Sciences, State University of New York at Stony Brook, Stony Brook, New York 11794 Received 28 November 1990/Accepted 12 June 1991
A synthetic analog of an abasic site in DNA is efficiently repaired by a short-patch repair mechanism in soluble extracts of Xenopus laevis oocytes (Y. Matsumoto and D. F. Bogenhagen, Mol. Cell. Biol. 9:3750-3757, 1989). We present a detailed analysis of the repair mechanism, using extracts depleted of endogenous nucleotide pools. ATP was required for repair with a sharp optimal concentration of 5 mM. The initial rate of repair was increased by preincubation of the DNA in the extract in the presence of ATP. During this preincubation, the DNA was cleaved on the 5' side of the lesion by a class II apurinic-apyrimidinic endonuclease, but removal of the abasic sugar residue was not observed prior to addition of deoxynucleotides to the reaction. Immediately folowing DNA synthesis, excision and ligation proceeded in a coordinated manner to complete repair. DNA preincubated in the extract in the absence of deoxynucleotides remained associated with repair enzymes during gel filtration. These observations suggest that the enzymes involved in concerted repair of the abasic site form a complex on DNA.
Abasic sites are common intermediate products in base excision repair. The 3-hydroxy-2-hydroxymethyltetrahydrofuran residue is a structural analog of the sugar residue in the natural apurinic-apyrimidinic (AP) site (11). Because of its chemical stability, this residue can be introduced into oligonucleotides during automated DNA synthesis and eventually inserted into covalently closed circular DNA (cccDNA). Using DNA substrates which contain this synthetic abasic site at a defined position, we have developed accurate and sensitive assays for reactions involved in repair of this lesion. In a previous report (7), we described the vigorous repair of tetrahydrofuran residues in a cell extract derived from Xenopus laevis oocytes. In this repair reaction the tetrahydrofuran site was rapidly incised by a class II AP endonuclease, while the slower step of DNA synthesis required ATP and was quickly followed by ligation. The repair-related DNA synthesis was localized to a patch of one to a few nucleotides surrounding the abasic site. Our preliminary characterization of this repair process did not address several aspects of the repair mechanism. We have focused our recent experiments on the following questions. First, is the abasic sugar residue removed before or after DNA synthesis takes place? Second, does the close timing of DNA synthesis and ligation result from coupling of these reactions? If so, does this coupling include any physical interaction between the enzymes involved in those reactions? To address these questions, we have studied the repair reaction in extracts depleted of endogenous nucleotides. These extracts made it possible to control the initiation of DNA synthesis during the repair reaction. In this report we have characterized the sequential reactions involved in the repair of tetrahydrofuran residues. We also discuss the model of a repair complex suggested by these results.
*
MATERIALS AND METHODS
Materials. The sources of materials used in this work were as previously described (7) except for adenosine 5'-O-(3thiotriphosphate) (ATP-yS), which was obtained from Pharmacia. Construction of DNA. Tetrahydrofuran-containing cccDNA was prepared by procedures essentially similar to those described by Naser et al. (8) and Stanssens et al. (10) (Fig. 1A). In a typical preparation, 50 ,ug of pBS- double-stranded DNA (Stratagene) was digested with AvaI and EcoRI, deproteinized by extraction with phenol-chloroform, and precipitated with ethanol. The linear DNA was mixed with 50 ,ug of pBS- single-stranded DNA in 200 [lI of water and incubated for 15 min at 70°C. Then 20 [lI of annealing buffer (0.1 M Tris-Cl [pH 7.5], 1.5 M NaCl) was added, and the sample was gradually cooled to room temperature to form a gapped heteroduplex. One nanomole of the tetrahydrofurancontaining oligonucleotide with a sequence complementary to the gapped region of the heteroduplex was added to the DNA mixture and ligated at 4°C with T4 DNA ligase. cccDNA was purified by equilibrium centrifugation in CsCl and ethidium bromide. The concentration of recovered DNA was determined by fluorimetry (TK0100; Hoefer Scientific Instruments) in the presence of the dye Hoechst 33258 (4). For preparation of cccDNA prelabeled on the 3' or 5' side of the lesion, either the dephosphorylated EcoRI site of the double-stranded DNA or the 5' end of the oligonucleotide, respectively, was labeled with T4 polynucleotide kinase and [y-32P]ATP prior to heteroduplex formation. Depurinated DNA was prepared by incubation of closed circular plasmid DNA in depurination buffer (0.1 M NaCl, 10 mM NaP1, 10 mM sodium citrate [pH 5.0]) for 4 h at 70°C (5). The rate of formation of depurination sites was measured as follows. Samples were withdrawn from the depurination reaction at various times during the early stages of heat treatment and treated with exonuclease III to nick at abasic sites. The rate of generation of exonuclease III-sensitive sites was determined by agarose gel electrophoresis. Extrapolation of the initial rate of depurination over the complete
Corresponding author. 4441
4442
MATSUMOTO AND BOGENHAGEN
MOL. CELL. BIOL.
A
B
PVif
PvuD Time
CCGGGFACCGAGCTCG \1
C AATTC GGGCCCATGGCTCGAGCTTAAG
pBS- multiple cloning site
2
4
B
15
v
R C
_
-
probe uleaved (252 nt)' Repaired (382 nt) FIG. 1. Construction of the tetrahydrofuran-containing plasmid and assay for its repair in the oocyte extract. (A) Plasmid structure. The oligonucleotide containing a tetrahydrofuran residue (designated F) is ligated into the gapped heteroduplex of a pBS- plasmid vector to produce a cccDNA as described in Materials and Methods. This DNA is rapidly cleaved at the 5' side of the tetrahydrofuran residue when incubated in the X. Iaevis oocyte extract (7). This initial product is detected as a 252-nucleotide fragment following digestion with PvuII, denaturing polyacrylamide gel electrophoresis, and blot hybridization to a single-stranded RNA probe as described in Materials and Methods. Repair results in conversion of nicked fragments to a 382-nucleotide PvuII fragment. (B) Time course of a standard repair reaction. The incubation time for the reaction is indicated in minutes above each lane. R, repaired fragments; C, fragments cleaved at the tetrahydrofuran.
4-h treatment interval indicated that the DNA contained 5 pmol of depurinated sites per ,ug. S150 extract. The S150 extract was prepared as previously described (1, 7). A Sephadex G-25 column was used to remove nucleotides from the S150 extract. The column (0.75 by 21 cm) was preequilibrated with buffer containing 20 mM N-2-hydroxyethylpiperazine-N'-2-ethanesulfonic acid (HEPES; pH 7.5), 60 mM KCI, 2 mM ethyleneglycol-bis(paminoethyl ether)-N,N,N',N'-tetraacetic acid (EGTA), 10 mM a-glycerol phosphate, 2.5 mM dithiothreitol, 0.2 mM phenylmethylsulfonyl fluoride, 1 mM benzamidine-HCI, and 10% glycerol and then pretreated with 2 mg of bovine serum albumin. One milliliter of S150 extract (7 to 10 mg of protein per ml) was loaded on the column, and the fractions containing the peak of protein were pooled in 1 to 1.5 ml. The pooled fraction (S150GF) usually had 2 to 4 mg of protein per ml and less than 5% of the initial concentration of free nucleotides. DNA repair assay. The standard repair reaction mixture contains 10 ,ug of S15OGF protein, 10 ng of tetrahydrofurancontaining cccDNA, 5 mM ATP, and 50 ,uM each dATP, dCTP, dGTP, and dTTP in a 20-pdl reaction mixture containing 20 mM HEPES (pH 7.5), 60 mM KCI, 10 mM MgCl2, 2.5 mM dithiothreitol, 2.5 mM p-glycerol phosphate, 0.5 mM EGTA, and 2.5% glycerol. In most cases, the repair reaction was started by the addition of substrate DNA to the reaction mixture which had been preincubated for 5 min at 25°C. Reactions were stopped by addition of sodium dodecyl sulfate to a final concentration of 0.4%. After incubation with 10 ,ug of proteinase K for 10 min at 37°C, the sample was extracted with phenol-chloroform and precipitated along with 0.5 ,ug of tRNA in ethanol. The extracted DNA was digested with PvuII and then subjected to electrophoresis on a 6% denaturing polyacrylamide gel. Blot hybridization with a 32P-labeled RNA probe was done as described previously (7) except that the RNA probe was prepared by transcription of the EcoRI-digested template with T7 RNA polymerase. Autoradiograms were obtained without intensifying screens, and bands were quantified by densitometry (Ultroscan XL; LKB). Gel filtration of the repair complex. A Bio-Gel A-lSm column (bed volume, 2 ml; Bio-Rad) was pretreated with 2 mg of tRNA and 0.4 mg of gelatin and then equilibrated with
repair reaction buffer containing 0.1 mg of gelatin per ml, 0.01% Triton X-100, and 1 mM ATP but without a-glycerol phosphate and EGTA. A 25-ng sample of the tetrahydrofuran-containing DNA was incubated in S15OGF (25 jig of protein) in a volume of 50 RI under standard conditions but without deoxynucleoside triphosphates (dNTPs) for 10 min and then loaded on the column, which was run at room temperature. In some experiments (e.g., Fig. 7A), the DNA was quickly mixed with the extract and directly loaded on the column to assess the importance of preincubation. Eluted fractions (50 RI) were collected, supplemented with 5 ,uM [a-32P]dTTP (40 Ci/mmol) and 50 jiM each of the other three dNTPs, and incubated for 20 min at 25°C. After phenol-chloroform extraction and ethanol precipitation, DNA was digested with Hinfl, electrophoresed in a denaturing 20% polyacrylamide gel, and subjected to autoradiography. When repair complexes were subjected to gel filtration, the tetrahydrofuran-containing DNAs were pretreated with exonuclease III to ensure that the initial incision by an AP endonuclease did not limit the rate or extent of repair. Control experiments showed that DNA pretreated with exonuclease III was repaired in a standard repair assay with the same efficiency as was untreated DNA (data not shown). RESULTS Nucleotide requirements for the repair reaction. We have previously shown that a tetrahydrofuran residue that represents an analog of an abasic site in DNA is efficiently repaired in an S150 extract of X. laevis oocytes. Since the S150 extract contains nucleotide pools carried over from oocytes, the optimal concentrations of ATP and dNTPs for repair could not be determined accurately. We used gel exclusion chromatography to prepare a nucleotide-depleted extract (S15OGF) with essentially no loss of repair activity compared with the original S150 (Fig. 1B) (7). This S1SOGF extract supports repair of the tetrahydrofuran residue in the presence of ATP at 5 mM and dNTPs at >5 jiM (Fig. 2). The omission of dNTPs from the reaction mixture suppressed the repair activity. In the sequence shown in Fig. 1A, a thymidine residue should replace the tetrahydrofuran residue in DNA during repair. Control experiments with this DNA
REPAIR OF A SYNTHETIC ABASIC SITE
VOL. 11, 1991
4443
100 -
100
B 80 -
80
0
.-
-.4
Z
.4
0
0
z 60-i 10 0 /
60
.p40
10 .Is 40
d4
0
L.
L.4 20 20
02
0
1
3 2 dNTPs
4
(AM)
5
2
3
4 5 6 ATP (mM)
7
8
FIG. 2. Nucleotide requirements for repair in the extract following gel filtration. (A) dNTP requirement. Repair reactions were performed for 15 min with increasing amounts of dNTPs under the standard conditions as described in Materials and Methods. The repair products were analyzed as shown in Fig. 1B and quantified by densitometric scanning of the autoradiogram. Slightly higher repair was observed at 50 F.M than at 5 ,uM (data not shown). (B) ATP requirement. Reactions were performed for 15 min under two conditions. In one set, ATP was varied from 3 to 7 mM in the presence of 10 mM MgCl2 under standard conditions (0). In the second set, 3 to 7 mM Mg-ATP was added to reactions containing an excess of 5 mM MgCl2 (0).
substrate demonstrated that 0.1 ,uM dTTP without any other dNTPs could support more than 40% of the extent of repair observed under standard conditions with 50 ,uM dNTPs (data not shown). This result is consistent with our earlier observation that a significant fraction of repair events involve replacement of only the single damaged residue (7). Figure 2B shows the results of repair reactions performed to determine the optimal ATP concentration under two conditions. In one set of reactions, the ATP concentration was varied between 3 and 7 mM in the presence of 10 mM MgCl2; in the second set, the concentrations of both ATP and MgCl2 were varied to maintain a constant excess of 5 mM MgCl2. Under both conditions, ATP was required at a relatively high and extremely sharp optimal concentration of 5 mM. Changing the ATP concentration to 4 or 6 mM dramatically reduced the efficiency of repair. The fact that the same ATP optimum was observed under both conditions in Fig. 2B indicates that the sharp ATP optimum is not an artifact resulting from chelation of Mg2' by ATP. The exogenous ATP concentration required for optimal repair activity varies slightly, between 3.5 and 5.0 mM, in different extracts prepared from individual frogs. However, all extracts that we have prepared show a sharp optimum in the ATP requirement that is not fully understood at present. Neither ATP-yS, GTP, nor dATP could be substituted for ATP in the range of 3 to 7 mM (data not shown). Effect of preincubation. The dNTP requirement for repair suggests that in the absence of dNTPs, the repair reaction might be stalled at the step preceding DNA synthesis and might be reinitiated by addition of dNTPs. We tested this possibility by comparing the initial rate of repair with and without preincubation in the absence of dNTPs. As shown in Fig. 3, a 10-min preincubation of the DNA substrate in the absence of dNTPs significantly increased the initial rate of repair. This effect required preincubation of the substrate
6
mLini. after dNTPs addition F
S15OGF
AL, 6
dNTPs
4
F S15OGF 1 5n1 0
dNTPs 10
F
S15OGF
L
M1
dNTPu 16
mm.L
FIG. 3. Effect of preincubation in the absence of dNTPs. The tetrahydrofuran-containing DNA (F) was incubated with the extract including ATP for 10 min prior to addition of dNTPs. The repair reaction was reinitiated by addition of dNTPs. The repair products were analyzed as described in the legend to Fig. 2. Two control experiments without preincubation of DNA in the extract were also performed with the time courses diagrammed. Symbols represent the three different preincubation protocols, as diagrammed at the bottom.
exogenous
DNA in the extract prior to addition of dNTPs. Preincubation of the extract without DNA did not increase the initial rate of the reaction. Other control experiments showed that ATP was required at a very early stage of the reaction. Preincubation of the extract in the reaction buffer without ATP greatly inhibited repair and did not allow activation of repair by the subsequent addition of ATP (data not shown). Analysis of intermediate products. Our previous experiments (7) showed that repair was initiated by rapid cleavage by AP endonuclease followed by slower steps involving excision of the tetrahydrofuran residue and DNA synthesis. In these early experiments, we observed that ligation quickly followed DNA synthesis. These observations suggested that either DNA synthesis or the excision of an abasic residue, if it indeed preceded DNA synthesis, might be a rate-limiting step for this repair process. The availability of the nucleotide-dependent extract provided an opportunity to determine whether exonucleolytic removal of the tetrahydrofuran residue precedes DNA synthesis. We performed experiments with DNA templates labeled on either the 5' or 3' side of the tetrahydrofuran residue to monitor the fate of intermediate products throughout the repair process. In these experiments, the tetrahydrofuran-containing cccDNA was prelabeled with 32P at a distance of a few nucleotides on either the 5' or 3' side of its abasic site as described in Materials and Methods. When such prelabeled substrates are incubated in the extract, the DNA is cut rapidly at the 5' side of the lesion by a class II AP endonuclease (7). To monitor the fate of the prelabeled DNA substrate, we recovered the DNA after various periods of incubation and cut the DNA with Hinfl to yield the initial fragments diagrammed in Fig. 4C. This strategy allows us to monitor
4444
MATSUMOTO AND BOGENHAGEN
MOL. CELL. BIOL.
A 1 2 345
8
7
8
B 9
10
2
3
4
5
8
_-'imm -R-
7
8 9 10 11 12 13 14
_
_ _ ..~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~....
C
-E
__tema
..... .%
C
-c
ml
6'
ACTCTAGAGGATCCCCGGG
I*
FACCGAGCTCGAATTCGCCCTATAGTG
3
AP endcD. M2 FIG. 4. Analysis of intermediate products during the repair reaction. (A) Analysis of the fragment on the 5' side of the lesion. The DNA prelabeled upstream of the tetrahydrofuran (at *C in panel C) was incubated in the reaction mixture without (lanes 1 to 5) or with (lanes 6 to 10) dNTPs for 1 min (lanes 1 and 6), 2 min (2 and 7), 4 min (3 and 8), 8 min (4 and 9), or 20 min (5 and 10). The extracted DNA samples were digested with Hinfl, electrophoresed in a denaturing 20% polyacrylamide gel, and autoradiographed. C, initial fragments produced by cleavage by AP endonuclease; E, fragments elongated by one nucleotide; R, repaired products. (B) Analysis of the fragment on the 3' side of the lesion. The DNA prelabeled downstream of the tetrahydrofuran (at *A in panel C) was incubated in the reaction mixture without (lanes 1 to 6) or with (lanes 9 to 14) dNTPs for 0 min (lanes 1 and 9), 1 min (2 and 10), 2 min (3 and 11), 4 min (4 and 12), 8 min (5 and 13), or 20 min (6 and 14). The extracted DNA was analyzed as described for panel A. Molecular weight markers Ml and M2 (see panel C) were loaded on lanes 7 and 8, respectively. (C) Sequence of the Hinfl fragment cleaved by AP endonuclease. Asterisks indicate the two prelabeling positions either upstream or downstream of the tetrahydrofuran. The 26-nucleotide fragment Ml, one of the molecular weight markers used in panel B, was generated by digestion of labeled DNA containing a T residue instead of the tetrahydrofuran with RsaI and Hinfl. The second marker, M2, is identical to Ml except that it includes the tetrahydrofuran residue. M2 was generated by digestion of labeled DNA containing the tetrahydrofuran residue with exonuclease III and Hinfl.
the sizes of fragments on the 5' side (Fig. 4A) or on the 3' side (Fig. 4B) of the initial cleavage by the AP endonuclease. In the presence of exogenous dNTPs, the 5' fragment was gradually elongated by one or a few nucleotides (Fig. 4A, lanes 6 to 10). These elongated products did not accumulate but were rapidly ligated to the 3' fragment to complete repair. At the same time, the 3' fragment was gradually ligated to the 5' fragment (Fig. 4B, lanes 9 to 14). We think it significant that we did not detect a reduction in size of the 3' fragment which would have accompanied removal of the tetrahydrofuran residue from its 5' terminus. As shown in lane 7, removal of the tetrahydrofuran residue results in a detectable mobility shift. This does not mean that excision of the abasic residue did not occur during the repair process. We suggest that the excision of a tetrahydrofuran was followed by ligation too quickly to be detected as an intermediate product. The final product of repair has a normal nucleotide at the tetrahydrofuran site and is resistant to AP endonuclease (7). In the absence of dNTPs, we observed inefficient repair, probably as a result of residual low amounts of dNTPs in the extract after gel filtration. In this case as well, we did not detect shortened products of the downstream fragment (Fig. 4B, lanes 1 to 6). As long as DNA synthesis did not occur, the tetrahydrofuran remained at the 5' terminus of the downstream fragment. This means that the excision of a tetrahydrofuran residue is dependent on DNA synthesis.
Taken together, these results indicate that DNA synthesis is rapidly followed by excision and ligation. Inhibition by depurinated DNA. A tetrahydrofuran residue is repaired by a base excision repair mechanism that may also be a common mechanism for repair of natural AP sites. To test this possibility, we sought to determine whether repair of the tetrahydrofuran residue would be inhibited by depurinated plasmid DNA. In the experiment shown in Fig. 5, 100 ng of depurinated DNA (about 0.5 pmol of AP sites) inhibited repair of the tetrahydrofuran residue by 90%, while 500 ng of normal plasmid DNA still allowed repair of 70% of the substrate DNA. This result indicates that the repair of tetrahydrofuran residues involves the same rate-limiting steps as does repair of natural AP sites. The initial rate of repair is accelerated by preincubation of the DNA in the extract in the presence of ATP (Fig. 3). Therefore, some rate-limiting ATP-dependent interaction between substrate DNA and factors in the extract is required for repair prior to DNA synthesis. We performed the experiment shown in Fig. 6 to determine whether preincubation might produce a complex that is resistant to inhibition by a large excess of depurinated DNA. The results confirm that a significant percentage of tetrahydrofuran-containing DNA was efficiently repaired if it was preincubated in the extract prior to the addition of depurinated DNA. Simultaneous addition of the depurinated DNA completely inhibited repair of the tetrahydrofuran residue. We conclude that some
REPAIR OF A SYNTHETIC ABASIC SITE
VOL. 11, 1991
A 100 -
75
._-.
1 23 4 5 6 78 910
4445
B 1 2 3 4 5 6 7 8 9 10
l_ 0-4
Q
aL)
50
._
25 .
0 0
100
10
1000
competitor DNA (ng) FIG. 5. Inhibition of repair by depurinated competitor DNA. The repair of tetrahydrofuran-containing DNA in 8 min in the presence of increasing amounts of depurinated DNA (0) or normal plasmid DNA (0) was measured. The relative repair activities were calculated as the percentage of the activity in the absence of competitor DNA.
repair enzymes, which could otherwise be titrated by depurinated DNA, might form a complex at a tetrahydrofuran site in DNA during preincubation. Gel filtration of a repair complex. To further characterize the putative repair complex, we attempted to detect repair activity associated with DNA following size exclusion chromatography on a column with a very high exclusion limit. The tetrahydrofuran-containing DNA was preincubated in the reaction mixture without dNTPs and loaded on a Bio-Gel A-15m gel filtration column as described in Materials and
40I--
IzI30
AA
la *0
20 U-
04
10 . A
0
8 12 4 min after dNTPs addition
F S15OGF depur.DNA 5
m1m
F
S15OGF
16
I
Mb
16
dNTPs 10mm.
depur.DNA 10
dNTPa
A, A
I
*
4
nin =i
FIG. 6. Evidence that preincubation of DNA in the extract alleviates inhibition by depurinated DNA. The tetrahydrofurancontaining DNA (F) was incubated with the extract including ATP for 10 min prior to addition of 200 ng of depurinated DNA. After further incubation for 1 min (A) or 4 min (-), the repair reaction was reinitiated by addition of dNTPs. In a control experiment (0), the depurinated DNA was added simultaneously with the tetrahydrofuran-containing DNA in the time course diagrammed.
vol.(ml) 0.8 0.9 1.0 1.1
0.8 0.9 1.0 1.1
FIG. 7. Coelution of repair activity with the tetrahydrofurancontaining DNA from a gel filtration column. (A) Bio-Gel A-15m chromatography of the DNA without preincubation in the extract. The tetrahydrofuran-containing DNA (nicked by pretreatment with exonuclease III) was loaded on a gel filtration column immediately after mixing with the extract in the absence of dNTPs. The repair activity of eluted fractions was analyzed as described in Materials and Methods. (B) Bio-Gel A-15m chromatography of the DNA preincubated in the repair reaction. The tetrahydrofuran-containing DNA (pretreated with exonuclease III) was incubated in S15OGF in the absence of dNTPs for 10 min and then loaded on a column. In lane 1 of each panel, the sample treated without gel filtration was loaded.
Methods. Plasmid DNA eluted from this column after about 0.9 ml, while most free proteins, including molecules as large as ferritin (molecular weight 440,000), eluted after 1.5 ml. Approximately 5% of the protein applied to the column coeluted with the DNA. The eluted fractions containing DNA were then incubated with radioactive dNTPs, and the repaired products were analyzed by gel electrophoresis. In this assay, if the activities of DNA synthesis and ligation coeluted with DNA, repair would be detected as incorporation of 32P into the restriction fragment containing the tetrahydrofuran residue. Figure 7 shows that a significant fraction of the DNA preincubated in the extract for 10 min prior to gel filtration was repaired during subsequent incubation in the presence of dNTPs. In contrast, essentially none of the DNA loaded on the gel filtration column immediately after mixing with S15OGF was repaired. This result suggests that enzymes involved in DNA synthesis, excision of the lesion, and ligation associate with DNA during preincubation in the absence of deoxynucleotides. However, the presence of a relatively large amount of unligated polymerization products in Fig. 7B is consistent with the possibility that these complexes are relatively deficient in either the tetrahydrofuran excision activity or DNA ligase. We were concerned with the possibility that the extent of DNA repair observed in Fig. 7B might result from coelution of protein associated nonspecifically with DNA rather than from assembly of a specific repair complex. We performed another experiment to distinguish between these two possibilities. In this experiment, cccDNA containing a single tetrahydrofuran residue was preincubated in the extract and recovered following gel exclusion chromatography on Bio-
4446
MATSUMOTO AND BOGENHAGEN
12 3 4
MOL. CELL. BIOL.
5 67 8 Incision AP endonuclease
R
Repair complex formation
Io11UVT DNA synthesis
E Excision & ligation
FIG. 8. Challenge of repair complexes by an excess amount of abasic DNA. Tetrahydrofuran-containing DNA (30 ng) was preincubated with 30 ,ug of extract in a volume of 60 ,ul and loaded on a Bio-Gel A-15m gel filtration column as described in Materials and Methods. The eluate from 0.8 to 1.1 ml was collected and divided into two aliquots; 200 ng of the depurinated DNA (pretreated with exonuclease III as a source of AP endonuclease) was added to one of the reactions. The aliquots were incubated at 25°C either without (lanes 1 to 4) or with (lanes 5 to 8) 200 ng of depurinated DNA. After various time points (1 min in lanes 1 and 5, 2 min in lanes 2 and 6, 4 min in lanes 3 and 7, and 8 min in lanes 4 and 8), aliquots were removed and added to radioactive dNTPs to allow repair reactions to resume. These reactions, containing 0.3 ,uM dNTPs and 8 ,uCi of [a-32P]dTTP, were continued for 20 min at 25°C. The extracted DNA from each sample was analyzed as described above. DNA was electrophoresed in a denaturing 20% polyacrylamide gel after digestion with Hinfl. R, repaired products; E, fragments elongated but not ligated. The depurinated DNA added after gel filtration does not produce the Hinfl fragment with the same size as the repair product from the tetrahydrofuran-containing DNA.
Gel A-15m. If repair following gel filtration required redistribution of proteins bound in a rather nonspecific fashion to the DNA, we would expect this repair to be inhibited by a large excess of DNA that had been extensively depurinated and nicked at the abasic sites. Repair of tetrahydrofuran sites was monitored after incubation of the excluded peak with excess depurinated DNA for time periods ranging from 1 to 8 min. As shown in Fig. 8, the tetrahydrofurancontaining DNA was repaired at a comparable level either with or without competitor DNA. These results show that some limiting component of the repair machinery binds persistently to abasic sites after cleavage by AP endonuclease. This association of repair proteins with the tetrahydrofuran residues can survive gel filtration and challenge by an excess of depurinated DNA.
DISCUSSION Significant progress has been made recently in describing DNA repair reactions in soluble extracts from eukaryotic cells. In these experiments, various well-defined DNA lesions were studied as substrates for repair reactions. The repair of pyrimidine dimers, acetylaminofluorene adducts, and psoralen monoadducts in human cell extracts were
FIG. 9. Pathway for repair of a tetrahydrofuran residue. See the text for discussion.
enhanced by Escherichia coli UvrABC proteins (2, 3), suggesting that their repair proceeds by a nucleotide excision pathway. In addition, several groups have reported in vitro repair of base pair mismatches (12-14). Additional experiments will be required to compare the mechanism of repair of these lesions with the repair of abasic sites. We have focused our attention on the repair of precisely positioned tetrahydrofuran residues in DNA in an X. laevis oocyte extract. This synthetic analog of an abasic site in DNA resembles the product of spontaneous depurination or base excision events that may represent the most common type of DNA damage (6). We have previously shown that the X. laevis oocyte extract is capable of repairing these lesions rapidly. Efficient repair requires addition of a precisely controlled concentration of ATP (Fig. 2). This observation has an important practical consequence for efforts to study DNA repair processes in vitro. If initial efforts to detect repair activity do not employ an optimal ATP concentration, repair might not be observed. The efficiency of repair under optimal conditions has allowed us to determine the order of events in repair of this lesion. The order of subreactions during repair of the tetrahydrofuran residue. Along with our previous experiments (7), the analysis of intermediate repair products has established the order of sequential reactions shown in Fig. 9. The initial incision by class II AP endonuclease can occur independently of the subsequent steps. Cleavage of the substrate is completed in 15 s (7) and requires neither ATP nor dNTPs. DNA which was cleaved at the tetrahydrofuran site by pretreatment with exonuclease III was repaired with the same efficiency as uncleaved DNA. In contrast, DNA synthesis occurs at a slower rate than incision and is coordinated with excision and ligation. The detailed kinetic analysis of intermediates in repair presented in Fig. 4 suggests that DNA synthesis precedes excision of the lesion from the DNA. The 5' -- 3' exonuclease activity that removes the tetrahydrofuran residue is dependent on deoxynucleotides and presumably on polymerization. Such a dNTP depen-
REPAIR OF A SYNTHETIC ABASIC SITE
VOL . 1 l, 1991 dence would not be
expected for the
5'
-+
ated
5'
--
3'
exonuclease
activity.
Although
5'
--
3'
exonuclease activity has not been documented for eukaryotic DNA polymerases, a potential damage-specific nuclease activity would not have been detected in routine assays for 5'
-*
3' exonuclease
activity.
ACKNOWLEDGMENTS
3' exonuclease
activity of a classical repair polymerase, such as DNA polymerase I of E. coli. The overall repair could be accomplished by any of several mechanisms. The DNA polymerase that accomplishes this repair may have a tightly associ-
A second alternative is sug-
gested by experiments examining the properties of purified enzymes that may be involved in DNA repair. These experiments have shown that exonuclease activity can follow limited displacement DNA synthesis (9). However, we are not aware of any previous evidence for this sort of strand displacement synthesis in the context of site-specific repair. The failure to observe an intermediate product in which the downstream fragment was shortened by exonucleolytic removal of the abasic residue requires that excision and ligation be very tightly linked reactions. Experiments are in progress to further characterize the DNA polymerase and exonuclease activities responsible for this repair. Wood et al. (15) have reported that the gap filling and ligation in the course of pyrimidine dimer repair proceed rapidly after the initial incision has occurred. This repair also requires a high concentration of ATP at a very early stage. However, the limited efficiency of this in vitro eukaryotic repair system has not yet permitted a detailed analysis of the order of events in the repair of pyrimidine dimers. Assembly of a repair complex. The nick introduced by the AP endonuclease appears to trigger the assembly of a repair complex on the DNA. The AP endonuclease is unlikely to be involved in this complex because the initial incision by this enzyme can be independent of the subsequent reaction steps. Several experiments suggest that the ATP-dependent formation of the complex might be a rate-limiting step in the repair reaction. Once it is assembled, the complex rapidly completes repair in the presence of dNTPs. This would appear to be a very reasonable strategy for the cell to adopt to repair its DNA, since the concerted action of the repair complex minimizes the exposure of intermediates in DNA repair to other nuclear proteins that might initiate aberrant repair activities. This complex can be maintained at least briefly at the synthetic abasic site in the absence of dNTPs. The data shown in Fig. 7 and 8 indicate that the repair complex assembled on the DNA can survive gel filtration. Although a fraction of the repair complexes survives challenge by a large excess of depurinated DNA, some component(s) of the complex probably dissociate in the absence of dNTPs, as shown in Fig. 6. Additional experiments will be required to identify the proteins required for repair and to determine which of these are most tightly bound in the repair complex that survives gel filtration. We expect that the characterization of the overall repair reaction described here will be helpful for developing a reconstituted repair system with purified enzymes.
4447
This research was funded by grant ES04068 from the National Institute of Environmental Health Sciences. We thank Rob Rieger for synthesis of the oligonucleotides bearing tetrahydrofuran residues that have made this work possible. We also thank Arthur P. Grollman for critical reading of the manuscript.
1. 2.
3.
4.
5. 6. 7.
8.
9. 10.
11.
12. 13.
14.
15.
REFERENCES Glikin, G. C., I. Ruberti, and A. Worcel. 1984. Chromatin assembly in Xenopus oocytes: in vitro studies. Cell 37:33-41. Hansson, J., L. Grossman, T. Lindahl, and R. D. Wood. 1990. Complementation of the xeroderma pigmentosum DNA repair synthesis defect with Escherichia coli UvrABC proteins in a cell-free system. Nucleic Acids Res. 18:35-40. Hansson, J., M. Munn, W. D. Rupp, R. Kahn, and R. D. Wood. 1989. Localization of DNA repair synthesis by human cell extracts to a short region at the site of a lesion. J. Biol. Chem. 264:21788-21792. Labarca, C., and K. Paigen. 1980. A simple, rapid, and sensitive DNA assay procedure. Anal. Biochem. 102:344-352. Lindahl, T., and B. Nyberg. 1972. Rate of depurination of native deoxyribonucleic acid. Biochemistry 11:3610-3618. Loeb, L. A. 1985. Apurinic sites as mutagenic intermediates. Cell 40:483-484. Matsumoto, Y., and D. F. Bogenhagen. 1989. Repair of a synthetic abasic site in DNA in a Xenopus laevis oocyte extract. Mol. Cell. Biol. 9:3750-3757. Naser, L. J., A. L. Pinto, S. J. Lippard, and J. M. Essigmann. 1988. Extrachromosomal probes with site-specific modifications. Construction of defined DNA substrates for repair and mutagenesis studies, p. 205-217. In E. C. Friedberg and P. C. Hanawalt (ed.), DNA repair. A laboratory manual of research procedures, vol. 3. Marcel Dekker, Inc., New York. Randahl, H., G. C. EUliott, and S. Linn. 1988. DNA repair reactions by purified HeLa DNA polymerases and exonucleases. J. Biol. Chem. 263:12228-12234. Stanssens, P., C. Opsomer, Y. M. McKeown, W. Kramer, M. Zabeau, and H.-J. Fritz. 1989. Efficient oligonucleotide-directed construction of mutations in expression vectors by the gapped duplex DNA method using alternating selective markers. Nucleic Acids Res. 17:4441-4454. Takeshita, M., C.-N. Chang, F. Johnson, S. Will, and A. P. Grollhman. 1987. Oligodeoxynucleotides containing synthetic abasic sites: model substrates for DNA polymerases and apurinic/apyrimidinic endonucleases. J. Biol. Chem. 262:1017110179. Thomas, D. C., J. D. Roberts, and T. A. Kunkel. 1991. Heteroduplex repair in extracts of human HeLa cells. J. Biol. Chem. 266:3744-3751. Varlet, I., M. Radman, and P. Brooks. 1990. DNA mismatch repair in Xenopus egg extracts: repair efficiency and DNA repair synthesis for all single base-pair mismatches. Proc. Natl. Acad. Sci. USA 87:7883-7887. Wiebauer, K., and J. Jiricny. 1990. Mismatch-specific thymine DNA glycosylase and DNA polymerase 1B mediate the correction of G:T mispairs in nuclear extracts from human cells. Proc. Natl. Acad. Sci. USA 87:5842-5845. Wood, R. D., P. Robins, and T. Lindahl. 1988. Complementation of the xeroderma pigmentosum DNA repair defect in cell-free extracts. Cell 53:97-106.
