Ecotoxicology and Environmental Safety 112 (2015) 7–14

Contents lists available at ScienceDirect

Ecotoxicology and Environmental Safety journal homepage: www.elsevier.com/locate/ecoenv

Relative developmental toxicities of pentachloroanisole and pentachlorophenol in a zebrafish model (Danio rerio) Yan Cheng, Marc Ekker, Hing Man Chan n Center for Advanced Research in Environmental Genomics, University of Ottawa, 30 Marie Curie, Ottawa, ON, Canada K1N 6N5

art ic l e i nf o

a b s t r a c t

Article history: Received 22 August 2014 Received in revised form 3 October 2014 Accepted 6 October 2014

Pentachloroanisole (PCA) and pentachlorophenol (PCP) are chlorinated aromatic compounds that have been found in the environment and in human populations. The objective of this study is to characterize the effects of PCA in comparison to those of PCP on development at environmental relevant levels using a fish model. Zebrafish embryos were exposed to 0.1, 1, 10, 100, 500, 1000 μg/L PCA and PCP respectively for 96 h. Malformation observation, LC50 testing for survival rate at 96 hours post fertilization (hpf) and EC50 testing for hatching rate at 72 hpf indicated that the developmental toxicity of PCP was about 15 times higher than that of PCA. PCP exposure at 10 μg/L resulted in elevated 3, 3′, 5-triiodothyronine (T3) levels and decreased thyroxine (T4) levels, whereas PCA had no effects on T3 or T4 levels. PCP and PCA exposure at 1 and 10 μg/L showed possible hyperthyroid effects similar to that of T3, due to increased relative mRNA expression of synapsin I (SYN), iodothyronine deiodinase type III (Dio3), thyroid hormone receptor alpha a (THRαa) and thyroid hormone receptor beta (THRβ), and decreased expression of iodothyronine deiodinase type II (Dio2). The results indicate that both PCA and PCP exposure can cause morphological deformities, possibly affect the timing and coordination of development in the central nervous system, and alter thyroid hormone levels by disrupting thyroid hormone regulating pathways. However, the developmental toxicity of PCA is at least ten times lower than that of PCP. Our results on the relative developmental toxicities of PCA and PCP and the possible underlying mechanisms will be useful to support interpretation of envrionmental concentrations and body burden levels observed in human populations. & Elsevier Inc. All rights reserved.

Keywords: Pentachloroanisole (PCA) Pentachlorophenol (PCP) Developmental Toxicity Thyroid Hormone Zebrafish (Danio rerio)

1. Introduction Pentachlorophenol (PCP) has been extensively used as a pesticide and biocide primarily for wood preservation worldwide (Seiler, 1991). It is ubiquitous in the environment and food products and is considered a priority toxic pollutant (EC, 2013; EU, 2010; USEPA, 2000). Pentachloroanisole (PCA) has industrial applications but is not manufactured commercially, even though it is also widely distributed in the environment (NTP, 1993). It is believed that PCA is formed mainly from methylation of PCP by bacteria and fungi in the environment (Lamar and Dietrich, 1990; Okeke et al., 1997; Walter et al., 2004). Concentrations of PCP in the environment have been widely reported, for example in water samples up to 10 μg/L (Euro Chlor, 1999; UNECE, 2008; Zheng et al., 2011). Data for PCA are more limited. Both PCA and PCP have been shown to be present in the placenta and paired breast milk samples, suggesting prenatal and postnatal exposure to both chemicals and potential effects on the development of the n

Corresponding author. Fax: þ 1 613 562 5385. E-mail address: [email protected] (H.M. Chan).

http://dx.doi.org/10.1016/j.ecoenv.2014.10.004 0147-6513/& Elsevier Inc. All rights reserved.

offspring (Glinoer, 1997; Glinoer and Delange, 2000; Haddow et al., 1999; Klein et al., 1991; Pop et al., 1999). Results from the literatures show that the PCP concentrations in maternal and/or cord blood samples are generally below 10 ng/g (Dallaire et al., 2009; Guvenius et al., 2003; Meijer et al., 2008; Meijer et al., 2012; Park et al., 2008; Roze et al., 2009), and PCA are generally below 1 ng/g (Damgaard et al., 2006; Shen et al., 2007). PCP was found to disrupt thyroid functions of the rat offspring (Kawaguchi et al., 2008) and zebrafish (Guo and Zhou, 2013; Yu et al., 2014) by altering hypothalamus–pituitary–thyroid (HPT) axis related gene expressions and thyroid homone levels. Sub-lethal effects of PCP on the development of zebrafish embryo have been reported (Duan et al., 2008). Noticeably, neonates birth defects (Dimich-Ward, et al., 1996), cognitive and behavior disruption at school aged children (Roze et al., 2009) and cord plasma free T4 (fT4) concentration alteration in neonates (Dallaire et al., 2009) were reported after paternal exposure to PCP in humans. The toxicity of PCA is less well known, no data on effects of PCA in animal models or in human populations, but it has been reported that it could cause carcinogenicity (NTP, 1993). PCA appeared less toxic than PCP in rats in terms of fetal resorption and skeletal variations (Welsh et al., 1987) but the

8

Y. Cheng et al. / Ecotoxicology and Environmental Safety 112 (2015) 7–14

molecular and physiological responses are not known. Since PCA is ubiquitous in the environment and its developmental toxicity or mode of action is still largely unknown, the objective of this study is to compare the developmental toxicity of PCA to that of PCP and to examine the possible molecular changes underlying the affected pathways specifically related to thyroid function in zebarfish. The zebrafish thyroid system is similar to that of mammals and zebrafish has become a popular model to screen for thyroid-disrupting chemical pollutants (Porazzi et al., 2009; Power et al., 2001). The objective of this study is to study the relative developmental toxicity of PCA to PCB using a zebrafish model. The overall hypothesis is that PCA has a similar effect to PCP in modulating the thyroid function of the zebrafish larvae with similar mechanisms.

2. Materials and methods 2.1. Chemicals PCA (CAS 1825-21-4, analytical standard), PCP (CAS 87-86-5, analytical standard), 3.3′,5-triiodothyronine (T3), 6-propyl-2-thiouracil (PTU), dimethyl sulfoxide (DMSO) and barbital buffer (pH 8.6) were obtained from Sigma-Aldrich Chemical Co. (Oakville, Ontario, Canada). Trizol reagent was from Invitrogen Life Technologies (Carlsbad, CA, USA). GoScript™ Reverse Transcription System was from Promega Corporation (Madison, WI, USA), and Maxima SYBR Green qPCR Master Mix from Thermo Fisher Scientific Company (Ottawa, Ontario, Canada). Primers were obtained from Integrated DNA Technologies, Inc. (Toronto, Ontario, Canada). 2.2. Animal maintenance All experiments were performed according to the guidelines of the Canadian Council on Animal Care and were approved by the University of Ottawa's animal care committee. Zebrafish and embryos were maintained at 28.5 °C according to previous methods (Westerfield, 2000). Wild-type adult zebrafish were kept and bred in circulating fish water at 28.5 °C with a controlled 14 h light cycle. 2.3. Experiment design Embryos were collected at the one-cell-stage in glass petri dishes, and exposed to a nominal concentration of 0.1, 1, 10, 100, 500, 1000 μg/L PCA or PCP in 0.01% DMSO for 96 hours post fertilization (hpf). The doses were chosen to be within the range reported in surface waters and maternal and cord blood. Control embryos received 0.01% DMSO only. Three replicates were performed for each exposure, control and blank group, and 20 embryos per group were collected for malformation observation, survival rate, hatching rate and gene transcription assays, 60 embryos per group for thyroid hormone measurement. For comparison, hyperthyroidism was induced by exposure zebrafish embryos to 10 μg/L T3 (Blanton and Specker, 2007; Teerds et al., 1998). Dosing solutions were renewed gently every day, and all embryos were raised at similar densities in a 28.5 °C incubator. After 96 h exposure to 1 and 10 μg/L PCA or PCP, larvae were randomly sampled, immediately frozen in liquid nitrogen, and stored at  80 °C for subsequent gene transcriptions and thyroid hormone assays. The malformation, survival and hatching were also recorded. 2.4. Malformation observation Acute endpoints used for assessing the developmental toxic effects of PCA and PCP included hatching success, survival/mortality, and malformation (OECD, 2013; Hermsen et al., 2011; van den Brandhof and Montforts, 2010). Morphological deformities, including pericardial edema, yolk sac edema, eye edema, malformation of the head, malformation of sacculi/otoliths, malformation of tail, malformation of heart, modified chorda structure, scoliosis, rachischisis, yolk deformation and abnormal pigmentation, were examined under a stereomicroscope at 24, 48, 72, 96 hpf after exposure to 0.1, 1, 10, 100, 500, 1000 μg/L PCA or PCP respectively.

2.6. Thyroid Hormone extraction and measurement The methods for whole body thyroid hormone extraction and measurement were adopted from previous methods (Schmidt and Braunbeck, 2011; Shi et al., 2009) in zebrafish. 60 larvae were homogenized in 0.5 mL ice-cold methanol with 1 mM PTU. The homogenates were dispersed by intermittent sonic oscillation for 5 min on ice and vortexed for 10 min. After centrifugation at 3500  g and 4 °C for 20 min, the supernatants were collected, and the pellets were re-extracted with 0.5 mL ice-cold methanol/PTU and centrifuged again. The freshly collected supernatant was combined with the original supernatant and vacuum dried overnight at room temperature. The samples were redissolved in 0.10 mL methanol, 0.4 mL chloroform, and 0.10 mL 0.11 M barbital buffer (pH 8.6). The mixture was vortexed for 3 min and centrifuged at 3,500  g and 4 °C for 15 min. The upper layer was carefully collected and immediately used for the T3 and thyroxine (T4) measurements performing with commercial kits (Diagnostic Automation/ Cortez Diagnostics Inc., Calabasas, USA) according to the manufacturer's instructions. The minimal detectable concentration of T3 and T4 by the assay was 0.2 ng/mL and 0.4 ng/mL respectively. For T3 and T4, the intra-assay coefficients of variance (CV) were o 10%, and inter-assay CVo 14%. 2.7. RNA extraction and real-timeRT-PCR The zebrafish thyroid gland is formed around 55–60 hpf (Opitz et al., 2013; Alt et al., 2006) and thyroid hormone related expression are apparent early during embryonic development (Liu and Chan, 2002; Walpita et al., 2007), which provides feasibility to study the developmental toxicities by measuring the thyroid hormone related expression at 96 hpf. RNA was extracted using Trizol reagent, and reverse transcribed into cDNA using the GoScript™ Reverse Transcription System according to the manufacturer's instructions. Real-time quantitative RT-PCR was performed with Maxima SYBR Green qPCR Master Mix using a Biorad C1000 Thermal Cycler PCR system (Stratagene, La Jolla, CA, USA). The primer sequences are listed in Table 1. The melt curve was measured by raising the temperature from 60 °C slowly to 95 °C at a speed of 0.5 °C/s, to verify a single amplicon was produced. Expression data were adjusted relative to the expression of elongation factor 1α (EF1α) due to the stable expression of EF1α for PCA and PCP in the experiment. 2.8. Statistical analysis The normality of the data was analyzed using the Kolmogorov–Smirnov test, and if necessary, data were log transformed to approximate normality. Homogeneity of variances was verified by Levene's test. For survival and hatching rates, as these data were presented as proportions, they were square root arcsinetransformed before analysis of variance. LC50 and EC50 were calculated using Sigmoid Fit. All data were shown as mean 7standard deviation (SD) and analyzed by one-way analysis of variance (ANOVA), followed by Tukey's test. Data were considered significantly different at Po 0.05 (JMPs 10 PC, Statistics Discovery, USA).

3. Results 3.1. Malformation observation No effect was observed in the zebrafish embryos or larvae when exposed to the vehicle control of 0.01% DMSO. All embryos exposed to PCP at 1000 mg/L died after 24 h and those exposed to the doses of 100 and 500 mg/L died after 48 h. Some of the representative photographs for the malformations of larvae exposed to PCA and PCP are presented in Fig. 1. The observed malformations included yolk deformation, malformation of tail (compared to blank), scoliosis, hemorrhage and pericardial edema. The lowest-observed-effect concentration (LOEC) for apparent malformation for PCA and PCP is shown in Table 2. It indicated that PCA and PCP both could induce morphological deformities, but PCA is at least 50 times less toxic (malformation of the tail) compared to PCP. However PCA caused pericardial edema in embryos and the effect was not seen for PCP.

2.5. Survival rates and hatching rates

3.2. Survival rates and hatching rates

Mortality was identified as coagulation, missing heartbeat, failure to develop somite, and a non-detached tail. LC50 for survival rates at 96 hpf and EC50 for hatching rates at 72 hpf were tested after exposure to 0.1, 1, 10, 100, 500, 1000 μg/L PCA or PCP respectively.

Survival rates at 96 hpf and hatching rates at 72 hpf for PCA and PCP treated larvae are shown in Fig. 2. The survival and hatching rates of the control are both 96.7%. For PCP, the larvae exposed at

Y. Cheng et al. / Ecotoxicology and Environmental Safety 112 (2015) 7–14

100, 500 and 1000 μg/L concentration all died, and other groups exposed at 0.1, 1 and 10 μg/L had decreased survival and hatching rates in a dose-dependent manner. Compared to PCP, the acute toxicity of PCA was significantly lower. The LC50 at 96 hpf was calculated to be 21.8 μg/L (95% CI 10.1–70.6) for PCP and 329 μg/L (95% CI 143–1032) for PCA. EC50 for hatching at 72 hpf was calculated to be 20.4 μg/L (95% CI 8.79–75.9) for PCP and 298 μg/L

9

(95% CI 125–980) for PCA. Therefore, the effect of PCA on hatching is at least ten times lower than that of PCP. 3.3. T3 and T4 contents The whole-body T3 and T4 levels after exposure to 10 μg/L of PCP were increased by 34.6% and decreased by 46.1% respectively,

Table 1 Primer sequences and cycling parameters used for gene amplification. Gene ID

GenBank ID

Forward and reverse primer

Elongation Factor 1α (EF1α) Synapsin I (SYN)

NM_131263 NM_001126437.2

Transthyretin (TTR)

BC081488.1

Iodothyronine Deiodinase type I (Dio1)

BC076008

Iodothyronine Deiodinase type II (Dio2)

BC059608

Iodothyronine Deiodinase type III (Dio3)

NM_001177935.2

Thyroid hormone receptor alpha a (THRαa)

NM_131396

Thyroid hormone receptor beta (THRβ)

NM_131340

(fwd): ATCACCAAGGAAGTCAGCG (rev): ATCTTCCATCCCTTGAACCAG (fwd): CAGCATGCGTTCAGTATGGC (rev): CCTGGTCGATCAGTGGGAAC (fwd): CGGGTGGAGTTTGACACTTT (rev): GCTCAGAAGGAGAGCCAGTG (fwd):GTTCAAACAGCTTGTCAAGGACTTC (rev): AGCAAGCCTCTCCTCCAAGTT (fwd): CATCAGCGGTAAGACCCACAA (rev): AAGACCGGCAGCTGGCTTATA (fwd): GAGACCGCTGATCCTCAACTTC (rev): TCGATGTACACCAGCAGAGAGT (fwd): CTATGAACAGCACATCCGACAAG (rev): CACACCACACACGGCTCATC (fwd): ATCGACCAGAGCCCACACA (rev): TAGGTGCCGATCCAATGTCTT

Fig. 1. Representative photographs for zebrafish larvae are shown to illustrate the sub-lethal responses: (A) normal blank control for 48 h (A-I), 72 h (A-II) and 96 h (A-III); (B) exposure to PCA at 1000 μg/L 48 h (B-I), 500 μg/L 72 h (B-II) and 1000 μg/L 96 h (B-III); (C) exposure to PCP at 10 μg/L 48 h (C-I), 0.1 μg/L 72 h (C-II) and 0.1 μg/L 96 h (C-III) respectively. Scale bar¼ 200 μm. MT – malformation of tail, YD – yolk deformation, SC – scoliosis, HE – hemorrhage, PE – pericardial edema.

10

Y. Cheng et al. / Ecotoxicology and Environmental Safety 112 (2015) 7–14

Table 2 The lowest-observed-effect concentration (LOEC) for apparent malformation for PCA and PCP respectively. Morphological deformities

Yolk deformation Malformation of tail Scoliosis Hemorrhage Pericardial edema

LOEC PCA

PCP

1000 μg/L 96 h 500 μg/L 72 h 1000 μg/L 96 h N/A 1000 μg/L 48 h

0.1 μg/L 72 h 10 μg/L 48 h 0.1 μg/L 96 h 0.1 μg/L 96 h N/A

and showed significant difference relative to the control (Fig. 3). No significant differences were observed for T3 or T4 levels after PCA exposure (Fig. 3).

4. mRNA gene expression The results for the mRNA expression changes after exposure to PCA, PCP and T3 are shown in Fig. 4. PCA and PCP both increased the expression of SYN and Dio3 and decreased the expression of Dio2, no effect was observed for TTR or Dio1 expression. Only PCP but not PCA increased the expression of THRαa and THRβ. As a positive control, 10 μg/L T3 increased the expression of SYN, Dio3, THRαa and THRβ, and decreased the expression of Dio2.

5. Discussion The sub-lethal and lethal toxicities of PCA and PCP were compared at the nominal concentration range (0.1, 1, 10, 100, 500, 1000 μg/L), covering the reported PCA and PCP concentrations in water samples and maternal and/or cord blood samples as aforementioned. To further explore the underneath possible molecular mechanism and affected pathways, the effects on thyroid hormone levels and gene transcription were measured at 1 and 10 μg/L of PCA and PCP exposure levels, which are the typical environmental exposure levels and also the reported levels in maternal and/or cord blood samples. Mortality results showed that PCP was much more toxic than PCA on the development of zebrafish embryos. The LC50 for survival rate at 96 hpf and EC50 for hatching at 72 hpf for PCA were at least 10 times higher than those of PCP. LC50 at 96 hpf for PCP in zebrafish larvae observed in our study was 21.8 μg/L, falling in the reported range of 20–600 μg/L for acute LC50 values in warmwater fish species (Euro Chlor, 1999). In adult zebrafish, the LC50 at 96 hpf for PCP was reported as 0.13 mg/L (Yin et al., 2006), which is higher than our LC50 values possibly due to the different fish development age. Sub-lethal effects, such as yolk deformation, malformation of tail, scoliosis and hemorrhage were observed after 96 hpf exposure to PCA and/or PCP in our study. Only PCA was shown to induce pericardial edema, and pericardial edema was often considered as the result of heart failure or circulatory failure (Fraysse et al., 2006). So PCA seemed to affect heart functions and possibly renal blood flow specifically (Merrill, 1946). More studies are needed to investigate the underlying mechanism. PCP has been reported to result in delayed hatching and tail deformations in zebrafish embryos after 72 h pdf (Duan et al., 2008), with similar sub-lethal effects as for our results. Again effects of PCA were found to be about 10–100 fold less toxic.

Fig. 2. The survival rates at 96 hpf (A) and the hatching rates at 72 hpf (B) in zebrafish exposed to PCA and PCP at the levels of 0.1, 1, 10, 100, 500, 1000 μg/L respectively. Data are shown as mean 7 SD from three replicates (n¼ 20 larvae per group). Significant differences (P o0.05) between the groups at the same exposure levels are marked by asterisks.

PCP can be methylated to more lipid-soluble PCA, and the methylation of the -OH group in PCP to the hydrophobic –OCH3 in PCA might result in a decrease in toxicity (UNECE, 2008). This is similar to the toxicity of anisole which is less toxic than phenol as the –OH in phenol is substituted by –OCH3 in anisole (USEPA, 2002). This structural change could explain the results observed in this study that both acute and sub-lethal toxic effects of PCA were lower than those of PCP. Even though biomethylation of PCP to PCA is a ubiquitous reaction, it is generally not the major route of PCP degradation (Valo and Salkinoja-Salonen, 1986). PCP metabolizes aerobically in aqueous medium and in soils with a half-life of 14 days, and in anaerobic aquatic soil with a half-life of 1–2 months (UNECE, 2008). Therefore, in the time frame of our study, the amount of PCA being metabolized into PCA will be negligible. Results of thyroid hormone assay showed that exposure to PCP disrupts the thyroid hormone homeostasis by decreasing T4 levels and increasing T3 levels, the same trend as in previous report (Guo and Zhou, 2013). The decline of T4 contents after PCP exposure implies the inability of the thyroid system to produce sufficient amounts of T4 to compensate for the inhibition by PCP. The

Y. Cheng et al. / Ecotoxicology and Environmental Safety 112 (2015) 7–14

Fig. 3. Whole body contents of T3 and T4 in zebrafish larvae after exposure to 1 and 10 μg/L PCA and PCP respectively. Data are shown as mean7 SD from three replicates (n¼ 60 larvae per group). Significant differences (Po 0.05) from the control group are marked by asterisks.

increase of T3 levels after PCP exposure implicates that larvae might possibly be experiencing hyperthyroidism after PCP exposure, just like in zebrafish exposed to T3 (Wang et al., 2013) that increased T3 levels and decreased T4 levels are observed. The fact that no significant changes for PCA at 10 times the dose suggests that PCA is at least 10 times less potent in terms of thyroid disruption. We further studied the mechanism of the developmental toxicity of PCA and PCP by studying their effects on the expression of synapsin I (SYN). SYN is implicated in synaptic plasticity, neurotransmitter release and learning (D'Agostino and Henning, 1982; Moore and Bernstein, 1989; Rosahl et al., 1995; Rosahl et al., 1993), and is an important factor that promotes brain growth. In our experiment, PCP, PCA and T3 had similar up-regulation effects on the expression of SYN, like the previous report that T3 increases the mRNA expression of SYN in rats (Di Liegro et al., 1995; Heisenberg et al., 1992). The impact on SYN expression possibly affects the timing and coordination of development in the central

11

nervous system (CNS) (Di Liegro et al., 1987; Savettieri et al., 1989), which may bring about those observed sub-lethal effects in development aforementioned. The similar effects on SYN expression for PCP, PCA and T3 also suggest a possible similar hyperthyroid regulation mechanism for PCA and PCP as T3. Previous reports indicated possible thyroid disrupting effects on animals after exposure to PCP by regulation of HPT axis-related genes expression (Beard et al., 1999; Beard and Rawlings, 1999; Guo and Zhou, 2013; Hughes et al., 1985; Jekat et al., 1994; Yu et al., 2014), but this is the first report showing similar thyroid disrupting effects after PCA exposure. Our results show that PCA can also affect gene expression related to thyroid hormone regulation similar to PCP. Iodothyronine deiodinase type III (Dio3) is the major physiological inactivator of thyroid hormone, and is highly expressed in developing tissues such as placenta, neonatal skin, skeletal muscle and central nervous system (Bouzaffour et al., 2010; Dentice et al., 2009; Visser and Schoenmakers, 1992). In our results, PCA, PCP and T3 increased Dio3 expression, which is consistent with previously reported results in hyperthyroid rats (Bianco et al., 2002). The increase expression of Dio3 can explain the results of decreased T4 in our study. Both PCA and PCP induced down regulation of Dio2, but no effects on Dio1 and TTR expression. This reduction in Dio2 would be predicted as a compensatory response in peripheral tissues to reduce systemic T3 levels in hyperthyroidism. Similar previous results are reported in other fish species including tilapia (Mol et al., 1999; Van der Geyten et al., 2005), killifish (García-G et al., 2004) and rainbow trout (Finnson and Eales, 1999; Orozco et al., 2002). The idle response for Dio1 expression in our results may be due to possible scavenger role for Dio1 preferentially deiodinating sulfated forms of iodothyronines in organisms (Schneider, et al., 2006). Also for unchangeable TTR expression after PCP or PCA exposure, it might indicate that PCP or PCA does not interfere thyroid hormone homeostasis by competing for the binding sites at transport proteins (Morgado et al., 2007), but through other mechanisms. THRαa and THRβ mRNA expression were significantly increased after exposure to PCP and T3, but not for PCA exposure, the same trend for the previous report of T3 administration in gull (Crump et al., 2008). The expression increases might be responded to the aforementioned increased T3 levels upon PCP treatment, for T3 is considered to be the mainly physiologically relevant hormone on these receptors (Zoeller et al., 2007). PCA has no effects on THRαa or THRβ expression, showing that PCA is less potent than PCP in disrupting thyroid hormone related expression. Both PCA and PCP have shown acute, sub-lethal, thyroid hormone levels and gene expression alteration at the concentrations (1 and 10 μg/L) reported in maternal and/or cord blood samples, therefore the potential effects on timing and coordination of development in the central nervous system and thyroid hormone regulation in humans need to be characterized. The changes in mRNA expression for SYN and Dio3 are sensitive endpoints for affecting the timing and coordination of development in the central nervous system and thyroid hormone regulation at the concentration of 1 μg/L. As this concentration falls within the range of reported PCP concentrations in water samples aforementioned, exposure to environmental concentrations of PCP in water could already have some deleterious developmental effects on fish around the world. Correspondingly, exposure to the same environmental concentrations of PCA in water will exert at least 10 times less impact in development compared to PCP in fish. In conclusion, we found that PCA like PCP had adverse developmental impact on zebrafish embryos and/or larvae, but at doses typically 10 to 1000 times higher than that of PCP. Developmental exposure to PCA and PCP can affect thyroid hormone levels and

12

Y. Cheng et al. / Ecotoxicology and Environmental Safety 112 (2015) 7–14

Fig. 4. The mRNA expression relative to EF1α in zebrafish larvae after exposure to 1 and 10 μg/L PCA, 10 μg/L T3 (Fig. 4) and exposure to 1 and 10 μg/L PCP, 10 μg/L T3 (Fig. 4B) respectively. mRNA expression values are normalized to EF1α values. Data are shown as mean 7 SD from three replicates (n¼ 20 larvae per group). Significant differences (Po 0.05) from the control group are marked by asterisks.

gene expression related to timing and coordination of development in the central nervous system and thyroid hormone, resulting in growth and survival vulnerability in zebrafish larvae. The cause for the specific effect of PCA on pericardial edema needs further study. Our results demonstrate the relative developmental toxicity of PCA in relation to PCP and the possible underlying toxicity mechanisms which will be useful to support the interpretation of future body burden results obtained in human populations.

Acknowledgments We thank Prof. Dr. Vance Trudeau for the assistance in the experiment design; also thank Gary Hatch, Philip Pelletier and

Vishal Saxena for their assistance in the experiments. Funding support from the Canada Research Chair to HMC is acknowledged.

References Alt, B., Reibe, S., Feitosa, N.M., Elsalini, O.A., Wendl, T., Rohr, K.B., 2006. Analysis of origin and growth of the thyroid gland in zebrafish. Dev. Dyn. 235 (7), 1872–1883. Beard, A.P., Bartlewski, P.M., Rawlings, N.C., 1999. Endocrine and reproductive function in ewes exposed to the organochlorine pesticides lindane orpentachlorophenol. J. Toxicol. Environ. Health A 56 (1), 23–46. Beard, A.P., Rawlings, N.C., 1999. Thyroid function and effects on reproduction in ewes exposed to the organochlorine pesticides lindane orpentachlorophenol (PCP) from conception. J. Toxicol. Environ. Health A 58 (8), 509–530.

Y. Cheng et al. / Ecotoxicology and Environmental Safety 112 (2015) 7–14

Bianco, A.C., Salvatore, D., Gereben, B., Berry, M.J., Larsen, P.R., 2002. Biochemistry, cellular and molecular biology, and physiological roles of the iodothyronine selenodeiodinases. Endocr. Rev. 23 (1), 38–89. Blanton, M.L., Specker, J.L., 2007. The hypothalamic–pituitary–thyroid (HPT) axis in fish and its role in fish development and reproduction. Crit. Rev. Toxicol. 37 (1– 2), 97–115. Bouzaffour, M., Rampon, C., Ramaugé, M., Courtin, F., Vriz, S., 2010. Implication of type 3 deiodinase induction in zebrafish fin regeneration. Gen. Comp. Endocrinol. 168 (1), 88–94. Crump, D., Jagla, M.M., Kehoe, A., Kennedy, S.W., 2008. Detection of polybrominated diphenyl ethers in herring gull (Larus argentatus) brains: effects on mRNAexpression in cultured neuronal cells. Environ. Sci. Technol. 42, 7715–7721. Dallaire, R., Muckle, G., Dewailly, E., Jacobson, S.W., Jacobson, J.L., Sandanger, T.M., Sandau, C.D., Ayotte, P., 2009. Thyroid hormone levels of pregnant inuit women and their infants exposed to environmental contaminants. Environ. Health Perspect. 117 (6), 1014–1020. Damgaard, I.N., Skakkebaek, N.E., Toppari, J., Virtanen, H.E., Shen, H., Schramm, K. W., Petersen, J.H., Jensen, T.K., Main, K.M., Nordic Cryptorchidism Study Group, 2006. Persistent pesticides in human breast milk and cryptorchidism. Environ. Health Perspect. 114 (7), 1133–1138. Dentice, M., Ambrosio, R., Salvatore, D., 2009. Role of type 3 deiodinase in cancer. Expert Opin. Ther. Targets 13 (11), 1363–1373. Di Liegro, I., Savettieri, G., Cestelli, A., 1987. Cellular mechanism of action of thyroid hormones. Differentiation 35 (3), 165–175. Di Liegro, I., Savettieri, G., Coppolino, M., Scaturro, M., Monte, M., Nastasi, T., Salemi, G., Castiglia, D., Cestelli, A., 1995. Expression of synapsin I gene in primary cultures of differentiating rat cortical neurons. Neurochem. Res. 20 (2), 239–243. Dimich-Ward, H., Hertzman, C., Teschke, K., Hershler, R., Marion, S.A., Ostry, A., Kelly, S., 1996. Reproductive effects of paternal exposure to chlorophenate wood preservatives in the sawmill industry. Scand. J. Work Environ. Health 22 (4), 267–273. Duan, Z., Zhu, L., Zhu, L., Kun, Y., Zhu, X., 2008. Individual and joint toxic effects of pentachlorophenol and bisphenol A on the development of zebrafish (Danio rerio) embryo. Ecotoxicol. Environ. Saf. 71 (3), 774–780. D'Agostino, J., Henning, S.J., 1982. Role of thyroxine in coordinate control of corticosterone and CBG in postnatal development. Am. J. Physiol. 242 (1), E33–E39. Environment Canada (EC) , Draft Entry Characterization of Trifluralin; Atrazine; Chlorothalonil; Chlorophacinone; Methoxychlor; and Pentachlorophenol, 2013. Euro Chlor , Pentachlorophenol, Euro Chlor Risk Assessment for the Marine Environment OSPARCOM Region-North Sea. Brussels, Belgium, 1999. European Union (EU) , Commission regulation (EU), 2010 (No 258/2010 of 25 March 2010). Finnson, K.W., Eales, J.G., 1999. Effect of T(3) treatment and food ration on hepatic deiodination and conjugation of thyroid hormones in rainbow trout, Oncorhynchus mykiss. Gen. Comp. Endocrinol. 115 (3), 379–386. Fraysse, B., Mons, R., Garric, J., 2006. Development of a zebrafish 4-day embryolarval bioassay to assess toxicity of chemicals. Ecotoxicol. Environ. Saf. 63 (2), 253–267. García-G, C., Jeziorski, M.C., Valverde-R, C., Orozco, A., 2004. Effects of iodothyronines on the hepatic outer-ring deiodinating pathway in killifish. Gen. Comp. Endocrinol. 135 (2), 201–209. Glinoer, D., 1997. The regulation of thyroid function in pregnancy: pathways of endocrine adaptation from physiology to pathology. Endocr. Rev. 18 (3), 404–433. Glinoer, D., Delange, F., 2000. The potential repercussions of maternal, fetal, and neonatal hypothyroxinemia on the progeny. Thyroid 10 (10), 871–887. Guo, Y., Zhou, B., 2013. Thyroid endocrine system disruption by pentachlorophenol: An in vitro and in vivo assay. Aquat. Toxicol. 142 (143C), 138–145. Guvenius, D.M., Aronsson, A., Ekman-Ordeberg, G., Bergman, A., Norén, K., 2003. Human prenatal and postnatal exposure to polybrominated diphenyl ethers, polychlorinated biphenyls,polychlorobiphenylols, and pentachlorophenol. Environ. Health Perspect. 111 (9), 1235–1241. Haddow, J.E., Palomaki, G.E., Allan, W.C., Williams, J.R., Knight, G.J., Gagnon, J., O’Heir, C.E., Mitchell, M.L., Hermos, R.J., Waisbren, S.E., Faix, J.D., Klein, R.Z., 1999. Maternal thyroid deficiency during pregnancy and subsequent neuropsychological development of the child. N. Engl. J. Med. 341 (8), 549–555. Heisenberg, C.P., Thoenen, H., Lindholm, D., 1992. Tri-iodothyronine regulates survival and differentiation of rat cerebellar granule neurons. Neuroreport. 3 (8), 685–688. Hermsen, S.A., van den Brandhof, E.J., van der Ven, L.T., Piersma, A.H., 2011. Relative embryotoxicity of two classes of chemicals in a modified zebrafish embryotoxicity test and comparison with their in vivo potencies. Toxicol. In Vitro 25 (3), 745–753. Hughes, B.J., Forsell, J.H., Sleight, S.D., Kuo, C., Shull, L.R., 1985. Assessment of pentachlorophenol toxicity in newborn calves: clinicopathology and tissue residues. J. Anim. Sci. 61 (6), 1587–1603. Jekat, F.W., Meisel, M.L., Eckard, R., Winterhoff, H., 1994. Effects of pentachlorophenol (PCP) on the pituitary and thyroidal hormone regulation in the rat. Toxicol. Lett. 71 (1), 9–25. Kawaguchi, M., Morohoshi, K., Saita, E., Yanagisawa, R., Watanabe, G., Takano, H., Morita, M., Imai, H., Taya, K., Himi, T., 2008. Developmental exposure to pentachlorophenol affects the expression of thyroidhormone receptor beta1 and synapsin I in brain, resulting in thyroid function vulnerability in rats. Endocrine 33 (3), 277–284.

13

Klein, R.Z., Haddow, J.E., Faix, J.D., Brown, R.S., Hermos, R.J., Pulkkinen, A., Mitchell, M.L., 1991. Prevalence of thyroid deficiency in pregnant women. Clin. Endocrinol. (Oxf.) 35 (1), 41–46. Lamar, R.T., Dietrich, D.M., 1990. In situ depletion of pentachlorophenol from contaminated soil by Phanerochaete spp. Appl. Environ. Microbiol. 56 (10), 3093–3100. Liu, Y.W., Chan, W.K., 2002. Thyroid hormones are important for embryonic to larval transitory phase in zebrafish. Differentiation 70 (1), 36–45. Meijer, L., Martijn, A., Melessen, J., Brouwer, A., Weiss, J., de Jong, F.H., Sauer, P.J., 2012. Influence of prenatal organohalogen levels on infant male sexual development: sex hormone levels, testes volume and penile length. Hum. Reprod. 27 (3), 867–872. Meijer, L., Weiss, J., Van Velzen, M., Brouwer, A., Bergman, A., Sauer, P.J., 2008. Serum concentrations of neutral and phenolic organohalogens in pregnant women and some of their infants in the Netherlands. Environ. Sci. Technol. 42 (9), 3428–3433. Merrill, A.J., 1946. Edema and decreased renal blood flow in patients with chronic congestive heart failure: evidence of “forward failure” as the primary cause of edema. J. Clin. Invest. 25 (3), 389–400. Morgado, I., Santos, C.R., Jacinto, R., Power, D.M., 2007. Regulation of transthyretin by thyroid hormones in fish. Gen. Comp. Endocrinol. 152, 189–197. Mol, K.A., van der Geyten, S., Kühn, E.R., Darras, V.M., 1999. Effects of experimental hypo- and hyperthyroidism on iodothyronine deiodinases in Nile tilapia, Oreochromis niloticus. Fish Physiol. Biochem. 20, 201–207. Moore, R.Y., Bernstein, M.E., 1989. Synaptogenesis in the rat suprachiasmatic nucleus demonstrated by electron microscopy and synapsin I immunoreactivity. J. Neurosci. 9 (6), 2151–2162. National Toxicology Program (NTP), 1993. NTP toxicology and carcinogenesis studies of pentachloroanisole (CAS No. 1825-21-4) in F344 rats and B6C3F1 mice (Feed Studies). Natl. Toxicol. Prog. Tech. Rep. Ser. 414, 1–284. Okeke, B.C., Paterson, A., Smith, J.E., Watson-Craik, I.A., 1997. Comparative biotransformation of pentachlorophenol in soils by solid substrate cultures of Lentinula edodes. Appl. Microbiol. Biotechnol. 48 (4), 563–569. Opitz, R., Antonica, F., Costagliola, S., 2013. New model systems to illuminate thyroid organogenesis. Part I: an update on the zebrafishtoolbox. Eur. Thyroid J. 2 (4), 229–242. Organisation for Economic Co-operation and Development (OECD), Test No. 236: Fish Embryo Acute Toxicity (FET) Test, 2013. Orozco, A., Villalobos, P., Valverde, R.C., 2002. Environmental salinity selectively modifies the outer-ring deiodinating activity of liver, kidney and gill in the rainbow trout. Comp. Biochem. Physiol. 131, 387–395. Park, J.S., Bergman, A., Linderholm, L., Athanasiadou, M., Kocan, A., Petrik, J., Drobna, B., Trnovec, T., Charles, M.J., Hertz-Picciotto, I., 2008. Placental transfer of polychlorinated biphenyls, their hydroxylated metabolites and pentachlorophenol in pregnant women from eastern Slovakia. Chemosphere 70 (9), 1676–1684. Pop, V.J., Kuijpens, J.L., van Baar, A.L., Verkerk, G., van Son, M.M., de Vijlder, J.J., Vulsma, T., Wiersinga, W.M., Drexhage, H.A., Vader, H.L., 1999. Low maternal free thyroxine concentrations during early pregnancy are associated with impaired psychomotordevelopment in infancy. Clin. Endocrinol. (Oxf.) 50 (2), 149–155. Porazzi, P., Calebiro, D., Benato, F., Tiso, N., Persani, L., 2009. Thyroid gland development and function in the zebrafish model. Mol. Cell. Endocrinol. 312 (1–2), 14–23. Power, D.M., Llewellyn, L., Faustino, M., Nowell, M.A., Björnsson, B.T., Einarsdottir, I. E., Canario, A.V., Sweeney, G.E., 2001. Thyroid hormones in growth and development of fish. Comp. Biochem. Physiol. C: Toxicol. Pharmacol 130 (4), 447–459. Rosahl, T.W., Geppert, M., Spillane, D., Herz, J., Hammer, R.E., Malenka, R.C., Südhof, T.C., 1993. Short-term synaptic plasticity is altered in mice lacking synapsin I. Cell 75 (4), 661–670. Rosahl, T.W., Spillane, D., Missler, M., Herz, J., Selig, D.K., Wolff, J.R., Hammer, R.E., Malenka, R.C., Südhof, T.C., 1995. Essential functions of synapsins I and II in synaptic vesicle regulation. Nature 375 (6531), 488–493. Roze, E., Meijer, L., Bakker, A., Van Braeckel, K.N., Sauer, P.J., Bos, A.F., 2009. Prenatal exposure to organohalogens, including brominated flame retardants, influences motor, cognitive, and behavioral performance at school age. Environ. Health Perspect. 117 (12), 1953–1958. Savettieri, G., Di Liegro, 1., Cestelli, A., 1989. Action of thyroid hormones on developing CNS at the molecular level. In: Bonavita, V., Piccoli, F. (Eds.), Biological Aspects of Neuronal Activity. Liviana Press, Padova, pp. 17–27. Schmidt, F., Braunbeck, T., 2011. Alterations along the hypothalamic–pituitary– thyroid axis of the zebrafish (Danio rerio) after exposure to propylthiouracil. J. Thyroid Res. 2011, 1–17. Schneider, M.J., Fiering, S.N., Thai, B., Wu St, S.Y., Germain, E., Parlow St, A.F., Germain, D.L., Galton, V.A., 2006. Targeted disruption of the type 1 selenodeiodinase gene (Dio1) results in marked changes in thyroid hormoneeconomy in mice. Endocrinology 147 (1), 580–589. Seiler, J.P., 1991. Pentachlorophenol. Mutat Res. 257 (1), 27–47. Shen, H., Main, K.M., Virtanen, H.E., Damggard, I.N., Haavisto, A.M., Kaleva, M., Boisen, K.A., Schmidt, I.M., Chellakooty, M., Skakkebaek, N.E., Toppari, J., Schramm, K.W., 2007. From mother to child: investigation of prenatal and postnatal exposure to persistent bioaccumulating toxicants using breast milk and placenta biomonitoring. Chemosphere 67 (9), S256–S262.

14

Y. Cheng et al. / Ecotoxicology and Environmental Safety 112 (2015) 7–14

Shi, X., Liu, C., Wu, G., Zhou, B., 2009. Waterborne exposure to PFOS causes disruption of the hypothalamus–pituitary–thyroid axis in zebrafish larvae. Chemosphere. 77 (7), 1010–1018. Teerds, K.J., de Rooij, D.G., de Jong, F.H., van Haaster, L.H., 1998. Development of the adult-type Leydig cell population in the rat is affected by neonatalthyroid hormone levels. Biol. Reprod. 59 (2), 344–350. United Nations Economic Commission for Europe (UNECE) , Pentachlorophenol risk profile, UNECE convention on long-range transboundary air pollution. Geneva, Switzerland, 2008. U.S. Environmental Protection Agency (USEPA) , Toxicological Review of Phenol, 2002 (CAS No. 108-95-2). U.S. Environmental Protection Agency (USEPA) , Pentachlorophenol 87-86-5 Hazard Summary, 2000. Valo, R., Salkinoja-Salonen, M., 1986. Bioreclamation of chlorophenol-contaminated soil by composting. Applied Microbiology and Biotechnology 25, 68–75. van den Brandhof, E.J., Montforts, M., 2010. Fish embryo toxicity of carbamazepine, diclofenac and metoprolol. Ecotoxicol. Environ. Saf. 73 (8), 1862–1866. Van der Geyten, S., Byamungu, N., Reyns, G.E., Kü hn, E.R., Darras, V.M., 2005. Iodothyronine deiodinases and the control of plasma and tissue thyroid hormone levels in hyperthyroid tilapia (Oreochromis niloticus). J. Endocrinol. 184, 467–479. Visser, T.J., Schoenmakers, C.H., 1992. Characteristics of type III iodothyronine deiodinase. Acta Med. Aust. (Suppl. 1), 18–21. Walpita, C.N., Van der Geyten, S., Rurangwa, E., Darras, V.M., 2007. The effect of 3.5,3′-triiodothyronine supplementation on zebrafish (Danio rerio) embryonic development andexpression of iodothyronine deiodinases and thyroid hormone receptors. Gen. Comp. Endocrinol. 152 (2–3), 206–214.

Walter, M., Boul, L., Chong, R., Ford, C., 2004. Growth substrate selection and biodegradation of PCP by New Zealand white-rot fungi. J. Environ. Manag. 71 (4), 361–369. Wang, Q., Liang, K., Liu, J., Yang, L., Guo, Y., Liu, C., Zhou, B., 2013. Exposure of zebrafish embryos/larvae to TDCPP alters concentrations of thyroid hormones and transcriptions ofgenes involved in the hypothalamic–pituitary–thyroid axis. Aquat. Toxicol. 126, 207–213. Welsh, J.J., Collins, T.F., Black, T.N., Graham, S.L., O'Donnell Jr., M.W., 1987. Teratogenic potential of purified pentachlorophenol and pentachloroanisole in subchronically exposed Sprague–Dawley rats. Food Chem. Toxicol. 25 (2), 163–172. Westerfield, M., 2000. The Zebrafish Book. A Guide for the Laboratory use of Zebrafish (Danio rerio), fourth ed. University of Oregon Press, Eugene. Yin, D., Gu, Y., Li, Y., Wang, X., Zhao, Q., 2006. Pentachlorophenol treatment in vivo elevates point mutation rate in zebrafish p53 gene. Mutat. Res. 609 (1), 92–101. Yu, L.Q., Zhao, G.F., Feng, M., Wen, W., Li, K., Zhang, P.W., Peng, X., Huo, W.J., Zhou, H. D., 2014. Chronic exposure to pentachlorophenol alters thyroid hormones and thyroid hormone pathway mRNAs in zebrafish. Environ. Toxicol. Chem. 33 (1), 170–176. Zheng, W., Yu, H., Wang, X., Qu, W., 2011. Systematic review of pentachlorophenol occurrence in the environment and in humans in China: not a negligible health risk due to the re-emergence of schistosomiasis. Environ. Int. 42, 105–116. Zoeller, R.T., Tan, S.W., Tyl, R.W., 2007. General background on the hypothalamic– pituitary–thyroid (HPT) axis. Crit. Rev. Toxicol. 37 (1–2), 11–53.

Relative developmental toxicities of pentachloroanisole and pentachlorophenol in a zebrafish model (Danio rerio).

Pentachloroanisole (PCA) and pentachlorophenol (PCP) are chlorinated aromatic compounds that have been found in the environment and in human populatio...
2MB Sizes 0 Downloads 7 Views

Recommend Documents


A physiologically based toxicokinetic model for the zebrafish Danio rerio.
Zebrafish (Danio rerio) is a widely used model for toxicological studies, in particular those related to investigations on endocrine disruption. The development and regulatory use of in vivo and in vitro tests based on this species can be enhanced by

Manipulating galectin expression in zebrafish (Danio rerio).
Techniques for disrupting gene expression are invaluable tools for the analysis of the biological role(s) of a gene product. Because of its genetic tractability and multiple advantages over conventional mammalian models, the zebrafish (Danio rerio) i

Assessing developmental toxicity and estrogenic activity of halogenated bisphenol A on zebrafish (Danio rerio).
Halogenated bisphenol A (H-BPAs), widely used in industrial production, have been identified in various environmental matrices and detected in human serum and breast milk. The persistence and prevalence of H-BPAs in the environment underscore the nee

Functional characterization of zebrafish (Danio rerio) Bcl10.
The complexes formed by BCL10, MALT1 and specific members of the family of CARMA proteins (CBM complex), have recently focused much attention because they represent a central hub regulating activation of the transcription factor NF-κB following vario

Neurotoxicity of FireMaster 550® in zebrafish (Danio rerio): Chronic developmental and acute adolescent exposures.
FireMaster® 550 (FM 550) is the second most commonly used flame retardant (FR) product in consumer goods and has been detected in household dust samples. However, neurobehavioral effects associated with exposure have not been characterized in detail.

Developmental Toxicity of Zinc Oxide Nanoparticles to Zebrafish (Danio rerio): A Transcriptomic Analysis.
Zinc oxide nanoparticles (ZnO NPs) are being utilized in an increasing number of fields and commercial applications. While their general toxicity and associated oxidative stress have been extensively studied, the toxicological pathways that they indu

Short-term memory in zebrafish (Danio rerio).
Learning and memory represent perhaps the most complex behavioral phenomena. Although their underlying mechanisms have been extensively analyzed, only a fraction of the potential molecular components have been identified. The zebrafish has been propo

Extremely low-frequency magnetic fields induce developmental toxicity and apoptosis in zebrafish (Danio rerio) embryos.
Extremely low-frequency (ELF) magnetic field (MF), as a widespread ecological factor, has an influence on all living beings. In the present study, biological effects of ELF-MF on the development of zebrafish (Danio rerio) embryos were investigated. F

Developmental toxicity of diclofenac and elucidation of gene regulation in zebrafish (Danio rerio).
Environmental pollution by emerging contaminants, e.g. pharmaceuticals, has become a matter of widespread concern in recent years. We investigated the membrane transport of diclofenac and its toxic effects on gene expression and the development of ze

TBBPA induces developmental toxicity, oxidative stress, and apoptosis in embryos and zebrafish larvae (Danio rerio).
Tetrabromobisphenol A (TBBPA) is currently one of the most frequently used brominated flame retardants and can be considered as a high production volume chemical. In this study, zebrafish embryos and larvae served as a biological model to evaluate TB