Chemosphere 147 (2016) 467e476

Contents lists available at ScienceDirect

Chemosphere journal homepage: www.elsevier.com/locate/chemosphere

Regulation of vitellogenin (vtg1) and estrogen receptor (er) gene expression in zebrafish (Danio rerio) following the administration of Cd2þ and 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) Ying Ying Chen, King Ming Chan* School of Life Sciences, Chinese University, Sha Tin, Hong Kong SAR, China

h i g h l i g h t s

g r a p h i c a l a b s t r a c t

 Combined effects of Cd and TCDD on vtg1 gene expression was studied.  In vitro study showed that ERa in important in mediating the inhibitory effects of Cd on vtg1 gene transcription.  In vivo gene expression study confirmed similar effects in embryo, larvae, and male liver tissues.  Male fish gave sensitive response to TCDD induction of vtg1 and such induction was inhibited by Cd.

a r t i c l e i n f o

a b s t r a c t

Article history: Received 12 October 2015 Received in revised form 21 December 2015 Accepted 22 December 2015 Available online 19 January 2016

We evaluated the individual and joint estrogenic effects of cadmium (Cd2þ) and 2,3,7,8tetrachlorodibenzo-p-dioxin (TCDD) in the zebrafish liver (ZFL) cell line, zebrafish embryo, larvae and the liver of adult zebrafish. The mRNA expression of vtg1 was inhibited by Cd2þ, but unaffected by TCDD in ZFL cells. Similar changes in the mRNA levels of ERa, ERb1, ERb2 and GPER (G protein coupled estrogen receptor) in ZFL cells were also observed. Deletion mutants of vtg1 gene promoters were constructed to investigate transcriptional regulation, and we found that all of the constructs failed to respond to TCDD or Cd2þ. However, after co-transfection with a vtg1 promoter-luciferase construct to the ERa, ERb1, ERb2 and GPER expression vectors, decreased luciferase activity was observed in the ERa co-transfection group after treatment with Cd2þ, suggesting that ERa participates in vtg1 transcriptional regulation and is affected by Cd2þ. Differences in the regulation of the mRNA levels of these genes were also observed between different developmental stages and between the livers of male and female zebrafish. © 2016 Published by Elsevier Ltd.

Handling Editor: David Volz Keywords: Biomarkers Environmental estrogen Reporter gene system

1. Introduction Vitellogenins (VTG) are liver-derived yolk-protein precursors required for oogenesis in all oviparous teleosts (Hansen et al., 1998). In teleosts, VTG expression is a reproductively relevant biomarker

* Corresponding author. E-mail address: [email protected] (K.M. Chan). http://dx.doi.org/10.1016/j.chemosphere.2015.12.083 0045-6535/© 2016 Published by Elsevier Ltd.

for the estrogenic effects of xenoestrogenic compounds. Hepatic vitellogenin synthesis is regulated through 17b-estradiol (E2) and the xenoestrogenic activation of estrogen receptors (ERs) a, b1 and b2, which can form dimers and translocate into the nucleus to induce target gene transcription by direct binding with a specific palindromic DNA sequence called the estrogen-responsive element (ERE: AGGTCAnnnTGACCT) (Menuet et al., 2004). Several studies have shown that the hepatic expression of ER genes in zebrafish

468

Y.Y. Chen, K.M. Chan / Chemosphere 147 (2016) 467e476

responds differently to estradiol (Menuet et al., 2004), and that mammalian ERs have different transcriptional capacities on E2 and xenoestrogen target genes (Kuiper et al., 1997). Estradiol and xenoestrogens can induce distinct conformational changes in the tertiary structure of ERs, leading to differential cofactor recruitment. Consequently, the effects of E2 and xenoestrogens at the transcriptional level depend on the promoter, the presence of cellspecific factors and the ER subtype. In addition to the classical ER transcriptional pathway, a recent study has identified a new membrane estrogen receptor in zebrafish (the G protein-coupled estrogen receptor, GPER) (Liu et al., 2009). Endogenous E2 or xenoestrogens can maintain high levels of cAMP through activation of the GPER/Gs/AC/cAMP signal transduction pathways. Other signaling mechanisms used by GPER might involve interaction with other ER proteins (Filardo and Thomas, 2012). As there are many unresolved issues regarding the molecular mechanisms of GPER signaling, it is important to take all subtypes of ER into consideration when investigating the estrogenic effects of environmental pollutants. Cadmium (Cd) is a common environmental and industrial pollutant. The persistence of this heavy metal is concerning, as it accumulates in food chains and can be found in high levels in surface water (Liang et al., 2011). In vitro and in vivo studies suggest that Cd2þ may possess estrogen-like or anti-estrogenic effects (Ali et al., 2010; Stoica et al., 2000; Johnson et al., 2003). Several wellcharacterized estrogenic responses have been induced in rodents exposed to Cd2þ (Johnson et al., 2003; Takiguchi and Yoshihara, 2006), including effects on progesterone receptors and ERa levels, induction of human breast cancer cell proliferation, and increases in uterine weight and mammary development in rats (Takiguchi and Yoshihara, 2006). Although some studies have reported that Cd2þ activates ERa in human breast cancer cell-lines (Stoica et al., 2000; Yu et al., 2010), a number of research groups have failed to observe this estrogenic activity. Silva et al. (2006) found that Cd reduced the effects of 17b-estradiol in an in vitro estrogenicity assay. Similar effects were reported in yeast cells transfected with rainbow trout ER (Guevel et al., 2000). More recent work on rainbow trout has shown an inhibition of E2-stimulated VTG expression following treatment with Cd2þ (Vetillard and Bailhache, 2005). 2,3,7,8-Tetrachlorodibenzo-p-dioxin (TCDD) is the most toxic congener among polychlorinated dibenzo-p-dioxins and is regarded as one of the most important endocrine disruptors (Ohtake et al., 2007, 2008). Many, if not all, toxic effects of TCDD are mediated by the aryl hydrocarbon receptor (AHR), which binds TCDD with high affinity to form a heterodimer with the AHR nuclear translocator (ARNT) (Okey et al., 1994; Yamauchi et al., 2006). Previous studies indicate that TCDD might also elicit AHR-mediated estrogenic activity through interactions with ERs (Bugel et al., 2013). Chaffin et al. (1996) reported that TCDD increased the DNA binding activity of ERs independent of estrogen in the rat uterus. Moreover, it has been shown that the ligand-activated AHR/ARNT complex directly associates with the ligand-free ER to form a functional complex that binds EREs and activates transcription (Ohtake et al., 2003). In addition, TCDD mediates the induction of estrogendependent tumors in rats and increases the incidence of endometriosis in laboratory animals and in women with a high TCDD burdens (Boverhof et al., 2006). However, accumulating evidence suggests that TCDD also possesses anti-estrogenic activity (Smeets et al., 1999; Heiden et al., 2006). DeVito et al. (1992) demonstrated that TCDD treatment induced a dose-dependent decrease in hepatic and uterine ER protein in CD1 mice. Similarly, a reduction in ER levels was also observed in human ovarian carcinoma BG-1 cells (Rogers and Denison, 2002). Furthermore, the potential role of crosstalk between AHR and ER signaling pathways in hormone-

dependent breast cancer cells has been reviewed (HombachKlonisch et al., 2005; Safe and Wormke, 2003). In the presence of an active AHR, the interaction between AHR and ERs occurs at various levels, and could include or inhibit DNA-binding to EREs, proteasomal degradation of ER, and even altered estrogen metabolism (Hombach-Klonisch et al., 2006). The zebrafish is an effective model for studying molecular toxicology in vitro and in vivo due to its rapid development, conserved molecular pathways, potential for high throughput screening, and the ease of making transgenic fish (Ali et al., 2014; Busquet et al., 2008; Chan et al., 2006; Dai et al., 2014). The major application of zebrafish in endocrine research until now has been in investigations of the activity of endocrine disrupting chemicals (EDC) (Segner, 2009). Many studies have suggested that zebrafish may be a good model for the effects of EDCs in mammals (Ankley and Johnson, 2004; Lohr and Hammerschmidt, 2011; Segner, 2009). Additionally, aquatic species are particularly vulnerable to EDCs, as many of these chemicals are water contaminants with the potential to greatly disturb fish reproduction or mating behavior (Denslow and Sepulveda, 2007; Calo et al., 2010; Bertram et al., 2015). The liver is the major target organ for the metabolism, detoxification and homeostasis of EDCs, and it has been shown that the transcriptional profiles of some genes in the liver of zebrafish can be altered by these compounds (Liu et al., 2010). Research on the tissue distribution of vtg genes has also shown that VTGs are expressed at high levels in the liver of female zebrafish, and lower but detectable levels in male zebrafish (Wang et al., 2005). It is thus useful to understand the molecular mechanisms involved in the modulation of ER-related gene expression by Cd2þ and TCDD using a zebrafish liver (ZFL) cell line and livers of zebrafish adults of both sexes. Although the individual effects of Cd2þ and TCDD have been widely studied, the combined endocrine effects of these two chemicals on the estrogenic pathways have received less attention. In this study, the individual and joint regulation of Cd2þ and TCDD on the mRNA expression of the vtg1 gene, the predominant isoform of the vtg gene in zebrafish (Wang et al., 2005), was examined in vivo and in vitro using the ZFL cell line. The roles of ERa, ERb1, ERb2, and GPER in the mediation of vtg1 gene transcription under the influence of Cd2þ and TCDD were also investigated. 2. Materials and methods 2.1. Cell cultures and chemical treatments The ZFL cell line, obtained from the American Type Culture Collection (ATCC, CRL2643), was maintained in a standard culture medium comprising 50% L15 medium, 35% Dulbecco's modified medium (DMEM) and 15% Hams F12, supplemented with 1.5 g/L of sodium bicarbonate, 15 mM of HEPES, 0.01 mg/ml of insulin, 50 ng/ ml of EGF, 5% heat-inactivated fetal bovine serum and a 1% penicillin/streptomycin mixture at 28  C, as previously described (Zhu and Chan, 2012; Chen et al., 2014). All of the reagents were purchased from GIBCO Invitrogen Cell Technologies, Life Technologies (NY, USA). The ZFL cells were seeded in 6- and 24-well cell culture plates with around 106 cells in standard culture medium. A concentrated stock solution of 50 ppm TCDD (Cambridge Isotope Laboratories, MA, USA) in dimethyl sulfoxide (DMSO, cell culture grade, Steinheim, Germany) and 10 mM of CdCl2 (SigmaeAldrich, St. Louis, USA) dissolved in double deionized water were prepared separately. The cells were treated in serum-free media with TCDD (3/ 30 nM) and various concentrations of Cd2þ (10%, 50% and 100% LC50 [126.2 mM]), separately or combined. Treatment with 0.1 mM of 17b-estradiol (E2, SigmaeAldrich) served as a positive control.

Y.Y. Chen, K.M. Chan / Chemosphere 147 (2016) 467e476

2.2. Zebrafish husbandry and chemical exposure Our experiments were performed using a wild-type AB strain of zebrafish with licenses from the Department of Health, Hong Kong Special Administrative Region, under the Animals (Control of Experiments) Regulations and with approval from the university's Animal Experimentation Ethics Committee. Fertilized eggs were obtained from spawning adult zebrafish maintained according to procedures described previously (Chan and Chan, 2012; Chen et al., 2014), collected and inspected within 4 h of spawning, then transferred to petri dishes and incubated at 28  C in embryo medium (19.3 mM of NaCl, 0.23 mM of KCl, 0.13 mM of MgSO47H2O, 0.2 mM of Ca(NO3)2, 1.67 mM of HEPES [pH 7.2]). At 5 h post fertilization (hpf), the embryos were examined under a dissecting stereomicroscope at 6 magnification (Nikon, Tokyo, Japan). Only the embryos that developed normally and reached the blastula stage (30% epiboly) were selected for subsequent experiments. The embryos were then incubated at 28  C for 4 days to obtain 96 hpf larvae. For the RNA assay, embryos (5 hpf), larvae (96 hpf) and adult zebrafish were exposed to 3 and 30 nM of TCDD alone or with 10%, 50% or 100% 24h-LC50 of Cd2þ. Fresh water controls, positive controls (0.1 mM of 17b-estradiol) and individual exposures to Cd2þ were also established. For zebrafish embryos and larvae, six replicates were set up for each concentration, each comprising 30 embryos or 25 larvae exposed to 10 ml of the test medium in a 50 ml beaker. For the adult zebrafish experiments, three replicates were set up for each concentration of TCDD/Cd2þ. For acute 24 h exposure, 12 fish (6 females and 6 males) were exposed to 2 L of the test medium in a 4 L glass container. After treatment, the male and female adult fish were separated and euthanized. The brains, gills, kidneys, livers and intestines were immediately removed and individual organs were pooled from at least four fish for RNA isolation. The samples were then stored at 80  C for RNA extraction. 2.3. RNA extraction, cDNA synthesis and real-time polymerase chain reaction The zebrafish cells, embryos, larvae, and organs exposed to different concentrations of Cd2þ and TCDD were collected for total RNA extraction using the Trizol reagent (Takara Biotechnology, Japan). Reverse transcriptions (RTs) were performed using the PrimerScript™ RT reagent kit (Takara Biotechnology) according to the manufacturer's instructions. One microgram of RNA template from each sample was then converted to cDNA in a 20 ml reaction at 42  C for 30 min. The RNA and reverse transcription products were quantified using NANODROP 2000C (Thermo Fisher Scientific). The mRNA expression changes in the ER pathway-related genes in the ZFL cells and zebrafish were verified using real-time quantitative polymerase chain reaction (PCR) methods through the ABI 7500 Fast system (Applied Biosystems, CA, USA). Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was the most stable reference gene after exposure to Cd2þ and TCDD, and thus was used as the internal control for normalization (Chen et al., 2014). SYBR® Green PCR Master Mix (Takara Biotechnology, Japan) was used in the real-time PCR analysis. All of the gene sequences used in this study were obtained from the NCBI Gene Bank and the latest zebrafish genome databases (Zv9 and Vega49). The primer sets were designed using the NCBI PCR Primer Design online tool, Primer-BLAST (http://www.ncbi.nlm.nih.gov/tools/ primer-blast). The nucleotide sequences of the forward and reverse primers for the genes selected and their accession

469

numbers are listed in Table 2 and were validated as described in Chen et al. (2014). The relative expression of each gene was calculated as previously described (Chen et al., 2014) using the formula of relative fluorescence ¼ 2DDCt. 2.4. Generation of reporter gene constructs and protein expression vectors Genomic PCR was used to amplify the indicated regions of the zfvtg1 promoter/enhancer from the genome DNA isolated from the zebrafish embryos. The PCR fragments were ligated into a pGL 4.17 basic vector (Promega, Madison, USA), to generate p-969/-1pGL4.17, p-1705/-1-pGL4.17, and p-2852/-1-pGL4.17. One microgram of total RNA from the ZFL cell line was reverse transcribed with oligo(dT) by reverse transcriptase (Boehringer Mannheim, Mannheim, Germany). The entire coding region of zfGPER, zfERa, zfERb1, and zfERb2 was amplified by PCR with oligonucleotides chosen from either side of the zfER coding region (Table 1). PCR products were visualized by electrophoresis on a 1% agarose gel, sub-cloned in pCMV-myc expression vector (Takara), and fully sequenced to confirm their true identities. 2.5. Transient transfection and luciferase assay The ZFL cells were maintained according to the methods described above. The cells were seeded in 24-well plates and incubated for 24 h before transfection. A reporter vector with and without zfER expression vectors was introduced into cells using Lipofectamine 2000 reagent (Life Technologies, Inc) following the manufacturer's protocols. Triplicated transfections were performed using 500 ng of total DNA containing 400 ng of reporter vector and 100 ng of pRL-TK vector (Promega) as internal controls. After transfection, the cells were exposed to different dosages of Cd2þ and TCDD for 24 h. The cells were then harvested to determine their luciferase activity using the Dual-Luciferase® Reporter Assay System (Promega), according to the manufacturer's instructions, with a GloMax-96 Microplate Luminometer (Promega). 2.6. Statistical analyses The results are presented as mean ± standard deviation (S.D.) in triplicate. The gene expression levels and normalized values in all of the figures were compared using one way ANOVA and Tukey's Multiple Comparison Test on Prism5 software (GraphPad, San Diego, USA). A probability value of p < 0.05 was considered significant. 3. Results 3.1. Effects of Cd2þ and TCDD on the ER pathway in ZFL cells The individual and joint effects of Cd2þ and TCDD on genes related to the ER pathways (vtg1, gper, era, erb1 and erb2) were assessed. As shown in Fig. 1, the mRNA level of vtg1 was not affected by TCDD at either concentration used, whereas it was decreased by Cd2þ in all cases. The inhibitory effects of Cd2þ on vtg1 were not affected by co-treatment with TCDD. Similar effects were observed on the mRNA level of era, suggesting that the transcriptional regulation of Cd2þ on vtg1 may be mediated by era. The individual effects of Cd2þ and TCDD on gper were also similar to the effects on vtg1, but after co-treatment the expression level was up-regulated by TCDD in a dose dependent way. The other two estrogen receptor genes (erb1 and erb2) were significantly inhibited by Cd2þ, but were not affected by TCDD, and the effects of Cd2þ were also not changed by TCDD after co-exposure.

470

Y.Y. Chen, K.M. Chan / Chemosphere 147 (2016) 467e476 Table 1 Nucleotide sequences of primers used in cloning the zfER expression vectors. Gene (Accession number)

Primer

Nucleotide sequence (50 e30 )

gper (EU652771)

Forward Reverse Forward Reverse Forward Reverse Forward Reverse

GGCGC GAATTC GATGAAGTATGTAGCACCTT ATT GGTACC GTGCTACACCTCAGACTC CGGCG GAATTC TCTCACCCATGTACCCTAA ATTTAT GGTACC GGTCAGGGGTCAGGGCTA CGTGC GAATTC CCTGAGATGCAGTAGTGT CGG GGTACC GATGAATGAAATGCCAGAT GCCTC GAATTC ACTCATCCGCCTTCACCAT TTA GGTACC CGTGTTTAGGGTCCGTGCT

era (NM_152959) erb1 (NM_174862) erb2 (NM_180966)

Table 2 Nucleotide sequences of primers used in the real-time quantitative PCR assay. Gene (Accession number)

Primer

Nucleotide sequence (50 e30 )

gapdh (NM_213094)

Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse

CGACCTCACCTGCCGCCTTACA GTCATTGAGGGAGATGCCAGCG TCCTGAAGTTTGCCATGATA GATGAGGAACCTTGCTGCTGA GAATAAAGTGTTGCAGCTGTGC CCTGGGCTTGTGTGATCCAT CAGGACCAGCCCGATTCC TTAGGGTACATGGGTGAGAGTTTG CGCTCGGCATGGACAAC CCCATGCGGTGGAGAGTAAT CTCACAGCACGGACCCTAAAC GGTTGTCCATCCTCCCGAAAC

vtg1 (AY034146) gper (EU652771) era (NM_152959) erb1 (NM_174862) erb2 (NM_180966)

Besides, ZFL cells were treated with estradiol (0.1 and 1 mM) as positive control, and the results showed that both concentrations can't effectively induced vtg1 and the related ers, and the data of 0.1 mM were shown in Fig. 1. Our results indicate that the ZFL cell line might not be suitable for evaluating estrogenic effects, which consistent with recently published paper showed that the ZFL cell line expressed low levels of genes in the estrogenic response

pathway (Eide et al., 2014). Furthermore, we also confirm this finding by using gene reporter system, As shown in Fig. S1, TCDD or Cd2þ alone had no significant effect on the promoter activity of the three vtg1 promoter constructs. In addition, the unresponsive of these constructs to E2 control further confirm above suggestion that ZFL cell line might not be suitable for effectively evaluating estrogenic effects, but it's still effective to estimate the antiestrogenic effects of Cd2þ. (Fig. S1C).

3.2. Roles of zfER in the transcriptional regulation of vtg1 in ZFL cells To understand the potential mechanism for the un-inducible ER pathway in ZFL cell line and establish the potential influence of each zfER in the regulation of vtg1 gene expression, ERa, ERb1, ERb2, and GPER protein expression vectors were generated and each expression vector (empty or containing the coding region of a zfER) was co-transfected with a vtg1 promoter construct (P1~2842) into ZFL cells. To a varying degree, the expression vectors all increased the basic activity of the vtg1 promoter (P-1~2842) luciferase reporter construct (Fig. 2), suggesting that all of these estrogen receptors are involved in vtg1 activation in ZFL cells and

Fig. 1. Effects of Cd2þ and TCDD on mRNA expression of vtg1 (A), gper (B), era (C), erb1 (D), and erb2 (E) in ZFL cells after 24 h treatment. The results are represented as the mean ± S.D. of three replicates. The data were analyzed by one-way ANOVA (*p < 0.01, **p < 0.05, ***p < 0.005) comparing each group with the control and Tukey's Multiple Comparison Test comparing the results of fold inductions from different treatments (same letter indicates no significant difference) at the level of p < 0.05.

Y.Y. Chen, K.M. Chan / Chemosphere 147 (2016) 467e476

471

inhibit the induction of vtg1. Although the mechanism for the different responses of the vtg1 promoter constructs to Cd2þ before and after co-transfection with ER expression vectors is still unclear, these results nevertheless demonstrate the important finding that the antagonistic response to Cd2þ treatment may due to ERa is prevented from binding to target cis-acting elements in DNA, which subsequently inhibits its transcriptional activity or actions. In E2 control experiment, all ERs can also increased the acitbity of vtg1 promoter constructs, but ERa is the most prominent one (Fig. S2), further suggesting the low expression level of endogenous ERa might be a main restrict factor for vtg1 induction. 3.3. Effects of Cd2þ and TCDD on the ER pathway in zebrafish embryo and larvae

Fig. 2. Effects of GPER, zfERa, zfERb1 and zfERb2 on the activity of vtg1 promoter construct (P-1~2842). ZFL cells were co-transfected with ER expression vectors (control, GPER, zfERa, zfERb1, and zfERb2) and the P1~2842 reporter gene. Cells were treated with 69 mM of Cd2þ. The histograms show the relative luciferase activity (±S.E.M.) for each reporter gene. Each experiment was repeated at least twice in triplicate. The data were analyzed by one-way ANOVA (*p < 0.01, **p < 0.05, ***p < 0.005) comparing each group with the control.

the un-inducible vtg1 in ZFL cells might resulted from the low expression level or non-active ERs. Interestingly, only after cotransfection with zfERa, the activity of the vtg1 promoter (P1~2842) luciferase reporter construct was decreased by Cd2þ, suggesting Cd2þ may interfere with the activity of zfERa and thus

To gain more insight into the toxic effects of TCDD and Cd2þ in vivo, zebrafish embryos were exposed to TCDD and Cd2þ separately or in combination for 24 h. With Cd2þ alone, the mRNA expression level of vtg1 decreased at a high concentration, but in common with the E2 treatment, TCDD alone exhibited estrogenic effects by increasing vtg1 expression and the inhibitory effects of Cd2þ on vtg1 were also observed after co-treatment with TCDD. Similar effects were seen on the mRNA expression of gper and era. Neither TCDD nor Cd2þ had any effect on the mRNA expression of erb1 or erb2 (Fig. 3). To investigate how TCDD and Cd2þ regulate ER pathway genes at different developmental stages, 96 hpf larvae were treated with TCDD and Cd2þ separately or in combination for 24 h. In zebrafish larvae, vtg1 was also up-regulated by E2, but in contrast to the

Fig. 3. Effects of Cd2þ and TCDD on the mRNA expression level of vtg1 (A), gper (B), era (C), erb1 (D), and erb2 (E) in zebrafish embryos after 24 h exposure to Cd2þ at 10%, 50%, and 100% of their 24 h-LC50 values in the presence or absence of 3/30 nM TCDD treatment. The results are represented as the mean ± S.D. of three replicates. The data were analyzed by one-way ANOVA (*p < 0.01, **p < 0.05, ***p < 0.005) comparing each group with the control and Tukey's Multiple Comparison Test comparing the results of fold inductions from different treatments (the same letter indicates no significant difference) at the level of p < 0.05.

472

Y.Y. Chen, K.M. Chan / Chemosphere 147 (2016) 467e476

embryos, the expression of vtg1 was up-regulated by Cd2þ at high concentrations. After co-treatment with TCDD, the induction fold was slightly increased, although TCDD alone did not have any effect on vtg1 induction. Similar regulation was seen in gper, suggesting that the regulation of vtg1 by Cd2þ in zebrafish larvae may be mediated by GPER. Other zfERs were not responsive to TCDD or Cd2þ treatments (Fig. 4). 3.4. Effects of Cd2þ and TCDD on the ER pathway in the liver of adult zebrafish The effects of TCDD and Cd2þ on male and female zebrafish were investigated separately. In agreement with previous studies in other fish species (Kang et al., 2007; Meng et al., 2010), our data also suggest that vtg1 transcription levels in females are much higher than in male zebrafish. Similar to the in vitro results using ZFL cells, Cd2þ caused inhibition of vtg1, but TCDD and E2 did not have significant effects on vtg1 induction in the liver of female zebrafish. (Fig. 5). Interestingly, in the liver of male zebrafish, significant inductions of vtg1 were obtained in the TCDD alone and E2 treatment groups. The expression levels of gper and era were also significantly increased by TCDD, but they were inhibited by Cd2þ treatment alone and by co-treatment. Regulation of the other two estrogen receptors (erb1 and erb2) was similar in male and female zebrafish (Fig. 6), suggesting they may not be involved in the activation of vtg1 gene transcription regulation by TCDD and Cd2þ. 4. Discussion The purpose of this study was to determine the effects of Cd and

TCDD on ERs and ER-mediated vtg1 mRNA expression in zebrafish in vitro and in vivo. Our results indicate that both Cd and TCDD are potential endocrine disruptors in zebrafish, but the effects vary depending on developmental stage and gender. Although both the estrogenic and anti-estrogenic effects of Cd and TCDD in different species have been reported in other studies, the present study systematically determined the effects of Cd and TCDD in endocrine signaling by evaluating in vitro and in vivo studies, and development stage and gender differences. In oviparous vertebrates, vitellogenesis is an essential event that enables oocyte growth through incorporation of VTG. Hepatic production of VTG is tightly controlled by endogenous E2 levels, and VTG produced is transported in the blood to the ovaries, where it forms the major yolk protein for embryo development. Clearly, all events affecting vitellogenesis can affect overall reproductive success (Zhong et al., 2014). In the present study, inhibitory effects of Cd2þ on vtg1 mRNA expression were observed in the ZFL cell line, embryos and adults. Cd has also been reported to inhibit the in vivo induction of VTG synthesis in many other fish species. For example, exposure to Cd decreased plasma VTG in maturing winter flounder (Pereira et al., 1993) and co-injection of Cd with estrogen resulted in decreased plasma protein (mostly VTG) levels (Olsson et al., 1995). It is well known that Cd is toxic to fish, interfering with reproduction processes, and the present study further confirms this phenomenon. To understand the intracellular mechanisms of vtg1 inhibition by Cd, the mRNA levels of ERs that mediate vtg1 transcription were also investigated. Our results showed that in most cases, the effects of Cd2þ on era are similar to those on vtg1, suggesting that the effects of Cd2þ on vtg1 inhibition might be mainly mediated by ERa.

Fig. 4. Effects of Cd2þ and TCDD the mRNA expression level of vtg1 (A), gper (B), era (C), erb1 (D), and erb2 (E) in zebrafish larvae after 24 h exposure to Cd2þ at 10%, 50%, and 100% of their 24 h-LC50 values in the presence or absence of 3/30 nM of TCDD treatment. The results are represented as the mean ± S.D. of three replicates. The data were analyzed by oneway ANOVA (*p < 0.01, **p < 0.05, ***p < 0.005) comparing each group with the control and Tukey's Multiple Comparison Test comparing the results of fold inductions from different treatments (the same letter indicates no significant difference) at the level of p < 0.05.

Y.Y. Chen, K.M. Chan / Chemosphere 147 (2016) 467e476

473

Fig. 5. Effects of Cd2þ and TCDD on the mRNA expression level of vtg1 (A), gper (B), era (C), erb1 (D) and erb2 (E) in the liver of female zebrafish after 24 h exposure to Cd2þ at 10%, 50%, and 100% of their 24 h-LC50 values in the presence or absence of 3/30 nM of TCDD treatment. The results are represented as the mean ± S.D. of three replicates. The data were analyzed by one-way ANOVA (*p < 0.01, **p < 0.05, ***p < 0.005) comparing each group with the control and Tukey's Multiple Comparison Test comparing results of fold inductions from different treatments (the same letter indicates no significant difference) at the level of p < 0.05.

Co-transfection experiments with different types ERs expression vectors also showed that Cd2þ could markedly weaken ERa-, but not GPER- or ERb-induced vtg1 promoter construct activity in the ZFL cells. Which further confirmed the important role of ERa on vtg1 inhibition process caused by Cd2þ. Cd has been reported can replace the Zn atom from the Zn fingers of the estrogen receptor and thus block binding of the estrogen receptor to the DNA hormone responsive elements in the cell nucleus (Georgescu et al., 2011). Although our results are inconsistent with previous research in which Cd did mimic the effects of estradiol and activate ERa in an estrogen-responsive breast cancer cell line (Brama et al., 2007; Stoica et al., 2000), some other studies have also reported that Cd lacked of estrogenic effects and inhibited E2-induced reporter activity (Guevel et al., 2000; Silva et al., 2006; Vetillard and Bailhache, 2005). However, those studies did not determine the role of ER type when considering the anti-estrogenic effects of Cd, thus making it difficult to compare with our results. To the best of our knowledge, this study is the first to evaluate the function of all types of zfER in regulating vtg1 transcription in ZFL cells under Cd treatment. The response of gper expression to Cd was also quite similar to vtg1 in both in vitro and in vivo studies. However, inhibition was not observed in the GPER co-transfection experiment, indicating that the mER pathway does not directly interact with the synthetic vtg1 promoter construct. Ultimately, knock down experiments should be carried out to confirm which ERs is involved in mediating the effects of Cd on vtg 1 induction. Although Cd reduced mRNA

expression of ERbs in both ZFL cells and in zebrafish, induction of vtg1 promoter activity was not significantly decreased by Cd, suggesting that the binding of ERbs to the ERE located in the vtg1 promoter region was not blocked by Cd. Although Cd has been shown to decrease the level of ERb in the rat intestine (Hofer et al., 2010), the link between ERbs and the effects of Cd is still unclear due to conflicting data and the complexity of ERb isoforms. Our results show for the first time that Cd can decrease the expression of ERb and may thus result in reduced vtg1 transcription, but the binding activity of ERb to the vtg1 promoter was not affected in ZFL cells. A weak induction of vtg1 expression was observed in 96 hpf zebrafish larvae exposed to high concentrations of Cd2þ, which contrasts with the effects on other developmental stages and the in vitro study. The estrogenic effects of Cd have been widely studied in other species (Kerdivel et al., 2013; Silva et al., 2012). For example, Kiyun et al. reported that vtg mRNA expression was significantly up-regulated in response to Cd in benthic Chironomus riparius larvae (Park and Kwak, 2012). However, in contrast with many in vitro studies, the estrogen-like effects of Cd in zebrafish larvae do not appear to be mediated via the classical genomic ER transcriptional pathway, based on up-regulation of the expression level of membrane ER egper and the lack of induction of nuclear ERs in zebrafish larvae. Cd has been found to trigger rapid, nongenomic, membrane-associated effects in the rat uterus in vivo (Zhang et al., 2007). Furthermore, treatment of breast cancer cells with 500 nM of Cd resulted in the activation of membrane ER-

Fig. 6. Effects of Cd2þ and TCDD on the mRNA expression level of vtg1 (A), gper (B), era (C), erb1 (D) and erb2 (E) in the liver of male zebrafish after 24 h exposure to Cd2þ at 10%, 50%, and 100% of their 24 h-LC50 values in the presence or absence of 3/30 nM of TCDD treatment. The results are represented as the mean ± S.D. of three replicates. The data were analyzed by one-way ANOVA (*p < 0.01, **p < 0.05, ***p < 0.005) comparing each group with the control and Tukey's Multiple Comparison Test comparing the results of fold inductions from different treatments (the same letter indicates no significant difference) at the level of p < 0.05.

dependent intracellular signaling, and increased intracellular cAMP (Yu et al., 2010). Many studies have also reported that TCDD might not only cause estrogenic effects but also anti-estrogenic effects (Ohyama et al., 2007). In the current study, the estrogenic effects of TCDD were observed in zebrafish embryos and male adult zebrafish after 24 h acute exposure, and the induction of vtg1 by TCDD in male zebrafish is strong. No significant effects of TCDD were detected in the ZFL cell line, the zebrafish larvae and the liver of adult female fish. Those results suggest that the estrogenic or anti-estrogenic effects of TCDD in zebrafish are both age and gender dependent. The reason for non-responsive ER pathway to TCDD main due to the low expression level of ERs, which was first reported by Eide et al. (2014), and confirmed in the current study by using the in vitro gene reporter systems co-transfected with ERs expression vectors. Zebrafish liver cell line were obtained from a mixture of male and female zebrafish (Ghosh et al., 1994) might explain why ZFL cell line can't show similar response to the adult male zebrafish. Male zebrafish is the best and most sensitive model to study estrogenic effects. Although the liver is a functioning endocrine organ in female zebrafish, it does not have this function in male zebrafish under normal conditions. However, male fish have retained the cellular receptors and the synthetic machinery for producing VTGs in their hepatocytes (Ankley and Johnson, 2004a). When male fish are exposed to chemicals that bind to these hepatocyte estrogen receptors in liver synthesizes VTGs, and because the baseline VTG level in control males is low (often nondetectable), the response is comparatively sensitive and can be quite rapid. Furthermore, because males do not have the capacity to readily eliminate VTG, concentrations of the protein can remain elevated for a relatively long time after even a brief exposure to a

xenoestrogen. Male fish of species such as fathead minnow, medaka, and zebrafish have therefore been widely used as important models for testing xenoestrogens using VTG as a biomarker of exposure (Ankley and Giesy, 1998; Harries et al., 2000; Van den Belt et al., 2001). In the present study, induction of vtg1 was only observed in the liver of male zebrafish, further suggesting that the male zebrafish is a sensitive model for evaluating estrogenic effects. As organisms are exposed simultaneously to endogenous estrogens and environmental agents with estrogenic or antiestrogenic effects, it is important to understand the combined toxic effects of pollutant mixtures. Previous studies have reported that Cd can reduce E2-stimulated vtg mRNA and ER in the liver of rainbow trout (Vetillard and Bailhache, 2005) and in the male Chinese loach (Lu et al., 2012). In the present study, TCDD-induced vtg1 and er mRNA expression was also reduced by Cd in the embryos and livers of adult male zebrafish after 24 h exposure, suggesting that Cd cannot only deplete the endogenous estrogeninduced ER signaling pathway, but also inhibit the estrogenic effects induced by xenoestrogens. In conclusion, this study has demonstrated that both Cd and TCDD are endocrine disrupters, the regulation of Cd and TCDD on ER pathway were summarized in Fig. 7. Cd alone can exhibit antiestrogenic effects in the ZFL cell line, embryos and adults, whereas estrogenic effects were observed in zebrafish larvae. The effects of Cd on vtg1 gene expression are mainly mediated by ERa in zebrafish. TCDD alone can induce vtg1 mRNA expression in the embryo and liver of adult male zebrafish after 24 h exposure, and such induction may be mediated by ERa and GPER. However, this effect was not observed in the female zebrafish, and the induction of vtg1 gene expression in the male zebrafish was much higher than in the embryos, suggesting that only the male fish is an effective

Y.Y. Chen, K.M. Chan / Chemosphere 147 (2016) 467e476

475

Fig. 7. Estrogenic or anti-estrogenic effects of Cd2þ and TCDD in ZFL cells and different developmental stages of zebrafish. The ER pathways affected by Cd2þ and TCDD are depicted. Genes known to be up-regulated by Cd2þ and TCDD after 24 h exposure are marked with a circle and those that are down-regulated are marked with a rectangle. Genes with no significant response to Cd2þ and TCDD induction are marked with a dotted line. The dotted line with arrows represents the interaction of Cd2þ and TCDD on the vtg1 gene.

model for evaluating acute estrogenic effects. After co-exposure, Cd still effectively decreased TCDD-induced vtg1 expression both in vitro and in vivo. Although the effects of Cd and TCDD on vtg1 and related ERs have been thoroughly examined in the present study, additional studies such as knock down experiments are needed to confirm the mechanisms by which Cd and TCDD exert toxicity at different stages of zebrafish development. Conflicts of interest The authors have no conflicts of interest to declare. Acknowledgments We thank the School of Life Sciences for providing a core facility and research allowance to conduct this research. Y. Y. Chen was the recipient of post-graduate studentships. Special thanks to Dr. Zhang Lei, who provided us with technical assistance and help with the cell culture and transfection analysis. The generosity of Professors Jimmy Yu and Wu Chi (Department of Chemistry, Chinese University), who loaned or shared their equipment with us for the transient gene expression study, is also very much appreciated. Appendix A. Supplementary data Supplementary data related to this article can be found at http:// dx.doi.org/10.1016/j.chemosphere.2015.12.083. References Ali, I., Penttinen-Damdimopoulou, P.E., Makela, S.I., Berglund, M., Stenius, U., Akesson, A., Hakansson, H., Halldin, K., 2010. Estrogen-like effects of cadmium in vivo do not appear to be mediated via the classical estrogen receptor transcriptional pathway. Environ. Health Perspect. 118, 1389e1394.

Ali, S., Aalders, J., Ricjardson, M.K., 2014. Teratological effects of a panel of sixty water-soluble toxicants o zebrafish development. Zebrafish 11, 129e141. Ankley, G.T., Giesy, J.P., 1998. Endocrine Disruptors in Wildlife: a Weight-ofevidence Perspective. SETAC. Tech. Publicat, pp. 349e367. Ankley, G.T., Johnson, R.D., 2004. Small fish models for identifying and assessing the effects of endocrine-disrupting chemicals. ILAR J. 45, 469e483. Bertram, M.G., Saaristo, M., Baumgartner, J.B., Johnstone, C.P., Allinson, M., Allinson, G., Wong, B.B.M., 2015. Sex in troubled water: widespread agricultural contaminant disrupts reproductive bahaviour in fish. Horm. Behav. 70, 85e91. Boverhof, D.R., Kwekel, J.C., Humes, D.G., Burgoon, L.D., Zacharewski, T.R., 2006. Dioxin induces an estrogen-like, estrogen receptor-dependent gene expression response in the murine uterus. Mol. Pharmacol. 69, 1599e1606. Brama, M., Gnessi, L., Basciani, S., Cerulli, N., Politi, L., Spera, G., Mariani, S., Cherubini, S., Scotto d'Abusco, A., Scandurra, R., Migliaccio, S., 2007. Cadmium induces mitogenic signaling in breast cancer cell by an ERalpha-dependent mechanism. Mol. Cell. Endocrinol. 264, 102e108. Bugel, S.M., White, L.A., Cooper, K.R., 2013. Inhibition of vitellogenin gene induction by 2,3,7,8-tetrachlorodibenzo-p-dioxin is mediated by aryl hydrocarbon receptor 2 (AHR2) in zebrafish (Danio rerio). Aq. Toxicol. 126, 1e8. Busquet, F., Nagel, R., von Landenberg, F., Mueller, S.O., Huebler, N., Broschard, T.H., 2008. Development of a new screening assay to identify proteratogenic substances using zebrafish Danio rerio embryo combined with exogenous mammalian metabolic activation system (mDarT). Toxicol. Sci. 104, 177e188. Calo, M., Alberghina, D., Bitto, A., Lauriano, E.R., Lo Cascio, P., 2010. Estrogenic followed by anti-estrogenic effects of PCBs exposure in juvenil fish (Spaurus aurata). Food. Chem. Toxicol. 48, 2458e2463. Chaffin, C.L., Peterson, R.E., Hutz, R.J., 1996. In utero and lactational exposure of female Holtzman rats to 2,3,7,8-tetrachlorodibenzo-p-dioxin: modulation of the estrogen signal. Biol. Reprod. 55, 62e67. Chan, W.K., Chan, K.M., 2012. Disruption of the hypothalamic-pituitary-thyroid axis in zebrafish embryo-larvae following waterborne exposure to BDE-47, TBBPA and BPA. Aq. Toxicol. 108, 106e111. Chan, K.M., Ku, L.L., Chan, P.C.Y., Cheuk, W.K., 2006. Metallothionein gene expression in zebrafish embryo-larvae and ZFL cell-line exposed to heavy metal ions. Mar. Environ. Res. 62, S83eS87. Chen, Y.Y., Zhu, J.Y., Chan, K.M., 2014. Effects of cadmium on cell proliferation, apoptosis, and proto-oncogene expression in zebrafish liver cells. Aq. Toxicol. 157, 196e206. Dai, Y.J., Jia, Y.F., Chen, N., Bian, W.P., Li, Q.K., Ma, Y.B., Chen, Y.L., Pei, D.S., 2014. Zebrafish as a model system to study toxicology. Environ. Toxicol. Chem. 33, 11e17. Denslow, N., Sepulveda, M., 2007. Ecotoxicological effects of endocrin disrupting compounds on fish reproduction. In: Babin, P.J., Cerda, J., Lubzens, E. (Eds.), The

476

Y.Y. Chen, K.M. Chan / Chemosphere 147 (2016) 467e476

Fish Oocyte: from Basic Studies to Biotechnological Applications. Springer Netherlands, pp. 255e322. DeVito, M.J., Thomas, T., Martin, E., Umbreit, T.H., Gallo, M.A., 1992. Antiestrogenic action of 2,3,7,8-tetrachlorodibenzo-p-dioxin: tissue-specific regulation of estrogen receptor in CD1 mice. Toxicol. Appl. Pharmacol. 113, 284e292. Eide, M., Rusten, M., Male, R., Jensen, K.H.M., Goksoyr, A., 2014. A characterization of the ZFL cell and primary hepatocytes as in vitro liver cell models for the zebrafish (Danio rerio). Aq. Toxicol. 147, 7e17. Filardo, E.J., Thomas, P., 2012. Minireview: G protein-coupled estrogen receptor-1, GPER-1: its mechanism of action and role in female reproductive cancer, renal and vascular physiology. Endocrinology 153, 2953e2962. ban, S., Bouaru, A., Pas¸cal Georgescu, B., Bogdan, C., D ara au, S., 2011. Heavy metals acting as endocrine disrupters. Anim. Sci. Biotech. 44, 89e93. Guevel, R.L., Petit, F.G., Goff, P.L., Metivier, R., Valotaire, Y., Pakdel, F., 2000. Inhibition of rainbow trout (Oncorhynchus mykiss) estrogen receptor activity by cadmium. Biol. Reprod. 63, 259e266. Hansen, P.D., Dizer, H., Hock, B., Marx, A., Sherry, J., McMaster, M., Blaise, C., 1998. Vitellogenin - a biomarker for endocrine disruptors. Trac-Trend Anal. Chem. 17, 448e451. Harries, J.E., Runnalls, T., Hill, E., Harris, C.A., Maddix, S., Sumpter, J.P., Tyler, C.R., 2000. Development of a reproductive performance test for endocrine disrupting chemicals using pair-breeding fathead minnows (Pimephales promelas). Environ. Sci. Technol. 34, 3003e3011. Heiden, T.K., Carvan III, M.J., Hutz, R.J., 2006. Inhibition of follicular development, vitellogenesis, and serum 17b-estradiol concentrations in zebrafish following chronic, sublethal dietary exposure to 2,3,7,8-tetrachlorodibenzo-p-dioxin. Toxicol. Sci. 90, 490e499. Hofer, N., Diel, P., Wittsiepe, J., Wilhelm, M., Kluxen, F.M., Degen, G.H., 2010. Investigations on the estrogenic activity of the metallohormone cadmium in the rat intestine. Arch. Toxicol. 84, 541e552. Hombach-Klonisch, S., Pocar, P., Kietz, S., Klonisch, T., 2005. Molecular actions of polyhalogenated arylhydrocarbons (PAHs) in female reproduction. Curr. Med. Chem. 12, 599e616. Hombach-Klonisch, S., Pocar, P., Kauffold, J., Klonisch, T., 2006. Dioxin exerts antiestrogenic actions in a novel dioxin-responsive telomerase-immortalized epithelial cell line of the porcine oviduct (TERT-OPEC). Toxicol. Sci. 90, 519e528. Johnson, M.D., Kenney, N., Stoics, A., Hilakivi-Clarke, L., Singh, B., Chepko, G., Clarke, R., Sholler, P.F., Lirio, A.A., Foss, C., Reiter, R., Trock, B., Paik, S., Marting, M.B., 2003. Cadmium mimics the in vivo effects of estrogen in the uterus and mammary gland. Nat. Med. 9, 1081e1084. Kang, B.J., Jung, J.H., Lee, J.M., Lim, S.G., Saito, H., Kim, M.H., Kim, Y.J., Saigusa, M., Han, C.H., 2007. Structural and expression analyses of two vitellogenin genes in the carp, Cyprinus carpio. Comp. Biochem. Physiol. Part B, Biochem. Molec. Biol. 148, 445e453. Kerdivel, G., Habauzit, D., Pakdel, F., 2013. Assessment and molecular actions of endocrine-disrupting chemicals that interfere with estrogen receptor pathways. Int. J. Endocrinol. 2013. Article ID 501851. http://dx.doi.org/10.1155/2013/ 501851. Kuiper, G.G., Carlsson, B., Grandien, K., Enmark, E., Haggblad, J., Nilsson, S., Gustafsson, J.A., 1997. Comparison of the ligand binding specificity and transcript tissue distribution of estrogen receptors alpha and beta. Endocrinology 138, 863e870. Liang, Y.L., Dai, J., Pang, X., 2011. Heavy metal pollution in surface water of linglong gold mining area, China. Procedia Environ. Sci. 10, 914e917. Liu, X., Zhu, P., Sham, K.W., Yuen, J.M., Xie, C., Zhang, Y., Liu, Y., Li, S., Huang, X., Cheng, C.H., Lin, H., 2009. Identification of a membrane estrogen receptor in zebrafish with homology to mammalian GPER and its high expression in early germ cells of the testis. Biol. Reprod. 80, 1253e1261. Liu, C., Deng, J., Yu, L., Ramesh, M., Zhou, B., 2010. Endocrine disruption and reproductive impairment in zebrafish by exposure to 8:2 fluorotelomer alcohol. Aq. Toxicol. 96, 70e76. Lohr, H., Hammerschmidt, M., 2011. Zebrafish in endocrine systems: recent advances and implications for human disease. Ann. Rev. Physiol. 73, 183e211. Lu, X.F., Liu, F.Y., Zhou, X.P., Zhou, Q.F., Deng, Y.L., 2012. Effects of cadmium, 17 betaestradiol and their interaction in the male Chinese loach (Misgurnus anguillicaudatus). Chin. Sci. Bull. 57, 858e863. Meng, X., Bartholomew, C., Craft, J.A., 2010. Differential expression of vitellogenin and oestrogen receptor genes in the liver of zebrafish, Danio rerio. Anal. Bioanal. Chem. 396, 625e630. Menuet, A., Le Page, Y., Torres, O., Kern, L., Kah, O., Pakdel, F., 2004. Analysis of the estrogen regulation of the zebrafish estrogen receptor (ER) reveals distinct

effects of ERalpha, ERbeta1 and ERbeta2. J. Mol. Endocrinol. 32, 975e986. Ohtake, F., Takeyama, K., Matsumoto, T., Kitagawa, H., Yamamoto, Y., Nohara, K., Tohyama, C., Krust, A., Mimura, J., Chambon, P., Yanagisawa, J., FujiiKuriyama, Y., Kato, S., 2003. Modulation of oestrogen receptor signalling by association with the activated dioxin receptor. Nature 423, 545e550. Ohtake, F., Baba, A., Takada, I., Okada, M., Iwasaki, K., Miki, H., Takahashi, S., Kouzmenko, A., Nohara, K., Chiba, T., Fujii-Kuriyama, Y., Kato, S., 2007. Dioxin receptor is a ligand-dependent E3 ubiquitin ligase. Nature 446, 562e566. Ohtake, F., Baba, A., Fujii-Kuriyama, Y., Kato, S., 2008. Intrinsic AhR function underlies cross-talk of dioxins with sex hormone signalings. Biochem. Biophys. Res. Commun. 370, 541e546. Ohyama, K., Ohta, M., Sano, T., Sato, K., Nakagomi, Y., Shimura, Y., Yamano, Y., 2007. Maternal exposure of low dose of TCDD modulates the expression of estrogen receptor subunits of male gonads in offspring. J. Vet. Med. Sci. 69, 619e625. Okey, A.B., Riddick, D.S., Harper, P.A., 1994. The Ah receptor: mediator of the toxicity of 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) and related compounds. Toxicol. Lett. 70, 1e22. Olsson, P.E., Kling, P., Petterson, C., Silversand, C., 1995. Interaction of cadmium and oestradiol-17 beta on metallothionein and vitellogenin synthesis in rainbow trout (Oncorhynchus mykiss). Biochem. J. 307, 197e203. Park, K., Kwak, I.S., 2012. Assessment of potential biomarkers, metallothionein and vitellogenin mrna expressions in various chemically exposed benthic chironomus riparius larvae. Ocean. Sci. J. 47, 435e444. Pereira, J.J., Mercaldoallen, R., Kuropat, C., Luedke, D., Sennefelder, G., 1993. Effect of cadmium accumulation on serum vitellogenin levels and hepatosomatic and gonadosomatic indexes of winter flounder (Pleuronectes americanus). Arch. Environ. Contam. Toxicol. 24, 427e431. Rogers, J.M., Denison, M.S., 2002. Analysis of the antiestrogenic activity of 2,3,7,8tetrachlorodibenzo-p-dioxin in human ovarian carcinoma BG-1 cells. Mol. Pharmacol. 61, 1393e1403. Safe, S., Wormke, M., 2003. Inhibitory aryl hydrocarbon receptor-estrogen receptor alpha cross-talk and mechanisms of action. Chem. Res. Toxicol. 16, 807e816. Segner, H., 2009. Zebrafish (Danio rerio) as a model organism for investigating endocrine disruption. Comp. Biochem. Physiol. Part C Toxicol. Pharmacol. 149, 187e195. Silva, E., Lopez-Espinosa, M.J., Molina-Molina, J.M., Fernandez, M., Olea, N., Kortenkamp, A., 2006. Lack of activity of cadmium in in vitro estrogenicity assays. Toxicol. Appl. Pharmacol. 216, 20e28. Silva, N., Peiris-John, R., Wickremasinghe, R., Senanayake, H., Sathiakumar, N., 2012. Cadmium a metalloestrogen: are we convinced? J. Appl. Toxicol. 32, 318e332. Smeets, J.M., Rankouhi, T.R., Nichols, K.M., Komen, H., Kaminski, N.E., Giesy, J.P., van den Berg, M., 1999. In vitro vitellogenin production by carp (Cyprinus carpio) hepatocytes as a screening method for determining (anti)estrogenic activity of xenobiotics. Toxicol. Appl. Pharmacol. 157, 68e76. Stoica, A., Katzenellenbogen, B.S., Martin, M.B., 2000. Activation of estrogen receptor-alpha by the heavy metal cadmium. Mol. Endocrinol. 14, 545e553. Takiguchi, M., Yoshihara, S., 2006. New aspects of cadmium as endocrine disruptor. Environ. Sci. Intl. J. Environ. Physiol. Toxicol. 13, 107e116. Van den Belt, K., Verheyen, R., Witters, H., 2001. Reproductive effects of ethynylestradiol and 4t-octylphenol on the zebrafish (Danio rerio). Arch. Environ. Contam. Toxicol. 41, 458e467. Vetillard, A., Bailhache, T., 2005. Cadmium: an endocrine disrupter that affects gene expression in the liver and brain of juvenile rainbow trout. Biol. Reprod. 72, 119e126. Wang, H., Tan, J.T., Emelyanov, A., Korzh, V., Gong, Z., 2005. Hepatic and extrahepatic expression of vitellogenin genes in the zebrafish, Danio rerio. Gene 356, 91e100. Yamauchi, M., Kim, E.Y., Iwata, H., Shima, Y., Tanabe, S., 2006. Toxic effects of 2,3,7,8tetrachlorodibenzo-p-dioxin (TCDD) in developing red seabream (Pagrus major) embryo: an association of morphological deformities with AHR1, AHR2 and CYP1A expressions. Aq. Toxicol. 80, 166e179. Yu, X., Filardo, E.J., Shaikh, Z.A., 2010. The membrane estrogen receptor GPR30 mediates cadmium-induced proliferation of breast cancer cells. Toxicol. Appl. Pharmacol. 245, 83e90. Zhang, W.C., Yang, J.S., Wang, J.L., Xia, P.C., Xu, Y.Q., Jia, H.M., Chen, Y.S., 2007. Comparative studies on the increase of uterine weight and related mechanisms of cadmium and p-nonylphenol. Toxicology 241, 84e91. Zhong, L., Yuan, L., Rao, Y., Li, Z., Zhang, X., Liao, T., Xu, Y., Dai, H., 2014. Distribution of vitellogenin in zebrafish (Danio rerio) tissues for biomarker analysis. Aq. Toxicol. 149, 1e7. Zhu, J.Y., Chan, K.M., 2012. Mechanism of cadmium-induced cytotoxicity on the ZFL zebrafish liver cell line. Metallomics 4, 1064e1076.