MOLECULAR AND CELLULAR BIOLOGY, Apr. 1992, p. 1652-1662 0270-7306/92/041652-11$02.00/0 Copyright X) 1992, American Society for Microbiology

Vol. 12, No. 4

Regulation of Vitellogenin Gene Expression in Transgenic Caenorhabditis elegans: Short Sequences Required for Activation of the vit-2 Promoter M. MACMORRIS,* S.

BROVERMANJ, S. GREENSPOON,t K. LEA, C. MADEJ,

T. BLUMENTHAL, AND J. SPIETH Department of Biology, Indiana University, Bloomington, Indiana 47405 Received 25 November 1991/Accepted 20 January 1992

The Caenorhabditis elegans vitellogenin genes are subject to sex-, stage-, and tissue-specific regulation: they are expressed solely in the adult hermaphrodite intestine. Comparative sequence analysis of the DNA immediately upstream of these genes revealed the presence of two repeated heptameric elements, vit promoter element 1 (VPE1) and VPE2. VPE1 has the consensus sequence TGTCAAT, while VPE2, CTGATAA, shares the recognition sequence of the GATA family of transcription factors. We report here a functional analysis of the VPEs within the 5'-flanking region of the vit-2 gene using stable transgenic lines. The 247 upstream bp containing the VPEs was sufficient for high-level, regulated expression. Furthermore, none of the four deletion mutations or eight point mutations tested resulted in expression of the reporter gene in larvae, males, or inappropriate hermaphrodite tissues. Mutation of the VPE1 closest to the TATA box inactivated the promoter, in spite of the fact that four additional close matches to the VPE1 consensus sequence are present within the 5'-flanking 200 bp. Each of these upstream VPEl-like sequences could be mutated without loss of high-level transgene expression, suggesting that if these VPE1 sequences play a role in regulating vit-2, their effects are more subtle. A site-directed mutation in the overlapping VPE1 and VPE2 at -98 was sufficient to inactivate the promoter, indicating that one or both of these VPEs must be present for activation of vit-2 transcription. Similarly, a small perturbation of the VPE2 at -150 resulted in reduction of fp155 expression, while a more extensive mutation in this element eliminated expression. On the other hand, deletion of this VPE2 and all upstream DNA still permitted correctly regulated expression, although at a very low level, suggesting that this VPE2 performs an important role in activation of vit-2 expression but may not be absolutely required. The results, taken together, demonstrate that both VPE1 and VPE2 are sites for activation of the vit-2 promoter.

Vitellogenin genes are among the most studied developmentally regulated genes in a wide variety of organisms. Typically, vitellogenins are encoded by small gene families (33). The mRNAs are abundantly expressed in only one or two tissues and generally only in the adult female. Thus, they have been the focus of studies on mechanisms of sex-specific gene regulation. Analysis of Drosophila yolk protein gene regulation revealed the presence of two sexand tissue-specific enhancers (10, 11). Vitellogenin gene families in vertebrates are regulated by estrogen, and analysis of these genes contributed to the current understanding of the estrogen response element (5). The vertebrate vitellogenin promoters are currently the focus of intensive investigations into the mechanism of transcriptional enhancement by the estrogen receptor. In Caenorhabditis elegans, the vitellogenins are encoded by a six-gene family (2, 27). These genes are tightly regulated during development; vitellogenin mRNA first appears at the end of the last larval stage (LA) only in the 30 to 34 nuclei of the hermaphrodite intestine (2, 14, 23). Levels remain high throughout adult life. No vitellogenin mRNA is present in the male or in any other cells of the hermaphrodite. Because the nematode genes are members of the same gene family as the vertebrate vitellogenin genes (20, 28, 30) and because the *

mode of regulation appeared to be so similar, we expected that the regulatory apparatus of the nematode and vertebrates might be closely related as well. An analysis of the 5'-flanking DNA of the nematode genes revealed no convincing match to an estrogen response element. There are, however, two repeated heptameric sequences present multiple times within the first 300 bp upstream of each of the six C. elegans vit genes (28). Furthermore, analysis of the related species, Caenorhabditis briggsae, showed that these sequence elements had been highly conserved compared with the surrounding DNA (35). One of these elements, vit promoter element 1 (VPE1), has the consensus sequence TGTCAAT, which is similar to the mammalian CCAAT box. In the C. elegans vit promoters, VPE1 is always present immediately upstream of the TATA box, usually as a perfect match to the consensus sequence. Each of the 11 Caenorhabditis vit promoters analyzed contains at least three additional matches to the consensus sequence (allowing a 1-bp mismatch) within 300 bp of the cap site (28, 35). The other heptameric element, VPE2, has the consensus sequence CTGATAA. This sequence is a perfect match to the binding site for the mammalian erythrocytespecific activator GATA-1 (22). In the vit promoters, VPE2 is always present between -90 and -150, often twice within this region, and almost always as a perfect match to the consensus sequence. A close relative of this sequence is also present in several other C. elegans promoter regions, namely, just upstream of the TATA box of the major sperm protein (msp) genes (15), in a region required for intestinespecific expression of the C. elegans gut esterase gene ges-I

Corresponding author.

t Present address: Fred Hutchinson Cancer Research Center,

Seattle, WA 98104. t Present address: Department of Biology, University of Michigan, Ann Arbor, MI 48109-1048. 1652

VOL. 12, 1992

C. ELEGANS vit TRANSGENIC PROMOTER ANALYSIS

(1, 31a), and just upstream of the tra-2 gene required for correct sex determination (1Sa, 21). The C. elegans homolog to the genes encoding the vertebrate GATA transcription factors has recently been cloned and its promoter contains multiple copies of VPE2 (31). The similarity of VPE1 and VPE2 to known binding sites for transcriptional regulatory proteins and the conservation of sequence and position suggest that these elements are involved in the high-level, sex-, stage-, and tissue-specific regulation of the vitellogenins. In order to learn whether the VPEs function in the regulation of the vit genes, we have analyzed the expression of a vit fusion gene under the control of the vit-2 promoter in transgenic worms. We have shown that in stable, low-copy-number transgenic strains, the introduced gene is correctly regulated (29). The fusion reporter gene is composed of the 5'-flanking region of vit-2 (3.9 kb) and the first 3.4 kb of the vit-2 coding region fused in frame to a 1.4-kb 3' fragment of vit-6 containing an additional 800 bp of noncoding DNA. It encodes a vitellogenin-related polypeptide of a unique size (155 kDa) that is easily detected on Western blots (immunoblots) of whole worms. It also makes a novel mRNA, whose synthesis is restricted to the adult hermaphrodite intestine. In this report, we demonstrate that a short region of 5'-flanking DNA containing the VPEs is sufficient to ensure correctly regulated expression of the fusion gene at nearly normal levels. We demonstrate that point mutations in some of the VPEs eliminate expression, while mutations in other VPEs have little effect. The data indicate that both VPE1 and VPE2 are binding sites for activators.

MATERIALS AND METHODS Worms. General procedures for maintaining and handling C elegans have been described by Brenner (3). Large-scale synchronous cultures were obtained by alkaline hypochlorite digestion of adults and hatching of the resulting embryos without food as described previously by Wood (34). The strain used for injections was heterozygous for an amber allele of tra-3 and contained the balancer chromosome nTJ[unc(n75dom)1et] (6). The propagation of this strain, identification of tra-3 homozygotes, and selection of transformants, as well as details of the injection procedure, have been described by Fire (7). Heterozygous strains were maintained as mixtures of transgene heterozygotes and their tra-3 homozygous sibs that lack the transgene. The populations are easily maintained, since the tra-3 individuals produce only one generation of sterile pseudomale progeny. Only the transgenic animals continue to propagate, although their frequency in the mixture can vary between populations unpredictably. For analysis of fusion protein levels in the transgenic strains, the worms were synchronized and collected at approximately 72 h after being placed on plates seeded with Escherichia coli as newly hatched Li larvae. Individuals from those strains which were heterozygous for the integrated transgene were cloned to verify their genotypes before their proteins were analyzed. Plasmids. (i) Fusion gene. The vitellogenin fusion gene with 247 bp of 5'-flanking vit-2 DNA (Fig. 1) was constructed by first cloning a 1.4-kb EcoRI fragment containing the 3' end of vit-6 into the polylinker EcoRI site in the sup-7-containing plasmid pAstl8A (8). The resulting plasmid is called pV6-3'. The vit-6 fragment was isolated from the genomic clone F9 (27) and contained 673 bp of the 3' end of vit-6 (582 bp of coding sequence and 91 bp of noncoding sequence) and 800

1653

bp of 3'-flanking DNA. A 3.8-kb fragment of vit-2 was isolated from pJ5 (29) by complete digestion with BamHI and partial digestion with Bcll and then subcloned into the BamHI polylinker site of pV6-3'. This vit-2 fragment contained 3.5 kb of coding sequence and 247 bp of 5'-flanking DNA. All of the clones contained the vit-2 insert in the wrong orientation. To obtain the correct orientation, the plasmid was linearized with KpnI which cut only in the polylinker, 3' overhangs were made blunt by T4 polymerase (17), and XbaI linkers were added. After removal of unligated linkers, the fragment was isolated by digestion with BamHI and XbaI, gel purified, and ligated into BamHI-XbaIdigested pV6-3'. The resulting plasmid is called pJ247, and in it the vit-2 coding region is in frame with the vit-6 coding sequence through 15 bp of polylinker sequence. In the resulting plasmid, the fusion gene is identical to the fusion gene in pJ5, but only with 247 bp of the vit-2 5'-flanking DNA. (ii) Promoter mutation and deletion plasmids. All mutations and deletions were made in pDJ1, a subclone of pJ247 that contains the 2.1-kb SphI fragment (Fig. 1) cloned into pTZ18U (19). All the mutations and deletions were checked by double-stranded DNA sequencing using a Sequenase DNA Sequencing Kit (United States Biochemical Corp.). The altered SphI fragments were isolated and cloned into SphI-digested pJ247DSph, a subclone of pJ247 lacking the 2.1-kb SphI fragment. The orientation of the SphI fragment in the resulting clones was determined by digestion with NcoI (Fig. 1). All point mutations were made by site-directed mutagenesis, using an Amersham Oligonucleotide-Directed In Vitro Mutagenesis System (version 2). The 5' deletions in pJ142, pJ110, and pJ49 (Fig. 2B) were made by cutting pDJ1 at unique restriction sites either created by in vitro mutagenesis or already present in the promoter and adding SphI linkers. After excess unligated linkers were removed, the plasmids were digested with SphI, and the resulting fragments were gel purified and cloned into SphI-digested pJ247DSph. The unique restriction sites created by in vitro mutagenesis are BalI in pJ247L, which gave rise to pJ110, and EcoRV in pJ247R, which generated pJ142. pJ49 was created by cutting pJ247 with XbaI and NdeI, blunt ending by filling in the ends and religating. The 5' deletion in pJ174 was made by BAL31 digestion. Nucleic acid purifications. (i) DNA. Plasmid DNAs for injections were prepared by alkaline lysis and further purification by LiCl precipitation, digestion with RNase and proteinase K, extraction with phenol-chloroform, and precipitation with ethanol as described by Fire and Waterston (9). Worm genomic DNA was purified by proteinase K digestion and phenol-chloroform extraction (29). (ii) RNA. RNA was purified from synchronous liquid cultures of adult worms by disruption of the worms in 6 M guanidine-HCl, ethanol precipitation, resuspension in 7 M urea, and repeated phenol-chloroform extractions (2, 29). Southern analysis. For Southern analyses, agarose gels were blotted onto Hybond-N nylon membrane (Amersham) as recommended by the manufacturer and hybridized to gel-purified restriction fragments. Hybridizations were done in a solution containing 50% formamide, 1 x SSC (1 x SSC is 0.15 M NaCl plus 0.015 M sodium citrate), 2x Denhardt's solution, 0.05 M Na phosphate buffer (pH 6.5), 0.1% sodium dodecyl sulfate (SDS), and 100 mg of sheared salmon sperm DNA per ml at 42°C for 15 h; two 15-min washes in 2x SSC-0.2% SDS at room temperature and two 30-min washes in O.lx SSC-0.1% SDS at 55°C were then performed. The

1654

MAcMORRIS ET AL.

MOL. CELL. BIOL.

vit-2 vit-6

5'

(ypl 70B)

5.

B

\ (Ypl

(yp88) \,vlt-2/6\

R

/

(fpl 55)

5,

R

sup-7

pJ247 (polylinker)

(polylinker) HX S `

57 Ni i

S

HN

R

I

11

1

B K R

7 7

HH R

11 I

I

I

I

I

I

I

I

I

1

2

3

4

5

6

7

8

I-

T

2.6 kb PF

2.3 kb TF

FIG. 1. Construction of the pJ247 fusion gene plasmid. pJ247 was constructed by cloning a 1.4-kb EcoRI fragment from the 3' end of vit-6 into the polylinker EcoRI site of the sup-7-containing plasmid pAst18A (8). A 3.8-kb BamHI-BclI fragment from the 5' end of vit-2, containing 247 bp upstream of the start site of transcription, was then cloned into the BamHI polylinker site. An additional step (not shown but described in Materials and Methods) was required to correct the orientation of the vit-2 insert. vit-2 encodes the yp17OB vitellogenin, and vit-6 encodes the precursor to ypll5 and yp88. The fusion gene encodes a 155-kDa protein called fp155. The HindIII fragments that hybridize to the vit-2 promoter probe and vit-6 terminator probe are shown at the bottom of the figure as 2.6 kb PF and 2.3 kb TF, respectively. Restriction site abbreviations: B, BamHI; Bc, BclI; H, HindIII; K, KpnI; N, NcoI; R, EcoRI; S, SphI; and X, XbaI.

restriction fragments were purified from agarose gels and radioactively labeled using a Boehringer Mannheim Random Primed DNA Labeling Kit. Each genomic DNA blot was hybridized sequentially, first with a probe to detect the 5' (vit-2) portion, using a 265-bp Sau3A fragment that hybridizes specifically to the vit-2 promoter region, and then with a 1.4-kb EcoRI fragment of the vit-6 gene to detect the terminator region of vit-6 included in the fusion gene. Intact copies of full-length plasmid, 8.3 kb (in tandem with at least a partial plasmid copy), were detected by hybridization of either probe to the genomic DNA digested with KpnI, which cuts only in the polylinker. Restriction digests with HindIII result in two major bands, a 2.6-kb fragment detected by hybridization to the vit-2 promoter fragment (2.6 kb PF, [Fig. 1]) and a 2.3-kb fragment detected by hybridization to the vit-6 terminator fragment (2.3 kb TF [Fig. 1]). The sizes of the predicted fragments containing the endogenous vit-6 gene are 11.8 kb for a KpnI digest and 1.8 kb for HindIII. In situ protein synthesis. BL203 adult hermaphrodites, males, and larvae were assayed for their ability to synthesize the fusion protein (fplS5) by cutting worms in [35S]methionine as described previously (29). Isolated tissues from BL203 hermaphrodites were similarly tested for fp155 synthesis, and in all cases, products were separated by SDSpolyacrylamide gel electrophoresis (PAGE) and detected autoradiographically. Si protection assays. Si protection assays were performed using 20 ,ug of total RNA as described by Greene and Struhl (12). The probe was a 125-base oligonucleotide complemen-

tary to the region of the fusion gene where vit-2 and vit-6 are joined. This oligonucleotide was designed so that protection by the fusion gene RNA and vit-6 RNA could be distinguished. It contained 85 bases complementary to vit-6 RNA, 15 bases complementary to the polylinker through which they are joined, 15 bases complementary to vit-2 RNA, and 10 noncomplementary bases at the 3' end. The oligonucleotides were radioactively labeled using a kinase reaction as described by Maniatis et al. (18). Samples were electrophoresed on a gel made of 10% polyacrylamide, 7 M urea, and 1 x TBE (Tris-borate-EDTA) buffer and autoradiographed. To quantify the S1 results, the gel and film were aligned and the bands corresponding to each protected fragment were excised and Cerenkov counted in a scintilla-

tion counter. The amounts of RNA present were calculated by first subtracting background counts and then adjusting all lanes for uneven loading on the basis of the counts in the vit-6 band. The factors used to equalize the vit-6 value for each lane were also used to adjust the counts in the vit-2/6 bands. Western blot analysis. Protein was extracted from whole worms by boiling the worms in a solution containing 0.067 M Tris-HCI (pH 6.8), 2% SDS, 5% glycerol, 5% (vol/vol) P-mercaptoethanol, and 0.05% bromphenol blue for 3 min. After brief centrifugation, proteins were electrophoresed on 5% polyacrylamide-SDS gels as described by Laemmli (16) and modified by Sharrock (24). Western blotting was performed as described by Towbin et al. (32) with several modifications. The gels were soaked briefly in a solution

C. ELEGANS vit TRANSGENIC PROMOTER ANALYSIS

VOL. 12, 1992

-200 *

A

*

*

*

*

*

*

GATCAAACTGTATTACTTGAAACAATTTAGTTATATGTTTAGAACCCCTCATTCAAAATT4ATAGAC -150

1655

GGGCTCTCACCG

-100

GGGTCACAAAGCGGAGCGAATGCTTGAATITGTCCA

AATGTTGCAATTTGTT
4W f 4Ww~ PI 1p5 W*J-.: , -i

45-

29-!

EBL203 (p3247 homozygotes)

C2

_ rp'55

c

BL315 (pJI42 homozygotes) J z 5 5 5 5 5 55 5 10 5 10 Ad X

i 5

* -i|i __

_

__

_

_

wn.dibi-ma.

cc~m cmN

20 Ntc

N

('10

C,t z

m

c

N

m m

m

N

0, C' Lo u.

vit-6

-

BL320 BL321 BL322 m N2 Ad L Adq Asd? AdV AdV 60 5 10 20 60 5 10 20 12 5 10 20 5 10 L

:_:.4-.-4

X gl2

E

k_

.

~~~~~~yp170A,B

_~~~~~~~fp155

FIG. 6. Western blot analysis of proteins from transgenic strains. Proteins were separated on 5% polyacrylamide-SDS gels, electroblotted to nitrocellulose, reacted with rat anti-ypll5 primary antibody, biotinylated goat anti-rat, and "2I-labelled streptavidin. In each case, the autoradiographic image of the bound "2I-labelled streptavidin is shown with the primary products (ypll5 and fp155) indicated with arrows. Cross-reacting vit products ypl70A and ypl70B are indicated by dots. An asterisk marks a product that cross reacts to streptavidin (on the basis of binding to this band in the absence of primary antibody). (A) Dilution series of BL203, a pJ247 strain. Lanes were loaded with protein from 1, 2, 5, and 10 worm equivalents. (B) Single heterozygotes of BL207(pJ247) compared with BL203 (a pJ247 homozygote) and N2 (wild type). (C) Expression of fp155 in BL315 (a pJ142 homozygote). Each lane contains protein from five hermaphrodites. Larvae from BL315 are shown in the leftmost lane. (D) Three pJ49-containing strains showing no expression. For each strain indicated, protein from the equivalent of 5, 10, and 20 worms was analyzed. Also shown on this gel are lanes containing larval proteins (L) from BL320 and BL321 and proteins isolated from BL322 adult (Ad) males.

-

123 bp 110

expression from obligate heterozygous strains, we devised a

90

quantitative Westem blot method for measuring expression of fp155 in single worms. A detection system using biotinstreptavidin recognition gave the necessary sensitivity. Dilutions of a control strain demonstrated an approximately linear relationship between protein level and binding of streptavidin within this range (Fig. 6A). Figure 6B to D contain representative data from several transgenic strains. Each panel includes multiple lanes of protein from one or more animals, as indicated, as well as the nontransformed control (N2) and BL203, a strain containing a single inte-

g_I A

(pJ49)

N

0

=*

770A.B ~~~~~~~~~ypl

a,a,4

w

vit- 2/6-

D

i

.4- ypI 15

____l

changed the tissue, sex, or stage specificity of vitellogenin synthesis. Some mutant strains did, however, exhibit significant differences in the level of expression. We quantified the expression levels of mutant strains in two ways, Si digestion of RNA and Western blot analysis of the fusion protein. S1 analysis. The RNA products of some strains were quantified by Si nuclease digestion using a synthetic probe that crosses the junction between vit-2 and vit-6 (Tables 1 and 2). Figure 5 shows the Si results for five strains. In Fig. 5A, a strain with a fourfold reduction in fusion mRNA level is compared with pJ247-containing reference strain BL203. In Fig. SB, three strains with no detectable fusion mRNA are compared with BL203. Dilution experiments with BL203 mRNA demonstrated that a 30-fold reduction of fusion mRNA still gave a detectable signal, indicating that these nonexpressing strains have at least a 30-fold reduction in expression (4). Many strains were not analyzed by Si analysis, because they could not be maintained as homozygous strains. Obligate heterozygous strains were grown as mixed populations containing various proportions of individuals with the transgene, which precluded their use for large-scale methods of analysis. Western analysis of expression levels. In order to quantify

1657

B

FIG. 5. S1 Protection Analysis of RNA from transgenic strains. RNA preparations from transgenic strains were hybridized to a 125-base oligonucleotide and digested with S1 nuclease. The protected fragments were separated electrophoretically on a 10% polyacrylamide-SDS gel. The sizes of the protected fragments, indicated by arrows, are 85 bp for vit-6 and 115 bp for vit-216.

1658

MACMORRIS ET AL.

MOL. CELL. BIOL. e,

A

E33 8 5 (pJ2471 hcteroszygote s I

I

I

i

I

>I

.\(] C

p 170AB a

fp155 -_

4W

vpl 15_.

40

B

81-31B386 (PJ2471. liontozvgotes) 1II

I

1

I10 Ad

1

fpI55

:~~M

..

BL388 (pJ2471 I

1

1

1

hiterozvgotes) 1

1

1

1 0101(1

Ad

yp170A,B* fp1 55_40 y PI 15_4m

FIG. 7. Western analysis of three pJ247L-containing strains. Blots were reacted with rat anti-ypll5, biotinylated anti-rat, and "NI-labelled streptavidin. In each case, the positions of fp155 and ypllS are indicated by arrows and ypl7OA and ypl70B by dots. In panel A, low-intensity bands in the N2 control lane are due to a dilution error. Ad, adult. N2, wild type.

grated copy of pJ247. Figure 6B presents an analysis of single heterozygotes from an obligate heterozygous pJ247containing strain. Figure 6C presents the results for BL315, a homozygous pJ142-containing strain, with five worms per lane because fp155 was not visible in single worms. The level of expression of fp155 in this strain was so low that even with five worms per lane, it was only marginally detectable. In Fig. 6D, three pJ49-containing strains (BL320, BL321, and BL322) are shown. For these nonexpressing strains, larger numbers of worms were examined in an effort to detect low-level expression, but even with 20 worms per lane, no fp155 could be seen. Similarly, when larval samples were analyzed, as shown for BL315 (Fig. 6C) and BL320 and BL321 (Fig. 6D), 60 individual L3-L4 larvae were loaded in a lane and no expression was detected. In the gel shown in Fig. 6D, 12 adult BL322 males were loaded and no fusion protein was detected. Figure 7 presents similar results from one homozygous and two heterozygous pJ247L-containing strains in which the VPE1 element at -113 is modified. Note that one of the three strains showed much less fp155 than did the other two. Quantitation of fp155. We were able to obtain quantitative results by cutting out bands made visible by the alkalinephosphatase conjugated streptavidin and counting the 1251 labelled streptavidin bound to the same bands. The results of averages of the levels of fp155 and ypllS of individuals and groups of individuals determined for each strain are summarized in Tables 1 and 2. We found that this method of quantitation gave reproducible results: the same strain grown and analyzed on separate occasions produced similar results (data not shown). In order to compare results for strains analyzed on different blots, the data were normalized in each case to adjust the

levels of fp155 and ypll5 for the control strain (BL203) on each blot to a standard level. All values on that blot were similarly adjusted. In order to facilitate comparisons between strains with different amounts of total protein, we determined the results for each as a ratio of the level of fp155 to the level of ypllS (Tables 1 and 2; Fig. 8). In separate experiments (not shown), we normalized the results to an unidentified cross-reacting band, which demonstrated that the levels of ypllS were not altered by the presence of the transgenes. Deletion mutations. We tested 11 strains containing four different deletion mutations for expression levels. The data (Table 1) demonstrate that the region containing the VPEs is required for vit-2 expression. Deletion of the distal 73 bp, from -247 to -174 had little, if any, effect on transgene expression. Four pJ174-containing strains, all heterozygous, displayed a wide range of fp155 expression levels from the wild-type level to a sevenfold reduction. The high level of expression of three of the pJ174-containing strains (BL301, BL303, and BL305) demonstrated that the VPE1 sequence contained in the deleted region is not required for maximal activity. In contrast, deletion of an additional 32 bp reduced activity to a barely detectable level in the two pJ142containing strains (BL310 and BL315). This deleted region contains the distal VPE2. Deletion of an additional 32 bp, to -110, eliminated all expression in BL440, the single strain containing the 110-bp promoter. As expected from this result, removal of an additional 61 bp to leave a 49-bp promoter also left no promoter activity in three pJ49-containing strains (BL320, BL321, and BL322). Point mutations. The vit-2 promoter contains five matches to the VPE1 consensus sequence. The VPE1 element closest to the TATA box is the most conserved in sequence and location in all of the vit genes (28). A 2-bp change created by site-directed mutagenesis of this element, pJ247B, eliminated promoter function. Three strains containing the pJ247B construct showed no detectable expression of fp155. In the two homozygous strains on which Si analysis was performed, no fusion mRNA was detected (Fig. 5), indicating a reduction of greater than 30-fold. Five of the seven nucleotides in the VPE1 element at -62 were changed in pJ247H. The single strain with this promoter modification showed high-level expression measured by Si analysis or Western blots (Table 2), suggesting that this VPE1 sequence is not required for high-level expression, in contrast to the VPE1 at -45. Quantitation of fp155 in three pJ247L-containing strains, in which the VPE1 at -113 has a one-bp change, reveals a surprising degree of variation (Fig. 7). The highest level of fp155, found in BL385, a heterozygous strain with an estimated 10 to 20 copies of the transgene, was nearly at the level of the endogenous vit-6 product, ypllS. A second strain, BL386, homozygous for two to three copies of pJ247L, had a level two- to threefold lower than BL385 yet still had a high level of fp155 expression. However, the third pJ247L strain, BL388 (five to six copies in heterozygotes), had barely detectable levels of fp155. The substantial level of fp155 expression in two of the strains, however, indicates that mutation of the -113 VPE1 sequence did not seriously impair promoter function; this VPE1 is apparently not necessary for high-level expression. The difference in expression between BL385 and BL386 roughly correlates with the copy number difference of the fusion gene, whereas the expression in BL388 does not (Table 2). Most likely, the low level of fp155 expression in BL388 is influenced by the chromosomal site at which the fusion gene is integrated.

VOL. 12, 1992

C. ELEGANS vit TRANSGENIC PROMOTER ANALYSIS

1659

TABLE 1. Transgenic strains with deletions Protein expressionb Construct

Strain

Copy no.'

Mean cpm + SE

RNA expressionc

ypll5

1,101 + 158

1,088 + 164

BL207(het)d BL208(het) BL209(het)

1 2-3 1 ND 2

(+) 693 ± 50 (+) 20 ± 6

673 + 87

1.03

116 ± 32

0.17

BL301(het) BL303(het)

2-3 2-6

524 ± 40 520 ± 69

979 ± 70 386 ± 29

0.53 1.35

BL304(het) BL305(het)

1 5-7

14 ± 3 623 ± 88

103 ± 13 1,343 ± 82

0.14 0.46

BL310(het) BL311(het) BL315

ND (intact) ND 1

83 + 55 (+) 26 + 6

1,407 ± 101

0.06

1,933 ± 70

0.01

pJllO

BL440

1

0

1,700

0

pJ49

BL320 BL321(het) BL322

1 ND (intact) 3

0 0 0

1,149 2,203 1,685

0 0 0

pJ247

pJ174

pJ142

BL203 BL202

cpm

fplS5/ypllS ratio

fp155

% of control

Mutant

BL203

300

480

100 62

0

800

0

0

800

0

1.01

Numbers of copies of the transgene per haploid genome were determined by comparisons of bands on genonlic Southern blots. ND, Southern analysis not done for this strain; ND (intact), Southern analysis confirms the presence of an intact transgene, but the copy number was not determined. b Protein levels determined by quantifying binding of "2I-labelled streptavidin to Western blots. Numbers given are normalized to the BL203 level. (+), Protein expression verified but level not measured. c RNA levels measured by S1 analysis expressed as normialized counts and as a percentage of BL203 level. d het, heterozygous. a

The most distal VPE1, at -186, is reversed in orientation relative to that of the other copies; it is eliminated by the 4-bp mutation in pJ247A. BL470, the single homozygous strain with pJ247A, showed an intermediate level of expression of fp155, confirming the conclusion based on the deletion mutation in pJ174 that this element is not absolutely required (Table 2). The VPE1 at -98 overlaps with a VPE2. Site-directed mutagenesis to create pJ247X changed 3 of the 6 bp shared by the two elements and thus left neither element intact. Four strains containing this mutation all had extremely low or undetectable expression, indicating that one or both of the overlapping elements is required for normal function. In addition to the VPE2 at -98, there is a VPE2 at -150. Two different point mutations in this sequence have been tested. The pJ247R construct contains the least severe mutation, a single-base change in the heptamer sequence as well as a change in one adjacent nucleotide. Two strains homozygous for pJ247R had relatively high levels of fp155 expression (Table 2). Fusion mRNA levels of one of these strains, BL341, was reduced by fourfold (Fig. 5). Three strains carrying a more severe 3-bp change in the -150 VPE2 in pJ247M exhibited drastic reductions in fp155 expression levels. Similarly, fusion gene mRNA was undetectable in the one strain in which it was measured, BL350 (Fig. 5). The one strain that had detectable but very low levels of fp155, also had ectopic expression in a distal region of the gonad, as revealed by in situ hybridization (not shown). This labelling pattern was not shared by the other strains carrying the pJ247M construct. We conclude from these results that the loss of the - 150 VPE2 severely reduced promoter function. We further conclude that the less severe mutation in pJ247R was not a sufficient modification to eliminate the function of the -150 element. There-

fore, in Fig. 8 we show only the results for the mutation in pJ247M above the -150 VPE2. Figure 8 summarizes the results presented above as well as the results for three strains containing the unmodified 247-bp promoter and a single strain with an 8-bp change at -88 between elements, pJ247B3G. The pJ247B3G-carrying strain, BL460, and two of the pJ247-carrying strains, BL203 and BL207, showed high-level fp155 expression (Tables 1 and 2). The third pJ247-containing strain, BL209, had lower levels of fp155, which is not accounted for by fewer copies of the transgene (Table 1) but may be due to its site of integration. DISCUSSION The in vivo analysis of the vit-2 promoter presented here demonstrates the functional importance of the conserved, repeated, heptameric sequences VPE1 and VPE2. Using integrated transgenic lines in which the expression of the vitellogenin fusion protein, fp155, was placed under the control of mutant promoter regions, we found that 247 bp of vit-2 5'-flanking DNA, which contains 5 VPE1 and 2 VPE2 sequences was sufficient upstream DNA for correctly regulated, high-level expression. Furthermore, point mutations and deletions of individual VPEs within this region did not change tissue-, sex-, or stage-specific expression; they altered only the level of expression. Our analysis demonstrated that all of the elements are not equal in importance. Removal of some VPEs eliminated or drastically reduced expression, while removal of others had relatively little effect. We measured expression levels for these strains in two ways and obtained similar results. The level of RNA expression in homozygous mutant strains measured by S1 nuclease digestion corresponded to the

1660

MAcMORRIS ET AL.

MOL. CELL. BIOL. TABLE 2. Transgenic strains with point mutations Protein expression'

Construct

Copy no.a

Strain

Mean cpm t SE

fplSS

ypllS

RNA expressionc

fpl55/ypll5 ratio

cpm Mutant

BL203

% of control

pJ247A

BL470

1

327 ± 138

809 + 207

0.40

pJ247R

BL341 BL342

1 >1

319 ± 98 477 ± 161

542 + 149 1,346 t 114

0.59 0.35

100

430

24

pJ247M

BL350 BL423(het) BL424

2 ND (intact) 1

23 0 0

1,289 987 2,700

0.02 0 0

0

800

0

pJ247L

BL385(het) BL386 BL388(het)

10-20 2-3 5-6

377 ± 49 281 ± 18 28 ± 5

430 + 68 890 ± 36 912 ± 87

0.88 0.32 0.03

pJ247X

BL390(het) BL391 BL395 BL394(het)

ND (intact) 1 4-6 ND (intact)

29

8,600 836 + 139 185

0 0.03 0

pJ247B3G

BL460

1-2

61 ± 27

40 + 13

1.52

pJ247H

BL425

1

79

35

124 + 36

0.64

147

151

97

pJ247B

BL360 BL361 BL364(het)

1 1 ND (intact)

0 0

800 800

0 0

0 +

10

0 0*

+

0 0 0

1,649 1,698 1,752

0 0 0

a Numbers of copies of the transgene per haploid genome were determined by comparisons of bands on genomic Southern blots. ND (intact), Southern analysis confirms presence of an intact transgene, but the copy number was not determined. " Protein levels determined by quantifying binding of 125I-labelled streptavidin to Western blots. Numbers given are normalized to the BL203 level. The asterisk indicates that no fp155 was detected, but levels of protein were not measured for this strain. c RNA levels measured by S1 analysis expressed as normalized counts and as a percentage of BL203 level (Table 1). d het, heterozygous.

results obtained by Western analysis of the same strains (Tables 1 and 2). While it might have been preferable to measure expression at the RNA level for all strains, this was not possible for the obligate heterozygous strains, nearly half of the collection. The normalized measurements of protein levels allowed us to analyze all strains. In a few cases, we observed significant variability in the level of expression of individual strains carrying the same promoter mutation. For three different constructs, pJ247, pJ174, and pJ247L, the results could not be explained by differences in the copy number of the transgenes. We concluded therefore that the reduced expression in a single strain carrying each of these constructs was due to position effects. Furthermore, the ectopic expression seen in a region of the gonad in a single strain containing pJ247M is likely due to position effect as well. Nevertheless, in most cases we analyzed adequate numbers of strains to allow us to draw conclusions about promoter function. For several promoter mutations, only a single strain was analyzed. In these cases, positive position effects could also contribute to the expression levels, leading to erroneous conclusions. Our results have however been confirmed with transgenic strains bearing nonintegrated high-copy-number extrachromosomal arrays (unpublished results). Results of point mutations and deletions were comparable, suggesting that the reductions in strains carrying deletion mutations were not simply due to the proximity of plasmid sequences. Deletions that removed the most distal VPE1 preserved high-level promoter activity, as did the site-

directed change in this same element. Removal of VPE2 at -150, either by deletion (pJ142) or by a site-directed change (pJ247M) drastically lowered expression. Further deletion to -110 eliminated expression of fp155, even though the only additional VPE1 lost in this deletion was found to be dispensable (pJ247L). Assuming that the lack of expression in the pJllO strain was not due to a position effect, the reduction from low expression in pJ142 to no expression in pJllO is an indication that there may be other sequences of importance in that interval. Alternatively, the loss of individual repeated elements, any one of which is not required in the presence of the others, may differ from a deletion such as pJllO in which multiple elements, two VPE1 sequences and one VPE2 sequence are deleted. We have demonstrated that several of the repeated VPEs perform critical roles in vit-2 promoter function: the VPE1 at -47, the VPE2 at -150, and the overlapping VPE1 and VPE2 at -98. All of these sites function as activating sequences, suggesting that they are binding sites for activator proteins. Among the VPE1 sequences, the copy that is most highly conserved in sequence and in position among the vitellogenin genes is also the most critical for promoter function. The presence of additional VPE1 sequences that are individually not required suggests they may act to modulate promoter function at a level that we are unable to detect. We are currently testing promoters with multiple point mutations in these apparently dispensable elements. None of the VPEs act like repressor-binding sites, since none show increases in expression when mutated. Also,

C. ELEGANS vit TRANSGENIC PROMOTER ANALYSIS

VOL. 12, 1992

1661

A U) V}

U) 0V

1

co ._

a

203 207 209

301 303 304 305

310 315

440

320 321 322

174

142

110

49

TATAA

B in

CL V)

-

470

247A

350 423 424 385 386 388 390391394395 460 425 360361 364

247M

247L

247X

247 247H 247B

TATAA FIG. 8. Protein expression levels in transgenic strains. Compiled results of quantified protein levels for all strains, expressed as the ratio of normalized mean fp155/mean ypllS. Each bar represents the ratio for a single strain. All strains containing a common construct are grouped together and aligned on a promoter diagram above the relevant portion of the promoter. The first two letters of the construct names have been omitted in the figure. (A) For strains with deletions, bars are positioned at the 5' ends of the deleted promoters. (B) For strains with point mutations, the bars are above the element or region changed in each case.

none of the mutations changed tissue, stage, or sex specific-

ity. The fact that loss of function mutations in the (male abnormal) mab-3 gene result in expression of the vit genes in males (26) suggests the existence of a male-specific repressor encoded by mab-3. This repressor could act on a sequence other than the VPEs, or it could act upstream in the vit gene regulatory pathway so that the sexual identity of mab-3 mutant intestines is misspecified. Our results suggest that the VPEs act as binding sites for activators that may only be functional in adult hermaphrodite intestinal cells. Combinatorial control of gene expression might be exerted by binding of an intestine-specific activator to VPE2 sequences, for example, and a sex-specific activator present only in adults to the VPE1 sequences. The mab-3 product might be required to repress the synthesis of the latter activator in males. Additional enhancer sequences outside the region we have tested may exist. Comparison of the level of expression in a strain with 3.9 kb of 5'-flanking DNA with the pJ247containing strains indicated a twofold reduction with the shorter promoter (4). This implies that additional sequences upstream of the 247-bp flanking region may modulate expression levels. Alternatively, the lowered expression could be due not to the removal of specific elements, but to "buffering" sequence that protects the region from effects of vector sequences or sequences adjacent to the site of integration. Correct regulation may also depend on the presence of

controlling elements within the gene or in the 3'-flanking regions. Since the reporter gene we used contains extensive vit-2 and vit-6 coding region along with vit-6 3'-flanking DNA, there may be sequences in these regions that play regulatory roles. However, sequence comparisons of introns and the 3' untranslated and flanking regions in all the vit genes have not revealed conserved elements. In any case, the experiments presented here demonstrate the importance of many of the VPEs identified by comparative sequence analysis for high-level expression of the Caenorhabditis vitellogenin genes. Whether the VPEs are directly involved in developmental regulation awaits further experiments. ACKNOWLEDGMENTS We thank our colleagues P. Cherbas, R. Conrad, and A. Fire for helpful discussions. This research was supported by grant GM30870 from the National Institute of General Medical Sciences. S.B. and S.G. were supported by training grants GM07227 and GM07757, respectively. M.M. was partially supported by a postdoctoral fellowship from the Indiana Corporation for Science and Technology. REFERENCES 1. Aamodt, E. J., M. A. Chung, and J. D. McGhee. 1991. Spatial control of gut-specific gene expression during Caenorhabditis elegans development. Science 252:579-582. 2. Blumenthal, T., M. Squire, S. Kirtland, J. Cane, M. Donegan, J.

1662

MAcMORRIS ET AL.

Spieth, and W. J. Sharrock. 1984. Cloning of a yolk protein gene family from Caenorhabditis elegans. J. Mol. Biol. 174:1-18. 3. Brenner, S. 1974. The genetics of Caenorhabditis elegans. Genetics 77:71-94. 4. Broverman, S. 1990. Analysis of a vitellogenin promoter in transgenic nematodes. Ph.D. dissertation. Indiana University, Bloomington. 5. Evans, R. M. 1988. The steroid and thyroid hormone receptor superfamily. Science 240:889-895. 6. Ferguson, E. L., and R. H. Horvitz. 1985. Identification and characterization of 22 genes that affect the vulval cell lineages of the nematode Caenorhabditis elegans. Genetics 110:17-72. 7. Fire, A. 1986. Integrative transformation of Caenorhabditis elegans. EMBO J. 5:2673-2680. 8. Fire, A., K. Kondo, and R. Waterston. 1990. Vectors for low copy transformation of C. elegans. Nucleic Acids Res. 18:42694270. 9. Fire, A., and R. H. Waterston. 1989. Proper expression of myosin in transgenic nematodes. EMBO J. 8:3419-3428. 10. Garabedian, M. J., M.-C. Hung, and P. C. Wensinlk 1985. Independent control elements that determine yolk protein gene expression in alternative Drosophila tissues. Proc. Natl. Acad. Sci. USA 82:1396-1400. 11. Garabedian, M. J., B. M. Shepherd, and P. C. Wensink. 1986. A tissue-specific transcription enhancer from the Drosophila yolk protein 1 gene. Cell 45:859-867. 12. Greene, J. M., and K. Struhl. 1987. Analysis of RNA structure and synthesis, p. 4.6.1-4.6.13. In F. M. Ausubel, R. Brent, R. E. Kingston, D. D. Moore, J. A. Smith, J. G. Seidman, and K. Struhl (ed.), Current protocols in molecular biology. John Wiley and Sons, New York. 13. Harlow, E., and D. Lane. 1988. Antibodies: a laboratory manual, p. 505. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y. 14. Kimble, J., and W. J. Sharrock. 1983. Tissue-specific synthesis of yolk proteins in Caenorhabditis elegans. Dev. Biol. 96:189196. 15. Klass, M., D. Ammons, and S. Ward. 1988. Conservation of the 5' flanking sequences of transcribed members of the Caenorhabditis elegans major sperm protein gene family. J. Mol. Biol. 199:15-22. 15a.Kuwabara, P., and J. Kimble. Personal communication. 16. Laemmli, U. 1970. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature (London) 227:680-685. 16a.MacMorris, M., and T. Blumenthal. Unpublished data. 17. Maniatis, T., E. F. Fritsch, and J. Sambrook. 1982. Molecular cloning: a laboratory manual, p. 395. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y. 18. Maniatis, T., E. F. Fritsch, and J. Sambrook. 1982. Molecular cloning: a laboratory manual, p. 122-126. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.

MOL. CELL. BIOL. 19. Mead, D. A., E. Szczesna-Skorupa, and B. Kemper. 1986. Single-stranded DNA 'blue' T7 promoter plasmids: a versatile tandem promoter system for cloning and protein engineering. Protein Eng. 1:67-74. 20. Nardelli, D., S. Gerber-Huber, F. D. van het Schip, M. Gruber, G. Ab, and W. Wahli. 1987. Vertebrate and nematode genes coding for yolk proteins are derived from a common ancestor. Biochemistry 26:6397-6402. 21. Okkema, P., and J. Kimble. 1991. Molecular analysis of tra-2, a sex determining gene in C. elegans. EMBO J. 10:171-176. 22. Orkin, S. 1990. Globin gene regulation and switching: circa 1990. Cell 63:665-672. 23. Schedin, P., C. P. Hunter, and W. B. Wood. 1991. Autonomy and nonautonomy of sex determination in triploid intersex mosaics of C. elegans. Development 112:833-879. 24. Sharrock, W. J. 1983. Yolk proteins of Caenorhabditis elegans. Dev. Biol. 96:182-188. 25. Sharrock, W. J. 1984. Cleavage of two yolk proteins from a precursor in Caenorhabditis elegans. J. Mol. Biol. 174:419-431. 26. Shen, M. M., and J. Hodgkin. 1988. mab-3, a gene required for sex-specific yolk protein expression and male-specific lineage in C. elegans. Cell 54:1019-1031.

27. Spieth, J., and T. Blumenthal. 1985. The Caenorhabditis elegans vitellogenin gene family includes a gene encoding a distantly related protein. Mol. Cell. Biol. 5:2495-2501. 28. Spieth, J., K. Denison, S. Kirtland, J. Cane, and T. Blumenthal. 1985. The C. elegans vitellogenin genes: short sequence repeats in the promoter regions and homology to the vertebrate genes. Nucleic Acids Res. 13:5283-5295. 29. Spieth, J., M. MacMorris, S. Broverman, S. Greenspoon, and T. Blumenthal. 1988. Regulated expression of a vitellogenin fusion gene in transgenic nematodes. Dev. Biol. 130:285-293. 30. Spieth, J., M. Nettleton, E. Zucker-Aprison, K. Lea, and T. Blumenthal. 1991. Vitellogenin motifs conserved in nematodes and vertebrates. J. Mol. Evol. 32:429-438. 31. Spieth, J., Y. H. Shim, K. Lea, R. Conrad, and T. Blumenthal. 1991. elt-1, an embryonically expressed Caenorhabditis elegans gene homologous to the GATA transcription factor family. Mol. Cell. Biol. 11:4651-4659. 31a.Stroeher, V. L., and J. D. McGhee. Personal communication. 32. Towbin, H., T. Staehelin, and J. Gordon. 1979. Electrophoretic transfer of proteins from polyacrylamide gels to nitrocellulose sheets: procedure and some applications. Proc. Natl. Acad. Sci. USA 76:4350-4354. 33. Wahli, W. 1988. Evolution and expression of vitellogenin genes. Trends Genet. 4:227-232. 34. Wood, W. B. 1988. The nematode Caenorhabditis elegans, p. 603-604. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y. 35. Zucker-Aprison, E., and T. Blumenthal. 1989. Potential regulatory elements of nematode vitellogenin genes revealed by interspecies sequence comparison. J. Mol. Evol. 28:487-496.