Comparative Biochemistry and Physiology, Part B 177–178 (2014) 21–28

Contents lists available at ScienceDirect

Comparative Biochemistry and Physiology, Part B journal homepage: www.elsevier.com/locate/cbpb

Regulation of insulin on lipid metabolism in freshly isolated hepatocytes from yellow catfish (Pelteobagrus fulvidraco) Mei-Qin Zhuo, Zhi Luo ⁎, Kun Wu, Qing-Ling Zhu, Jia-Lang Zheng, Li-Han Zhang, Qi-Liang Chen Key Laboratory of Freshwater Animal Breeding, Ministry of Agriculture of P.R.C., Fishery College, Huazhong Agricultural University, Wuhan 430070, China Freshwater Aquaculture Collaborative Innovative Centre of Hubei Province, Wuhan 430070, China

a r t i c l e

i n f o

Article history: Received 27 March 2014 Received in revised form 31 July 2014 Accepted 6 August 2014 Available online 17 August 2014 Keywords: Insulin Lipid metabolism Primary hepatocytes Pelteobagrus fulvidraco

a b s t r a c t Although the metabolic actions of insulin in fish have been investigated widely in the past years, the regulatory effect of insulin on lipid metabolism has received little attention, especially in primary hepatocytes of fish. In the present study, freshly hepatocytes were isolated from yellow catfish, cultured and subjected to different insulin levels (0, 10, 100 and 1000 nM) for 0 h, 24 h and 48 h. Triglyceride (TG) content, activity and expression of several key enzymes involved in lipid metabolism, as well as mRNA levels of key transcription factors related to lipid metabolism, were assessed at 0 h, 24 h and 48 h, respectively. Insulin incubation tended to increase the activities and expression of several lipogenic enzymes (such as FAS, G6PD, 6PGD). However, reduced CPT I gene expression was observed in hepatocytes following incubation treatment. Insulin administration also tended to up-regulate SREBP-1 expression but down-regulate PPARα mRNA levels. Insulin incubation enhanced lipogenesis and reduced lipolysis of freshly isolated hepatocytes of yellow catfish, in coincidence with increased TG content. Pearson correlations between expression of SREBP-1 and PPARα, and expression and activity of several enzymes were also observed, especially at 48-h insulin incubation. To the best of our knowledge, this is the first to study the effects of insulin on lipogenesis and lipolysis at both transcriptional and enzymatic levels using primary hepatocytes culture model in fish, which will help to understand the regulation of lipid metabolism by insulin in vivo, and will give us new insight into the insulin role in nutrient metabolism in fish. © 2014 Elsevier Inc. All rights reserved.

1. Introduction Insulin is a peptide hormone that plays a fundamental role in the regulation of somatic growth, cell differentiation during development and metabolism in all vertebrates (Caruso and Sheridan, 2011). At present, the effects of insulin on glucose homeostasis (hypoglycemia) have widely been studied (Mommsen and Plisetskaya, 1991; Navarro et al., 2006). However, information about insulin action on lipid metabolism in fish is scarce and contradictory. For example, in vivo, anti-lipolytic action of insulin is predominant in salmonids (Harmon and Sheridan, 1992). In contrast, some authors found that this pathway remained unaffected by insulin treatments (Plagnes-Juan et al., 2008). Studies also suggested that action of insulin on fish metabolism was tissue-specific, such as liver and muscle (important insulin target Abbreviations: CPT, carnitine palmitoyl transferase; DMSO, dimethyl sulphoxide; FAS, fatty acid synthase; FBS, fetal bovine serum; G6PD, glucose-6-phosphate dehydrogenase; MTT, 3-(4,5-dimethylthiazol-2-yl)-2, 5-diphenyltetrazoliumbromide; PBS, phosphate buffered saline; 6PGD, 6-phosphogluconate dehydrogenase; PPAR, peroxisome proliferator-activated receptor; SEM, standard error of mean; SREBP, sterol-regulator element-binding protein; TG, triglyceride. ⁎ Corresponding author at: Key Laboratory of Freshwater Animal Breeding, Ministry of Agriculture of P.R.C., Fishery College, Huazhong Agricultural University, Wuhan, 430070, China. Tel.: +86 27 8728 2113; fax: +86 27 8728 2114. E-mail addresses: [email protected], [email protected] (Z. Luo).

http://dx.doi.org/10.1016/j.cbpb.2014.08.004 1096-4959/© 2014 Elsevier Inc. All rights reserved.

tissues) (Polakof et al., 2010, 2011). On the other hand, studies suggested that in vivo insulin administration also changed other metabolic and hormonal signals, which potentially interacted with the regulation of insulin (Plagnes-Juan et al., 2008). Thus, compared with in vivo assay, in vitro assay can be used as an adjunct model to whole-animal experiments in vivo (Ellesat et al., 2011). Primary hepatocytes have been recognized as models for functional studies in fish. The in vitro effect of insulin on lipid metabolism in fish has been investigated (Cowley and Sheridan, 1993; Harmon et al., 1993; Plagnes-Juan et al., 2008). The underlying molecular mechanisms remained unknown. In general, lipid accumulation mainly results from the balance between de novo synthesis of fatty acids (lipogenesis) and fat catabolism via β-oxidation (lipolysis), and many key enzymes and transcriptional factors are involved in the process. Fatty acid synthase (FAS) catalyzes de novo fatty acid synthesis (Cowey and Walton, 1989). Glucose-6phosphate dehydrogenase (G6PD) and 6-phosphogluconate dehydrogenase (6PGD) are the key regulatory enzymes involved in NADPH production, essential for fatty acid biosynthesis (Carvalho and Fernandes, 2008). Carnitine palmitoyl transferase (CPT) I is considered to be the main regulatory enzyme in long-chain fatty acid oxidation because it catalyzes the conversion of fatty acid-CoAs into fatty acid–carnitines for entry into the mitochondrial matrix (Kerner and Hoppel, 2000). On the other hand, several transcription factors play an intermediary

22

M.-Q. Zhuo et al. / Comparative Biochemistry and Physiology, Part B 177–178 (2014) 21–28

role in lipid homeostasis, by orchestrating the gene transcription of the enzymes involved in these pathways (Spiegelman and Flier, 2001). Peroxisome proliferator-activated receptor (PPAR)α is a key modulator of lipid metabolism, notably through inducing the expression of a multitude of genes involved in fatty acid oxidation (Leone et al., 1999). Studies have suggested that PPARα can be highly expressed in liver (Zheng et al., 2013b). Furthermore, PPARα can be activated by subtype specific ligands, such as fibrate (Kersten and Wahli, 2000). Sterol-regulator element-binding protein-1 (SREBP-1) is a major regulator of fatty acid/lipid and cholesterol biosynthesis (Horton et al., 2002; Minghetti et al., 2011). SREBP-1 is a basic helix-loop-helix-leucine zipper transcription factor, and activates transcription by binding to nonpalindromic sterol response elements (SREs) in the promoter region of multiple target genes. Studies have suggested that SREBP-1 can be highly expressed in liver (Zheng et al., 2013b). In mammals, the regulation of these genes by insulin has been well established in primary culture hepatocytes (Azzout-marniche et al., 2000; Koo et al., 2001). However, no studies have been conducted to use fish hepatocytes to analyze the transcriptional effects of insulin on these genes in this model. In view of the differences in lipid metabolism and regulation between mammals and fish, it is absolutely important to illuminate the cellular mechanisms of insulin regulating gene transcriptional activity in fish. Yellow catfish Pelteobagrus fulvidraco, an omnivorous freshwater fish, is widely distributed in the inland freshwater waters in China. The fish is regarded as a good candidate for freshwater culture in China for its delicious meat and high market value. Yellow catfish also represent a valuable comparative model to study regulation of lipid metabolism in lower vertebrates since many key genes involved in lipid metabolism have been cloned (Zheng et al., 2013a, b) and the regulation of hepatic intermediary metabolism through nutrients has been extensively studied in this species (Luo et al., 2011; Tan et al., 2012; Zheng et al., 2014). In this study, we use freshly isolated and cultured yellow catfish hepatocytes, to analyze the effects of insulin on lipid deposition and metabolism. The effects of insulin are evaluated by determining TG level, and by investigating the activity of enzymes (FAS, CPT I, G6PD and 6PGD) and mRNA expression of genes (FAS, CPT I, G6PD, 6PGD SREBP-1 and PPARα). To our best knowledge, this is the first to study the effects of insulin on lipogenesis and lipolysis at both transcriptional and enzymatic levels using primary hepatocytes model in fish, which will help to understand the regulation of lipid metabolism by insulin in vivo, and will give us new insight into the physiological role of insulin in fish. 2. Materials and methods 2.1. Chemicals 3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyltetrazoliumbromide (MTT) was obtained from Amresco (USA). Medium 199 (M199), 0.25% sterile trypsin and fetal bovine serum (FBS) were obtained from Gibco/Invitrogen, UK. Penicillin, streptomycin, glutamine, trypan blue, bovine insulin and other reagents were purchased from Sigma-Aldrich, USA. 2.2. Culture of yellow catfish Before the experiment, uniform-sized yellow catfish (body mass 11.8 ± 2.5 g) were obtained from a local commercial farm, Wuhan, China. They were assigned to four indoor circular fiberglass tanks for 2 weeks for acclimation. During the acclimatization, they were provided with a commercial feed at 2% of body weight daily. The water quality parameters were: dissolved oxygen ≥ 6.3 mg/L, pH = 6.9 ~ 8.0, and total ammonia-nitrogen 0.02–0.044 mg/L, water temperature 25 ± 3 °C.

2.3. Hepatocyte isolation Before sampling, fish were starved for 24 h. Hepatocytes were isolated from eight yellow catfish according to the published protocols (Liebel et al., 2011) with slight modification. Firstly, yellow catfish were cleared of blood by cutting off the branchial arch, and disinfected with 75% alcohol. After all the blood had been cleared, the liver was carefully excised from the abdominal cavity, transferred onto a plastic Petri dish, and rinsed twice with phosphate buffered saline (PBS, pH 7.4, 4 °C) supplemented with amphotericin-B (25 μg/mL), streptomycin (100 μg/mL) and penicillin (100 IU/mL). Then the liver was aseptically minced into 1 mm3 pieces with scalpel and scissors, and the tissue was digested by 0.25% sterile trypsin at room temperature on a shaker for 30 min, neutralized with M199 medium containing 10% FBS every 5 min. The cell suspension was gathered. Then, the isolated hepatocytes were purified through nylon sieves of 200-μm mesh size. Hepatocytes were collected in 15-mL sterilized centrifuge tubes, centrifuged at low-speed (100 g, 5 min), and washed twice with PBS for debris removal. Finally, the purified hepatocytes were re-suspended in M199 medium containing 1 mmol/L-glutamine, 5% (v/v) FBS, penicillin (100 IU/mL) and streptomycin (100 μg/mL). Cells were counted using a hemocytometer based on the Trypan blue exclusion method, and only more than 95% cell viability were used for the subsequent experiments. When culturing, the hepatocyte cell suspension (CS) was plated onto 25 cm2 flasks at the density of 1 × 106 cells per mL. We assured that experiments performed on cell culture followed the ethical guidelines of Huazhong Agricultural University for the care and use of animal cells. 2.4. Insulin treatment For the insulin treatment experiment, four different bovine insulin concentrations (0, 10, 100 and 1000 nM, respectively) were used to incubate the freshly isolated hepatocytes (insulin 0 means that no extra insulin was added, and was used as the control) for 48 h. They were incubated at 28 °C in humidified air containing 5% CO2 based on our recent study (Zhu et al., 2014). Sampling occurred at 0 h, 24 h and 48 h, respectively. 0 h meant the time when the hepatocyte cell suspension (CS) was plated onto 25 cm2 flasks at the density of 1 × 106 cells per mL and four different insulin concentrations (0, 10, 100 and 1000 nM, respectively) were added. Each insulin treatment was performed in triplicate. We conducted the experiment of different insulin incubation four times under similar condition to test and confirm our results. 2.5. Cell livability assay The MTT assay was used to test the cell viability following the method described in our recent study (Zhu et al., 2014). Briefly, at 24 h and 48 h, respectively, 20 μL of MTT working solution was added to each well. The plates with added MTT solution were wrapped in aluminum foil and placed in the 5% CO2 incubator for another 4 h. Then, the supernatant culture medium was carefully aspirated and 150 μL dimethyl sulphoxide (DMSO, Sigma) was added to each well to dissolve the formazan precipitates. The amount of formazan was determined by measuring absorbance at 570 nm using a Tecan microplate reader. The wells containing the medium without any cells were used as the positive control. Results were present as OD value of each treatment group subtracting the positive group OD value. 2.6. TG accumulation and enzyme activity determination For the assay of enzyme activities and intracellular TG content, at each sampling time, the cells were collected from flasks with 0.25% (w/v) trypsin and washed with PBS. Then, cells were homogenized by sonication in different extraction buffers stated below. Only those cultures with a high viability (cell viability N95%) were used for the analysis of enzymatic activities.

M.-Q. Zhuo et al. / Comparative Biochemistry and Physiology, Part B 177–178 (2014) 21–28

For the intracellular triglyceride (TG) accumulation assay, the cells were homogenized in PBS. TG was determined by glycerol-3-phosphate oxidase p-aminophenol (GPO-PAP) methods, using a commercial kit from Nanjing Jian Cheng Bio-engineering Institute, Nanjing, China. The cellular TG content was expressed as μM TG per mg cellular protein. Selected enzymatic activities were assayed on cell homogenates using spectrophotometric procedures. For determination of the activities of G6PD, 6PGD and FAS, extraction buffers contained 0.02 M Tris– HCl, 0.25 M sucrose, 2 mM EDTA, 0.1 M sodium fluoride, 0.5 mM phenyl methyl sulphonyl fluoride, and 0.01 M ß-mercaptoethanol (pH7.4). FAS, G6PD and 6PGD activity was measured according to Chakrabarty and Leveille (1969), Barroso et al. (1999) and Hisar et al. (2009) methods, respectively. For the determination of CPT I activities, cells were homogenized in an extraction buffer containing 250 mM sucrose, 1 mM EDTA, 20 mM HEPES, and 0.5% bovine serum albumin (BSA) (pH7.4). The reaction mixture contained 0.1 mM 5,5′-dithiobis (2-nitrobenzoic acid) (DTNB), 5 mM L-carnitine and 0.1 mM palmitoyl-CoA. CPT I activity was measured in the forward direction (formation of palmitoylcarnitine) by monitoring the initial rate of CoA-SH release with DTNB at 412 nm according to the protocol from Morash et al. (2008). Enzyme activity units (U), defined as 1 μmol of substrate converted to product at the assay temperature (28 °C) per minute, are expressed per milligrams of cellular soluble protein. The cellular protein content was determined using Bradford (1976) method with bovine serum albumin as standard. 2.7. Total RNA preparation and RT-qPCR analysis The mRNA levels of several genes related lipid metabolism were determined by real-time fluorescence quantitative RT-PCR (RT-qPCR) method described in Chen et al. (2013) and Zhu et al. (2014). Hepatocytes from 25 cm2 flasks were collected for the total RNAs extracted using TRIzol regent (TaKaRa, Japan). Reverse transcriptions were performed with equal quantities of each total RNA (1 μg) as template using Quantitect Reverse Transcription Kit (Takara, Japan) for realtime PCR following the manufacturer’s protocol. The resulting firststrand cDNA was diluted to 1:10 with ddH2O and used as template for SYBR real-time PCRs. RT-qPCR was performed using the SYBR PremixEx TaqTMII kit (Takara, Japan) on a Chromo 4 Real-Time Detection System (MJ Research, Hercules, CA, USA). The gene-specific primer sequences for each gene were obtained according to Zheng et al. (2013b) and listed in Table 1. Primers were synthesized by Sangon (Shanghai, China). Real-time PCRs were performed in a 20 μL reaction mixture including 10 μL SYBR Premix ExTaqTMII, 0.4 μL each primer (25 μM), 1 μL diluted first-strand cDNA product and 8.2 μL ddH2O. Reactions were based on a two-step method as follows: initial denaturation for 30 s at 95 °C, followed by 40 cycles of 5 s at 95 °C, 10 s at 57 °C and 30 s at 72 °C. The baseline was automatically set to maintain consistency. Because β-actin level was stable in the present experiment, it was used as the internal control gene for the quantitative RT-PCR assay. The mRNA expression of each gene was calculated with the “delta–delta Ct” method (Pfaffl, 2001) normalized with β-actin level. To confirm amplification specificity, the PCR products from each

23

sample were examined by melting curve analysis and subsequent agarose gel electrophoresis (Zheng et al., 2013a). 2.8. Statistical analysis Statistical analysis was performed with SPSS 19.0 software. Results were presented as mean ± standard error of mean (SEM) of four independent biological experiments. Prior to statistical analysis, all data were tested for normality of distribution using the Kolmogornov– Smirnov test. The homogeneity of variances among the different treatments was tested using Barlett's test. Then the data were subjected to one-way ANOVA followed by Turkey's test. Differences were considered significant at P b 0.05. Pearson correlation coefficients were calculated to examine the relationships between expression of transcriptional factors (SREBP-1 and PPARα), and expression and activity of several enzymes at 24 h and 48 h, respectively. 3. Results 3.1. Effect of insulin on cell viability and TG accumulation Insulin treatments showed no significant effect on cell viability during the experiment. At 24 h and 48 h, TG content was the highest in the 100 nM insulin group. For the same insulin concentration, TG content tended to increase with the incubation time from 0 h to 48 h (Fig. 1) 3.2. Effect of insulin on enzyme activities FAS activity increased with insulin incubations (Fig. 2). At 24 h, FAS activity was the lowest for the control and showed no significant difference among three insulin-added groups. At 48 h, FAS activity was the lowest for the control and highest for 100 nM insulin group. G6PD activity at 24 h was the highest for 100 nM insulin group and showed no significant difference among other three groups. At 48 h, G6PD activity was the highest for 100 nM insulin group and the lowest for the control. For three insulin-added groups, G6PD activities at 48 h were significantly higher than those at 0 h and 24 h. However, for the control, G6PD activity showed no significant differences at 0 h, 24 h and 48 h. At 24 h, 6PGD activity showed no significant differences among the four treatments. At 48 h, 6PGD activities for 100 nM and 1000 nM insulin groups were significantly higher than those from the control. For the 100 nM and 1000 nM insulin groups, 6PGD activities were significantly higher at 48 h than those at 0 h and 24 h. However, for the control and 10 nM insulin group, 6PGD activity showed no significant differences among 0 h, 24 h and 48 h. During the experiment, CPT I activity remained relatively constant, and its change was not significantly related to insulin concentration and time. 3.3. Effect of insulin on gene expression The effects of insulin incubation on mRNA levels of several enzymes and transcription factors involved in lipid metabolism were shown in Fig. 3. At 24 h, FAS mRNA levels were the highest for 100 nM insulin

Table 1 Primers used for Q-PCR analysis in the present study. Gene

GenBank accession No.

Forward primer (5′-3′)

Reverse primer (5′-3′)

Size (bp)

β-actin FAS G6PD 6PGD CPT IA SREBP-1 PPARα

EU161066 JN579124 JX992744 JX992745 JQ074177 JX992742 JX992740

GCACAGTAAAGGCGTTGTGA AACTAAAGGCTGCTGGTTGCTA CAGGAATGAACGCTGGGATG GCTCTGATGTGGCGAGGTGG ATTTGAAGAAGCACCCAGAGTATGT CTGGGTCATCGCTTCTTTGTG CGAGGATGGGATGCTGGTG

ACATCTGCTGGAAGGTGGAC CACCTTCCCGTCACAAACCTC TCTGCTACGGTAGGTCAGGTCC CGTAGAAGGACAGTGCAGTGGTAAA CCCTTTTATGGACGGAGACAGA TCCTTCGTTGGAGCTTTTGTCT CGTCTGGGTGGTTCGTCTGC

136 141 249 216 254 188 323

24

M.-Q. Zhuo et al. / Comparative Biochemistry and Physiology, Part B 177–178 (2014) 21–28

Fig. 1. Effects of bovine insulin incubation (0, 10, 100 and 1000 nM) on cell livability and TG contents in primary hepatocytes from yellow catfish. Values are mean ± SEM (N = 4 independent biological experiments). Different lower-case letters indicate significant differences among the treatments at the same exposure time. Different capital letters indicate significant differences between different exposure times for the same insulin concentration (p b 0.05). The absence of different letters indicates no significant differences.

group and showed no significant differences among other three groups. At 48 h, the highest and lowest FAS mRNA levels were observed for 100 nM insulin group and the control, respectively. On the other hand, for three insulin-added groups, FAS mRNA levels significantly increased with the incubation time from 0 h to 48 h. The mRNA levels of G6PD and 6PGD showed no significant differences among four treatments at 24 h. At 48 h, G6PD and 6PGD mRNA levels were the highest for 100 nM insulin group and showed no significant differences among other three groups. For the same insulin concentration, mRNA levels of G6PD and 6PGD significantly increased with the incubation time. At 24 h and 48 h, CPT I mRNA levels were the highest for the control and showed no significant differences among three insulin-added groups. For the same insulin concentration groups, CPT I mRNA levels were higher at 0 h than those at 24 h and 48 h. At 24 h and 48 h, SREBP-1 mRNA levels were the lowest for the control and showed no significant differences for three insulin-added

groups. On the other hand, for the control, SREBP-1 mRNA levels showed no significant differences at 0 h, 24 h and 48 h. However, for the three insulin-added groups, SREBP-1 mRNA levels tended to increase with the incubation time. At 24 h, PPARα mRNA levels showed no significant differences among four treatments. At 48 h, PPARα mRNA levels were the highest for the control and showed no significant differences for three insulinadded groups. On the other hand, PPARα mRNA levels for the control were higher at 48 h than those at 0 h and 24 h. However, for three insulin-added groups, PPARα mRNA levels showed no significant differences among three sampling time. 3.4. Correlation analysis Pearson correlations between the mRNA of transcription factors, and the activities and their corresponding genes' mRNA expressions are showed in Table 2. At 24 h, the positive relationship was only observed

Fig. 2. Effects of bovine insulin incubation (0, 10, 100 and 1000 nM) on FAS, G6PD, 6PGD and CPT I activities in primary hepatocytes from yellow catfish. Values are mean ± SEM (N = 4 independent biological experiments). Different lower-case letters indicate significant differences among the treatments at the same exposure time. Different capital letters indicate significant differences between different exposure times for the same insulin concentration (p b 0.05). The absence of different letters indicates no significant differences.

M.-Q. Zhuo et al. / Comparative Biochemistry and Physiology, Part B 177–178 (2014) 21–28

25

Fig. 3. Effects of bovine insulin incubation (0, 10, 100 and 1000 nM) on mRNA expressions of related genes involved in lipid metabolism in primary hepatocytes from yellow catfish. Values are mean ± SEM (N = 4 independent biological experiments), expressed as logarithm of expression of each gene relative to expression of the housekeeping gene β-actin. Different lower-case letters indicate significant differences among the treatments at the same exposure time. Different capital letters indicate significant differences between different exposure times for the same insulin concentration (p b 0.05). The absence of different letters indicates no significant differences.

between SREBP-1 mRNA level and the activities of FAS and G6PD. No correlation was observed between PPARα mRNA level and other tested parameters (such as enzymatic activities and gene expression). However, at 48 h, the mRNA level of SREBP-1 was positively related to both the activities of and the mRNA levels of FAS, G6PD and 6PGD. SREBP-1 mRNA level was also positively related to CPT I activity but negatively related to CPT IA mRNA level. PPARα mRNA level was negatively related to the activities of FAS, G6PD and 6PGD, and the mRNA level of FAS and

6PGD. PPARα mRNA level was negatively related to the CPT I activities but positively related to CPT IA mRNA level. 4. Discussion In fish, the involvement of insulin in glucose metabolism has long been recognized. However, studies involved in the mechanism of insulin influencing lipid metabolism in isolated cell models were scarce.

Table 2 Pearson correlations between the mRNA of transcription factors, and related enzymes activities and mRNA expression levels in primary hepatocytes of yellow catfish at 24 and 48 h. Enzymatic activities FAS 24 h SREBP-1 PPARα

48 h SREBP-1 PPARα

mRNA levels

G6PD

6PGD

CPT I

G6PD

6PGD

FAS

CPT IA

R P R P

0.670 0.005 −0.454 0.077

0.619 0.011 0.456 0.077

0.339 0.198 0.343 0.194

−0.083 0.760 −0.404 0.120

0.569 0.054 −0.152 0.637

0.204 0.525 0.184 0.566

0.352 0.261 0.036 0.912

−0.556 0.061 0.223 0.486

R P R P

0.889 0.000 −0.584 0.018

0.652 0.006 −0.646 0.007

0.664 0.005 −0.635 0.008

0.544 0.029 −0.559 0.024

0.731 0.007 −0.505 0.094

0.759 0.004 −0.676 0.016

0.782 0.003 −0.682 0.013

−0.584 0.046 0.822 0.001

Positive R and P b 0.05 mean the positive correlation between the two variables; negative R and P b 0.05 mean the negative correlation between the two variables, and P N 0.05 means that there is no significant relationship between the two variables. Font with gray background means significant correlation.

26

M.-Q. Zhuo et al. / Comparative Biochemistry and Physiology, Part B 177–178 (2014) 21–28

Herein, for the first time, we examined the role of insulin in lipogenesis and lipolysis at both enzymatic and molecular levels using fish hepatocytes as a model. The effect of insulin incubation on expression of two transcriptional factors was also investigated. The present study will help to understand the regulatory role of insulin in lipid metabolism in fish. In the present study, 5% FBS was used for culture of purified hepatocytes from yellow catfish since lower FBS concentration (and/or further serum starvation) proved unsuccessful after our pilot experiments. Our study indicated that with 5% FBS in the medium, hepatocyte cell viability showed no significant decline during the 48-h incubation. In contrast, the cells were serum starved by changing the growth medium to a medium consisting on DMEM with only 0.02% FBS for 5 h, and then the medium was changed again to a DMEM containing 2% FBS and the corresponding dose of hormones to explore the effect of hormones in vitro (Rius-Francino et al, 2011). In the present study, the 48-h incubation time was chosen in the present study. In other studies, 72-h was used in Han et al. (2009), and 48 h was used in Pierce et al. (2011) to explore the effect of insulin on hepatocytes in vitro. Studies have also been conducted to determine the effects of insulin and other metabolic hormones on gene expression after 24 h in fish hepatocytes (Lansard et al., 2010; Leung and Woo, 2010), after 18 h (Pierce et al., 2010), and in fish myocytes after 6 h or 18 h (Cruz-Garcia et al., 2011; Jiménez-Amilburu et al., 2013). Thus, it seems that the effect of metabolic hormones on gene expression can be activated both the short and long incubation time. Our study indicated that insulin addition induced lipid accumulation. The anti-lipolytic effects of insulin have been demonstrated in rainbow trout in vivo and in isolated hepatocytes in vitro (Harmon and Sheridan, 1992; Harmon et al., 1993), but the underlying mechanism kept unknown. In the present study, especially at 48 h, insulin addition significantly increased activities of G6PD, 6PGD and FAS. G6PD, 6PGD and FAS are the key enzymes for fatty acid synthesis (Cowey and Walton, 1989). The increased activities and mRNA levels of lipogenic enzymes correlated well with the reported increase in TG content of hepatocytes of yellow catfish. The highest TG accumulation was observed at 100 nM insulin group, in coincidence with the highest activities of the lipogenic enzymes at the group. Similarly, insulin enhanced lipogenesis in liver of spotted catfish (Machado et al., 1988), lamprey (Kao et al., 1999) and rainbow trout (Ablett et al., 1981; Cowley and Sheridan, 1993). In the present study, the up-regulation of mRNA levels of hepatic lipogenic enzymes following insulin injection supports the lipogenic role of this hormone. Moreover, our study indicated that the increase in G6PD, 6PGD and FAS activities was attributable to the increase in the mRNA expression of these genes encoding them, indicating that these enzymes were regulated by insulin mainly at the transcriptional level. Increased FAS mRNA levels owing to insulin treatment agreed with previous in vitro studies, in which bovine insulin was shown to stimulate both FAS activity and gene expression in the hepatocytes of trout (Cowley and Sheridan, 1993; Plagnes-Juan et al., 2008). Polakof et al. (2010) found increased mRNA levels of FAS and G6PD in rainbow trout receiving an intraperitoneal injection of insulin. Mennigen et al. (2014) reported the increase in FAS expression following insulin administration in vivo and in vitro in trout. Thus, the increase in TG accumulation of hepatocytes after insulin incubation might be related to the increase in the activity and mRNA expression of genes encoding lipogenic enzymes. However, compared with 100 nM insulin, 1000 nM insulin tended to reduce TG content and down-regulate expression and activity of these enzymes. This may be the result of the high concentration of insulin exceeding the tolerance of hepatocytes, leading to a decrease in insulin sensitivity and an increase in insulin resistance, as suggested by Han et al. (2009). CPT I is considered to be the main regulatory enzyme in mitochondrial fatty acid oxidation (Kerner and Hoppel, 2000). In the present study, insulin down-regulated CPT IA expression (the key lipolytic enzyme's gene) after 48 h, again in agreement with the anti-lipolytic

effects of insulin in fish (Harmon and Sheridan, 1992). Similarly, Plagnes-Juan et al. (2008) reported that in vivo administration of insulin to rainbow trout inhibited gene expression of CPT I. SánchezGurmaches et al. (2010) reported that insulin decreased CPT IB expression and CO2 production from oleic acid in cultured trout myocytes. However, Polakof et al. (2010) found that the mRNA levels of CPT IA were enhanced (~3.5 fold) in fish receiving an intraperitoneal injection of insulin. However, our study suggested the reduction of CPT I mRNA levels in contrast with the relatively constant CPT I activities, which implied that anti-lipolytic regulation by insulin in yellow catfish hepatocytes was complex. Several studies pointed out that the posttranscriptional regulation of CPT I was a decisive factor of CPT I activity, possibly through affecting affinity for substrates and phosphorylation (Harano et al., 1985; Park et al., 1995). In the present study, PPARα mRNA levels tended to be higher for the control than those for three insulin-added groups. PPARα is a ligandactivated transcription factor that binds to corresponding response elements to activate genes in the fatty acid oxidation (Morash et al., 2008). Some well-known PPARα agonists, such as fenofibrate, have been used to lower triglyceride accumulation in mammals (Desvergne and Wahli, 1999). Here, the down-regulation of PPARα by insulin treatments indicated a decline in lipid consumption, which contributed to lipid accumulation. The present study indicated that the relationship between PPARα and CPT 1 expression was time-dependent. No relationship at 24 h but a positive relationship at 48 h was observed between PPARα and CPT 1 expression. Similarly, Zheng et al. (2013c) pointed out that mRNA expression of the gene encoding PPARα was positively related to mRNA expression of the CPT I gene. Studies in mammals also suggested that feeding high fat diets would increase CPT I expression compared to low fat diets (Thumelin et al., 1994; Tabarin et al., 2005) presumably through activation of PPARα. Furthermore, PPARα stimulates through a PPRE in the first and second intron of the human and rat CPT IA gene, respectively (Napal et al., 2005; Song et al., 2010). Except the regulation at the transcriptional level, enzymatically catalyzed post-translational modifications of enzymes are also important for their activity, including the modification of the side chains of various amino acid residues (or the free N-terminal amino group or the free C-terminal carboxyl) without any chemical changes of the polypeptide backbone (Ryslava et al., 2013). The present study also indicated that PPARα mRNA level was negatively related to the activities of FAS, G6PD and 6PGD, and the mRNA level of FAS and 6PGD at 48 h. Studies suggested that PPARα mediated many important metabolic pathway, such as PPARα/AMPK/FoxO1/ATGL pathway (Chen et al., 2012). Accordingly, the pathway mechanism involved in the relationship between PPARα and lipogenic enzymes remained further investigation. In the present study, SREBP-1 mRNA levels were the lowest for the control and showed no significant differences for three insulin-added groups. SREBP-1 is a membrane-bound transcriptional factor that regulates the gene expression of enzymes in fatty acid biosynthesis (Minghetti et al., 2011). The up-regulation of SREBP-1 gene expression after insulin treatment would increase the accumulation of lipids, as suggested by Horton and Shimomura (1999). Similarly, Polakof et al. (2010) also observed that SREBP-1 expression was up-regulated in insulin-injected fish. Furthermore, in the present study, the mRNA level of SREBP-1 was positively related to both the activities and the mRNA levels of lipogenic genes FAS, G6PD and 6PGD. Recent studies in our laboratory also indicated that activities and mRNA levels of some lipogenic enzymes (such as G6PD, 6PGD, FAS) were positively correlated with mRNA expression of SREBP-1 in liver of yellow catfish (Chen et al., 2013; Zheng et al., 2013c). Other studies indicated that lipogenic genes in the liver could be induced by SREBP-1 (Amemiya-Kudo et al., 2002; Rho et al., 2005). Thus, SREBP may constitute a link between insulin and enzyme gene expression, and insulin addition might increase SREBP-1 expression and, consequently, increased mRNA levels of lipogenic enzymes in hepatocytes of yellow catfish.

M.-Q. Zhuo et al. / Comparative Biochemistry and Physiology, Part B 177–178 (2014) 21–28

In conclusion, this study indicates that insulin promotes lipid storage in freshly isolated hepatocytes of yellow catfish, possibly through up-regulating lipogenesis and down-regulating lipolysis. To our best knowledge, this is the first to study the effects of insulin on lipogenesis and lipolysis at both transcriptional and enzymatic levels using primary hepatocytes model in fish, which will help to understand the regulation of lipid metabolism by insulin in vivo, and will give us new insight into the insulin role in nutrient metabolism in fish. Acknowledgment This work was funded by the National Natural Science Foundation of China (grant no. 31422056) and Fundamental Research Funds for the Central Universities, China (Grant no. 2013PY073).

References Ablett, R.F., Sinnhuber, R.O., Holmes, R.M., Selivonchick, D.P., 1981. The effect of prolonged administration of bovine insulin in rainbow trout (Salmo gairdneri). Gen. Comp. Endocrinol. 43, 211–217. Amemiya-Kudo, M., Shimano, H., Hasty, A.H., Yahagi, N., Yoshikawa, T., Matsuzaka, T., Okazaki, H., Tamura, Y., Iizuka, Y., Ohashi, K., Osuga, J., Harada, K., Gotoda, T., Sato, R., Kimura, S., Ishibashi, S., Yamada, N., 2002. Transcriptional activities of nuclear SREBP-1a, -1c, and -2 to different target promoters of lipogenic and cholesterogenic genes. J. Lipid Res. 43, 1220–1235. Azzout-Marniche, D., Becard, D., Guichard, C., Foretz, M., Ferre, P., Foufelle, F., 2000. Insulin effects on sterol regulatory-element-binding protein-1c (SREBP-1c) transcriptional activity in rat hepatocytes. Biochem. J. 350, 389–393. Barroso, J.B., Peragon, J., Garcca-Salguero, L., Dela-Higuera, M., Lupianez, J.A., 1999. Variations in the kinetic behaviour of the NADPH-production systems in different tissues of the trout when fed on an amino-acid-based diet at different frequencies. Int. J. Biochem. Cell Biol. 31, 277–290. Bradford, M.M., 1976. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 72, 248–254. Caruso, M.A., Sheridan, M.A., 2011. New insights into the signaling system and function of insulin in fish. Gen. Comp. Endocrinol. 173, 227–247. Carvalho, C.d.S., Fernandes, M.N., 2008. Effect of copper on liver key enzymes of anaerobic glucose metabolism from freshwater tropical fish (Prochilodus lineatus). Comp. Biochem. Physiol. A 151, 437–442. Chakrabarty, K., Leveille, G.A., 1969. Acetyl CoA carboxylase and fatty acid synthetase activities in liver and adipose tissue of meal-fed rats. Exp. Biol. Med. 131, 1051–1054. Chen, W.L., Chen, Y.L., Chiang, Y.M., Wang, S.G., Lee, H.M., 2012. Fenofibrate lowers lipid accumulation in myotubes by modulating the PPARα/AMPK/FoxO1/ATGL pathway. Biochem. Pharmacol. 84, 522–531. Chen, Q.L., Luo, Z., Pan, Y.X., Zheng, J.L., Zhu, Q.L., Sun, L.D., Zhuo, M.Q., Hu, W., 2013. Differential induction of enzymes and genes involved in lipid metabolism in liver and visceral adipose tissue of juvenile yellow catfish (Pelteobagrus fulvidraco) exposed to copper. Aquat. Toxicol. 136, 72–78. Cowey, C.B., Walton, M.J., 1989. Intermediary metabolism. Fish Nutr. 2, 259–329. Cowley, D.J., Sheridan, M.A., 1993. Insulin stimulates hepatic lipogenesis in rainbow trout (Oncorhynchus mykiss). Fish Physiol. Biochem. 11, 421–428. Cruz-Garcia, L., Sánchez-Gurmaches, J., Gutiérrez, J., Navarro, I., 2011. Regulation of LXR by fatty acids, insulin, growth hormone and tumor necrosis factor-α in rainbow trout myocytes. Comp. Biochem. Physiol. A 160, 125–136. Desvergne, B., Wahli, W., 1999. Peroxisome proliferator-activated receptors: nuclear control of metabolism. Endocr. Rev. 20, 649–688. Ellesat, K.S., Yazdani, M., Holth, T.F., Hylland, K., 2011. Species-dependent sensitivity to contaminants: an approach using primary hepatocyte cultures with three marine fish species. Mar. Environ. Res. 72, 216–224. Han, C., Wang, J., Li, L., Zhang, Z., Wang, L., Pan, Z., 2009. The role of insulin and glucose in goose primary hepatocyte triglyceride accumulation. J. Exp. Biol. 212, 1553–1558. Harano, Y., Kashiwagi, A., Kojima, H., Suzuki, M., Hashimoto, T., Shigeta, Y., 1985. Phosphorylation of carnitine palmitoyltransferase and activation by glucagon in isolated rat hepatocytes. FEBS Lett. 188, 267–272. Harmon, J.S., Sheridan, M.A., 1992. Effects of nutritional state, insulin, and glucagon on lipid mobilization in rainbow trout, (Oncorhynchus mykiss). Gen. Comp. Endocrinol. 87, 214–221. Harmon, J.S., Rieniets, L.M., Sheridan, M.A., 1993. Glucagon and insulin regulate lipolysis in trout liver by altering phosphorylation of triacylglycerol lipase. Am. J. Physiol. 256, 255–260. Hisar, O., Sonmez, A.Y., Beydemir, S., Hisar, S.A., Yanik, T., Cronin, T., 2009. Kinetic behaviour of glucose 6-phosphate dehydrogenase and 6-phosphogluconate dehydrogenase in different tissues of rainbow trout (Oncorhynchus mykiss) exposed to non-lethal concentrations of cadmium. Acta Vet. Brno 78, 179–185. Horton, J.D., Shimomura, I., 1999. Sterol regulatory element binding proteins: activators of cholesterol and fatty acid biosynthesis. Curr. Opin. Lipidol. 10, 143–150. Horton, J.D., Goldstein, J.L., Brown, M.S., 2002. SREBPs: activators of the complete program of cholesterol and fatty acid synthesis in the liver. J. Clin. Invest. 109, 1125–1131.

27

Jiménez-Amilburu, V., Salmerón, C., Codina, M., Navarro, I., Capilla, E., Gutiérrez, J., 2013. Insulin-like growth factors effects on the expression of myogenic regulatory factors in gilthead sea bream muscle cells. Gen. Comp. Endocrinol. 188, 151–158. Kao, Y., Youson, J.H., Holmes, J.A., Al-Mahrouki, A., Sheridan, M.A., 1999. Effects of insulin on lipid metabolism of larvae and metamorphosing landlocked sea lamprey (Petromyzon marinus). Gen. Comp. Endocrinol. 114, 405–414. Kerner, J., Hoppel, C., 2000. Fatty acid import into mitochondria. Biochim. Biophys. Acta Mol. Cell Biol. Lipids 1486, 1–17. Kersten, S., Wahli, W., 2000. Peroxisome proliferator activated receptor agonists. In: Jolles, P. (Ed.), New Approaches to Drug Development. Birkhauser Verlag, Switzerland, pp. 89,141–89,151. Koo, S.H., Dutcher, A.K., Towle, H.C., 2001. Glucose and insulin function through two distinct transcription factors to stimulate expression of lipogenic enzyme genes in liver. J. Biol. Chem. 276, 9437–9445. Lansard, M., Panserat, S., Plagnes-Juan, E., Seiliez, I., Skiba-Cassy, S., 2010. Integration of insulin and amino acid signals that regulate hepatic metabolism-related gene expression in rainbow trout: role of TOR. Amino Acids 39, 801–810. Leone, T.C., Weinheimer, C.J., Kelly, D.P., 1999. A critical role for the peroxisome proliferator-activated receptor α (PPARα) in the cellular fasting response: the PPARα-null mouse as a model of fatty acid oxidation disorders. Proc. Natl. Acad. Sci. 96, 7473–7478. Leung, L.Y., Woo, N.Y.S., 2010. Effects of growth hormone, insulin-like growth factor I, triiodothyronine, thyroxine, and cortisol on gene expression of carbohydrate metabolic enzymes in sea bream hepatocytes. Comp. Biochem. Physiol. 157A, 272–282. Liebel, S., Oliveira Ribeiro, C.A., Silva, R.C., Ramsdorf, W.A., Cestari, M.M., Magalhaes, V.F., Garcia, J.R., Esquivel, B.M., Filipak Neto, F., 2011. Cellular responses of Prochilodus lineatus hepatocytes after cylindrospermopsin exposure. Toxicol. In Vitro 25, 1493–1500. Luo, Z., Tan, X.Y., Zheng, J.L., Chen, Q.L., Liu, C.X., 2011. Quantitative dietary zinc requirement of juvenile yellow catfish (Pelteobagrus fulvidraco), and effects on hepatic intermediary metabolism and antioxidant responses. Aquaculture 319, 150–155. Machado, C., Garofaloj, M., Roselino, J., Kettelhut, I., Migliorini, R., 1988. Effects of starvation, refeeding, and insulin on energy-linked metabolic processes in catfish (Rhamdia hilarii) adapted to a carbohydrate-rich diet. Gen. Comp. Endocrinol. 71, 429–437. Mennigen, J.A., Plagnes-Juan, E., Figueredo-Silva, C.A., Seiliez, I., Panserat, S., Skiba-Cassy, S., 2014. Acute endocrine and nutritional co-regulation of the hepatic omy-miRNA-122b and the lipogenic gene fas in rainbow trout (Oncorhynchus mykiss). Comp. Biochem. Phyisol. B 169, 16–24. Minghetti, M., Leaver, M.J., Tocher, D.R., 2011. Transcriptional control mechanisms of genes of lipid and fatty acid metabolism in the Atlantic salmon (Salmo salar L.) established cell line, SHK-1. Biochim. Biophys. Acta Mol. Cell Biol. Lipids 1811, 194–202. Mommsen, T., Plisetskaya, E., 1991. Insulin in fishes and agnathans—history, structure, and metabolic regulation. Rev. Aquat. Sci. 4, 225–259. Morash, A.J., Kajimura, M., McClelland, G.B., 2008. Intertissue regulation of carnitine palmitoyltransferase I (CPT I): mitochondrial membrane properties and gene expression in rainbow trout (Oncorhynchus mykiss). Biochim. Biophys. Acta Biomembr. 1778, 1382–1389. Napal, L., Marrero, P.F., Haro, D., 2005. An intronic peroxisome proliferator-activated receptor-binding sequence mediates fatty acid induction of the human carnitine palmitoyltransferase 1A. J. Mol. Biol. 354, 751–759. Navarro, I., Capilla, E., Castillo, J., Albalat, A., Díaz, M., Gallardo, M., Blasco, J., Planas, J., Gutiérrez, J., Reinecke, M., 2006. Insulin metabolic effects in fish tissues. Fish Endocrinol. 1, 15–48. Park, E.A., Mynatt, R., Cook, G., Kashfi, K., 1995. Insulin regulates enzyme activity, malonylCoA sensitivity and mRNA abundance of hepatic carnitine palmitoyltransferase-I. Biochem. J. 310, 853–858. Pfaffl, M.W., 2001. A new mathematical model for relative quantification in real-time RT–PCR. Nucleic Acids Res. 29, e45-e45. Pierce, A.L., Dickey, J.T., Felli, L., Swanson, P., Dickhoff, W.W., 2010. Metabolic hormones regulate basal and growth hormone-dependent igf2 mRNA level in primary cultured coho salmon hepatocytes: effects of insulin, glucagon, dexamethasone, and triiodothyronine. J. Endocrinol. 204, 331–339. Pierce, A.L., Breves, J.P., Moriyama, S., Hirano, T., Grau, E.G., 2011. Differential regulation of Igf1 and Igf2 mRNA levels in tilapia hepatocytes: effects of insulin and cortisol on GH sensitivity. J. Endocrinol. 211, 201–210. Plagnes-Juan, E., Lansard, M., Seiliez, I., Médale, F., Corraze, G., Kaushik, S., Panserat, S., Skiba-Cassy, S., 2008. Insulin regulates the expression of several metabolism-related genes in the liver and primary hepatocytes of rainbow trout (Oncorhynchus mykiss). J. Exp. Biol. 211, 2510–2518. Polakof, S., Medale, F., Skiba-Cassy, S., Corraze, G., Panserat, S., 2010. Molecular regulation of lipid metabolism in liver and muscle of rainbow trout subjected to acute and chronic insulin treatments. Domest. Anim. Endocrinol. 39, 26–33. Polakof, S., Medale, F., Larroquet, L., Vachot, C., Corraze, G., Panserat, S., 2011. Regulation of de novo hepatic lipogenesis by insulin infusion in rainbow trout fed a highcarbohydrate diet. J. Anim. Sci. 89, 3079–3088. Rho, H.K., Park, J., Suh, J.H., Kim, J.B., 2005. Transcriptional regulation of mouse 6-phosphogluconate dehydrogenase by ADD1/SREBP-1c. Biochem. Biophys. Res. Commun. 332, 288–296. Rius-Francino, M., Acerete, L., Jimenez-Amilburu, V., Capilla, E., Navarro, I., Gutierrez, J., 2011. Differential effects on proliferation of GH and IGFs in sea bream (Sparus aurata) cultured myocytes. Gen. Comp. Endocrinol. 172, 44–49. Ryslava, H., Doubnerova, V., Kavan, D., Vanek, O., 2013. Effect of posttranslational modifications on enzyme function and assembly. J. Proteomics 92, 80–109.

28

M.-Q. Zhuo et al. / Comparative Biochemistry and Physiology, Part B 177–178 (2014) 21–28

Sánchez-Gurmaches, J., Cruz-Garcia, L., Gutiérrez, J., Navarro, I., 2010. Endocrine control of oleic acid and glucose metabolism in rainbow trout (Oncorhynchus mykiss) muscle cells in culture. Am. J. Physiol. Regul. Integr. Comp. Physiol. 299, R562–R572. Song, S., Attia, R.R., Connaughton, S., Niesen, M.I., Ness, G.C., Elam, M.B., Hori, R.T., Cook, G.A., Park, E.A., 2010. Peroxisome proliferator activated receptor α (PPARα) and PPAR gamma coactivator (PGC-1α) induce carnitine palmitoyltransferase IA (CPT-1A) via independent gene elements. Mol. Cell. Endocrinol. 325, 54–63. Spiegelman, B.M., Flier, J.S., 2001. Obesity and the regulation of energy balance. Cell 104, 531–543. Tabarin, A., Diz-Chaves, Y., del Carmen Carmona, M., Catargi, B., Zorrilla, E.P., Roberts, A.J., Coscina, D.V., Rousset, S., Redonnet, A., Parker, G.C., 2005. Resistance to diet-induced obesity in μ-opioid receptor-deficient mice evidence for a “Thrifty Gene”. Diabetes 54, 3510–3516. Tan, X.Y., Xie, P., Luo, Z., Lin, H.Z., Zhao, Y.H., Xi, W.Q., 2012. Dietary manganese requirement of juvenile yellow catfish (Pelteobagrus fulvidraco), and effects on whole body mineral composition and hepatic intermediary metabolism. Aquaculture 326, 68–73. Thumelin, S., Esser, V., Charvy, D., Kolodziej, M., Zammit, V., McGarry, D., Girard, J., Pegorier, J., 1994. Expression of liver carnitine palmitoyltransferase I and II genes during development in the rat. Biochem. J. 300, 583–587.

Zheng, J.L., Luo, Z., Zhu, Q.L., Chen, Q.L., Gong, Y., 2013a. Molecular characterization, tissue distribution and kinetic analysis of carnitine palmitoyltransferase I in juvenile yellow catfish Pelteobagrus fulvidraco. Genomics 101, 195–203. Zheng, J.L., Luo, Z., Zhu, Q.L., Tan, X.Y., Chen, Q.L., Sun, L.D., Hu, W., 2013b. Molecular cloning and expression pattern of 11 genes involved in lipid metabolism in yellow catfish Pelteobagrus fulvidraco. Gene 531, 53–63. Zheng, J.L., Luo, Z., Liu, C.X., Chen, Q.L., Tan, X.Y., Zhu, Q.L., Gong, Y., 2013c. Differential effects of acute and chronic zinc (Zn) exposure on hepatic lipid deposition and metabolism in yellow catfish Pelteobagrus fulvidraco. Aquat. Toxicol. 132–133, 173–181. Zheng, J.L., Luo, Z., Hu, W., Liu, C.X., Chen, Q.L., Zhu, Q.L., Gong, Y., 2014. Differential effects of dietary zinc deficiency and excess on carnitine status, kinetics and expression of CPT I in yellow catfish Pelteobagrus fulvidraco. Aquaculture 420, 10–17. Zhu, Q.L., Luo, Z., Zhuo, M.Q., Tan, X.Y., Sun, L.D., Zheng, J.L., Chen, Q.L., 2014. In vitro exposure to copper influences lipid metabolism in hepatocytes from grass carp (Ctenopharyngodon idellus). Fish Physiol. Biochem. 40, 595–605.