724

46th FORUM

IN IMMUNOLOGY

factors, some endocrine hormones and neurotrophfamily and are presumably evolved from a common progenitor. One important recent finding that may help explain the fttnctional redundancy of cytokine receptors is the fact that various cytokine receptors share a common subunit. A typical example is the case of gp130, a signal transducer molecule that functions not only to transmit signals from the IL6 receptor, but also from the LIF, OSM and CNTF receptors. One other important result from IL6 research is the discovery that overproduction of IL6 is critically linked with a variety of diseases including the development of myeloma/plasmacytomas, rheumatoid arthritis, Castleman’s disease, glomerulonephritis, psoriasis, postmenopausal osteoporosis and other diseases. This involvement of IL6 is again typical of the intimate relationship between cytokine dysfunction and chronic inflammatory disease. In order to further clarify the molecular mechanisms of IL6-related diseases and to develop new medical treatments, it is important to be able to elucidate the mechanisms that regulate IL6 gene expression and to develop inhibitors that will affect IL6 action. We now have characterized the regulatory region of the IL6 gene and identified some of the transcription factors, such as NF-IL6 and NF-LB, that are involved in IL6 gene regulation. Future studies on the molecuic factors, belong to the same receptor

Regulation

lar mechanisms of IL6 gene expression and their roles in various diseases as well as a more precise analysis on the interaction of IL6 with its receptor will provide information critical to the understanding of the molecular pathogenesis of and new approaches to the treatment of these diseases. In this Forum, we will discuss the functional properties of IL6, the structures of IL6 and its receptor and the regulation of IL6 gene expression. We will also discuss the involvement of IL6 in various diseases and consider possible clinical applications of both IL6 and its inhibitors. Before doing so, we would like to thank the contributors to this Forum and the publishers for their excellent cooperation. Toshio Hirano Biomedical Research Center Osaka University Medical School 2-2, Yamada-oka, Suita Osaka 56.5 (Japan), and Tadamitsu Kishimoto Department of Medicine III, Osaka University Medical School, I-l-50, Fukushima, Fukushima-ku, Osaka 530 (Japan)

of IL6 gene expression P.B. Sehgal

Departments of Microbiology and Immunology and of Medicine, New York Medical College, Valhalla, NY 10595 (USA)

Introduction Interleukin-6 (IL6) was originally cloned in 1980 as the cDNA copy of a poly(I).poly(C)-inducible 1.3-kb mRNA isolated from human fibroblasts (“interferon-F2”) (Weissenbach et al., 1980). The recognition in 1986-87 that the inflammationassociated cytokines tumour necrosis factor (TNF) and interleukin-1 (ILl), the growth factors platelet-

Mailing Address: Prof. P.B. Sehgal, ,Dept. of Microbiology Valhalla, NY 1059s.

derived growth factor (PDGF) and epidermal growth factor (EGF), serum, viral and bacterial infection, including bacterial products such as endotoxin, induced IL6 production suggested that this cytokine participated in the host response to a broad range of tissue injury (Content et al., 1985; Kohase et al., 1986, 1987a; Zilberstein et al., 1986; May et al., 1986; Helfgott et al., 1987; Sehgal et al., 1988). Indeed, IL6 appears to be a key systemic or long-

and Immunology,

Basic Science Building, New York Medical College,

INTERLEUKIN

distance alarm signal that is indicative of tissue damage somewhere in the body (Sehgal el al., 1989). The multiple molecular mechanisms and pathways that lead to the inducible expression of the IL6 gene in a wide variety of different tissues and cell types appear to be remarkably adapted to its role as an alarm signal (Sehgal et al., 1987a,b; Ray ef al., 1988, 1989b). This brief overview will focus on an evaluation of data from this and other laboratories on the regulation of IL6 gene expression and on the mechanism of glucocorticoid repression of IL6 gene expression, and discuss new insights that implicate the tumour suppressor proteins ~53 and RB in the regulation of IL6 gene expression.

The IL6 gene

The IL6 gene, located on chromosome 7 (at ~21) in the human genome (Sehgal er al., 1986; FergusonSmith et al., 1988; Bowcock et al., 1988) and on chromosome 5 in the mouse genome (Mock el al., 1989), consists of 5 exons that have the same overall exon-intron structure as the genes for human and rodent granulocyte-colony stimulating factor (G-CSF) and chicken myelomonocytic differentiation factor (Yasukalva et al., 1987; Tanabe et al., 1988; Leutz ef al., 1989). In addition to the major inducible RNA start site at + 1, there is a second minor RNA start site at approximately - 21 (Zilberstein et al., 1986; Ray et al., 1989a). (The RNA start sites at approximately -60 and another one further upstream as reported by Yasukawa et al. (1987) have not been confirmed by any other laboratory). The 5’ flanking regions of the human and murine IL6 genes are highly conserved (> 95 070identity) (Tanabe et al., 1988). At least three polyadenylation sites have been mapped - t\vo close together giving rise to transcripts of length 1.3 kb, and a downstream site giving rise to transcripts of length approximately 2.5 kb (Zilberstein et al., 1986; May et al., 1986; Northemann ef al., 1989). The human IL6 gene consists of at least 3 independently segregating allele systems as determined by restriction polymorphism analyses - three ~L~spI alleles, two Bg/I alleles and at least -1 BstNI alleles (Bo\vcock ef al., 1988). U’hile the .\fspI and BgII alleles appear to be due to point murarions, the BsfNI alleles, which are also detected using several other restriction enzymes, are the result ct‘ insertions ‘deletions in an .4T-rich region immedia!el\. 3’ to [he upstream polyadenylation sites (that .::\h rise IO rhe 1.3 kb mRNX) (Bo\vcock er nl., 1988, i’-rS9). Furrhermore, the fourth intron contains an :.‘I/ rcpe\iri\ e DN.4 element immediately upstream ?, rhc fifth rxon (Boivcock er al., 19S8). Thus, the J‘ ilall of rhe gene is subjected to considerable \,aria-

6

725

bility. Nevertheless, to date, none of these polymerphisms appear to alter the coding sequence for the IL6 protein.

Inducible expression IL6 gene transcription is readily induced in a variety of different normal tissues in response to RNA and DNA virus infection, bacterial products such as endotoxin, serum, inflammation-associated cytokines such as ILl, TNF, PDGF and interferons (Content ef al., 1985; Kohase et al., 1986, 1987a; Hirano ef al., 1986; reviewed in Sehgal ef al., 1987a, 1989). Activation of any of the three major second messenger pathways using diacylglycerol, phorbol ester, combinations of forskolin and iso-butylmethyl xanthine or the calcium ionophore A23 187 all activate IL6 gene transcription in appropriate cells (Sehgal ef al., 1987b; Walther et al., 1988; Zhang et al., 1988). Based ‘on extensive studies carried out in this and other laboratories, figure 1 summarizes the transcription regulatory elements present in the 5’-flanking region of the human IL6 gene (Ray ef al., 1988, 1989a,b, 1990; Shimizu ef al., 1990; Isshiki et al., 1990 ; Akira et al., 1990 ; Lieberrnann and Baltimore, 1990; Zhang et al., 1990). An interesting principle to emerge is that the IL6 and c-fos promoters are strikingly similar in their overall function. The c-fos serum response enhancer element (SRE) exhibits a strong nucleotide sequence similarity to that of the multiple cytokine (ILl, TNF, serum) and second messenger (CAMP, phorbol ester)-responsive enhancer (MRE) region in IL6 (- 173 to - 145) (Walther ef al., 1988; Ray et al., 1989a,b). Indeed, in functional cross-competition assays in intact cells, the IL6 and c-fos regulatory DNA elements cross-compete with each other in a reciprocal manner, in gel-shift competition assays using induced HeLa cell nuclear extracts, oligonucleotides corresponding to regions within the IL6 MRE compete with those from within the c-fos SRE region, and, overexpression of c-fos using constitutive expression plasmids represses both the IL6 and the c-fos promoters (Ray et al., 1989b). Overexpression of c-jztn alone or of c-jun in combination with c-fos has little overall effect on IL6 transcription (our unpublished data). The similarit? between the IL6 and c-fos promoters is further exemplified by the observation that the transcription factor NF-IL6 (C/EBPP) (Akira er al., 1990) not onl) binds the IL6 MRE region but also binds the SRE in the c-fos promoter (Metz and Ziff, 1991b). Indeed, NF-IL6 is also acti\.ated and translocated to the nucleus in PC12 cells, but not in HeLa cells, by c.4bIP agonists (hletz and Ziff, 1991a).

The comples inducible IL6 \IRE enhancer region consists of t\vo partially overlapping DNA elements, each of \vhich, \vhen attached in single copy to the

726

-102

CRUTREI . . . . . .. ATGCTAAAGGACGTCACA-l-l-GCA ------l

RR;1

c-e

RCE

(Rb

target)

IL-6

-401

-

.. . . . . . AC.~~GCACMT CRmn UJF-IL6

CCCGCG~C - CKTGG~CCCAF'CGTG ~CC~~~~~,~~~~~C~~~~~~C

binding

.

site)

Fig. 1. Schematicrepresentationof positive and negative transcription regulatory elementsin the 5’-flanking region of the IL6 gene. Solid lines (either boxes or arrows) indicate DNA regulatory elementsthat have already been functionally implicatedin IL6 geneexpression,while thosemarkedby broken linesor boxesare based on DNA sequenceanalyses.The inducible transcription start siteswere derived by Sl nucleasemapping (ratio of major + I to minor -21 was 99:l) (Ray et al., 1989a).The presenceof a negative regulatory domain(NRD) between - 225and - 165wasinferred from resultspublishedearlier (Ray et al., 1989b).The typical GACGTCA CRE/TRE motif in MRE I and the nucleotides in the novel

CRE/TRE in MRE II which match with nucleotides in the CRE identified in bovine cytochrome P450,,, promoter are highlighted by solid circles. The mutation of the CC residues (open circles) to CT reduces the responsiveness of MRE I to TPA and forskolin; similarly, point mutations in MRE II reduceinducibility by theseagents(seefig. 2). PRDII refers to the NF-E;B-likedomain in the P-interferon promoter. Inr refers to the initiator RNA start site motif as functionally characterized in the terminal deosynucleotidyltransferase(TdT) gene. RCE is the Rb-repressibleDNA target in the c-fos promoter. Adapted from Ray ef al., 1990.

heterologous ramphenicol

herpesvirus thymidine kinase/chloacetyltransferase (TK/CAT) reporter

construct, is responsive, albeit to differing extents,

to all of the inducers tested (Ray et al., 1989b, 1990). MRE I, - 173 to - 15 1, contains the typical GACGTCA cAMP/phorbol ester-responsive (CRE/TRE) motif. MRE II, - 158 to - 145, contains an imperfect dyad repeat which bears little

resemblance to a typical CRE/TRE motif but is nevertheless strongly inducible by both phorbol ester and CAMP, and by IL1 and TNF. The imperfect dyad repeat in MRE II is the site of binding of an ILl- or IL6-activated member of the C/EBP family of transcription factors designated C/EBP-P (also called NF-IL6 and IL6-DBP) (Isshiki et al., 1990; Akira et al., 1990). When each of MRE I or MRE II is mutated individually within the context of the intact IL6 promoter, it becomes clear that for maximal inducibility, both the elements are necessary (fig. 2). Furthermore, the region between - 164 and -225 contains negative regulatory elements because its deletion dramatically upregulates the basal IL6 promoter (Ray et al., 1989b). Parenthetically, there exist no functional data to substantiate the so-called AP-1 site between - 283 and - 277 ; this remains

purely a computer-based observation (Tanabe et al., 1988). A limitation of the role of NF-IL6 (UEBPP) in the activation of the IL6 promoter is that, although IL6 strongly activates NF-IL6 in hepatocytes (Akira et al., 1990), these cells do not express IL6 (Gauldie et al., 1991). Thus, NF-IL6 activation by itself cannot be the sole or dominant basis for IL6 promoter activation. The NF-kB site in the IL6 promoter also appears to contribute to the activation of this gene in some cell types (Shimizu et al., 1990; Liebermann and Baltimore, 1990; Zhang et al., 1990). In evaluating 5’ deletion constructs of the IL6 promoter in this laboratory in transient transfection assays in HeLa cells, all apparent inducibility (except with pseudorabies virus) was lost in the - 110 to + 13 construct (Ray et al., 1988, 1989b, 1990). Nevertheless, it is now clear that even in these experiments, the NF-kB site had a “permissive” effect on IL6 transcription. An IL6/CAT construct containing a mutated NF-kB site in the context of the intact IL6 promoter had decreased inducibility in these cells (fig. 2). In DNA foot-printing experiments, we have observed that the NF-kB factor(s) are fully activated in our “uninduced” HeLa cells. Taken together, the data suggest

INTERLEUKIN

6

727

pmMRE I -GT-

-173

CG

TG ~

-137...-73

-CA-----W pmMRE II

TGGGATTTTCC AAT pmNF-nB

Inducibility pIC225 Pm

(wt) 1

pmMRE II

GR effects (wt GR)

-64

. ..pIC225(ti)

IL-1

TPA

+++

+++

yes

yes

++

+

yes

yes

+

++

yes

yes

pmNF-nB

Repression

Activation

(mut

GR)

+ Fig. 2. Combinatorial

contribution of various DNA elements in the IL6 promoter to its inducibility. Point mutations at MRE I, MRE II or NF+B sites within the contest of the intact IL6 promoter decrease IL6 gene expression. Ray and Sehgal, (unpublished data).

that the discrepancy in descriptions of the role of the NF-kB site in IL6 function is likely to reside in our limited understanding of the state of NF-kB in the various “uninduced” cell types used in different laboratories. The major RNA start site in the IL6 promoter corresponds to the “initiator” (Inr) motif which has been recently described to be similar to the TATA box in its ability to direct accurate transcription in the absence of a TATA box (see Ray et al., 1990). The IL6 DNA sequence from - 126 to - 101 not only contains a direct repeat with strong similarity to the c-Jos basal transcription element, but also contains a 21/26 nucleotide match with the RBrepressible RCE (“RB-control element”) target motif recently identified in the c-fos gene (Ray et al., 1990). Indeed, in functional assays, we have observed that the overexpression of \vt RB or \vt ~53 in HeLa cells strongly represses IL6 promoter constructs (Santhanam et al., 1991) (see below). Transforming mutants of ~53 generally have a reduced ability to repress the IL6 promoter (Santhanam et al., 1991). \Ve have cloned a novel 1 IO-amino acid Zn-finger containing transcription regulatory factor designatc;i RF-IL6 (“repressor factor for IL-6”) that repressci IL-6 and c-.fos promoter constructs (unpublished rji:a). The biological importance of RF-IL6 and the :~:::!lanism Jf its action remain to be explored. Yhe marked “superinduction” of IL6 production in .(,.:e presence of inhibitors of protein synrhesis, a cd!:,::quence primarily of the increased stability of

IL6 mRNA under these conditions (U’alther er al., 1988), can be viewed as a remarkable adaptation to the “alarm signal” function of IL6. Cells inflicted with injury secrete enhanced levels of IL6 as their macromolecular slmthesis becomes compromised. In a dramatic example, Urbanski et al. (1990) reported an increase in the levels of circulating IL6 in volunteers exposed to ultraviolet light; a similar phenomenon was also observed in cultured keratinocytes (Kirnbauer et al., 1991). There are several examples of cell-type-dependent expression of IL6. Whereas CAMP (in the form of forskolin and isobutylmethyl xanthine) enhances IL6 transcription in fibroblasts and epithelial cells (Zhang et al., 1988; Ray er al., 1988, 1989b), it fails to do so in monocytes or in macrophages differentiated in cell culture (Tatter, 1989). Indeed, cAhIP agonists inhibit endotoxin-induced IL6 expression in monocytes and macrophages (Tatter, 1989). IL1 also inhibits IL6 expression in monocytes (Lee er al., 1990; Cheung era/., 1990). Furthermore, although TNF induces IL6 in a variety of cell types (fibroblasts, endothelial cells, keraiinocytes) it fails to do so in monocytes (reviewed in Ray er al., 1989a). Normal T cells, as compared IO T-cell lines, do not express IL6 except under unusual activation conditions (e.g. anti-CD28 activation) (Xarden, 1992). Additionally, plasmin digests of fibrinogen readily induce IL6 in monocytes but not in fibroblats (re\.ie\ved in Fuller and Granett, 1989; Tarter, 1989). Indeed, Fs receptor cross-linking by immunoglobulin appears to be a sufficient signal to induce IL6 in monocytes (Krutmann et 01.. 1990).

46111FORUM

728 Repression of the IL6 promoter and estrogens

I.‘+’ IMMUNOLOGY

searches (Tanabe et al., 19SS) do not appear to be functionally substantiated. In transient transfection assays IL6/CAT reporter plasmids driven by the enhancer and/or basal regulatory elements from within the IL6 promoter were repressed by desamethasone (Dex) in HeLa cells irrespective of the inducer used, provided that these cells had been transfected with constitutive expression vectors producing wt human GR (fig. 3) giving rise to the hypothesis that IL6 promoter occlusion was part of the mechanism by which wt GR repressed IL6 expression (Ray ef al., 1990). It is now clear that transcriptional repression by GR in other experimental systems also involves direct interactions between GR and c-jun (and other c-jun family members) and that whether one observes

by glucocorticoids

Glucocorticoids

and estradiol-17P strongly repress of cell types (Kohase et al., 1987b; Helfgott et al., 1987; Tabibzadeh et al., 1989a). In a series of detailed studies, we observed that the glucocorticoid receptor (GR) footprinted across the entire MRE region, the major TATA box and the major RNA start site (the Inr element) in the IL6 promoter (Ray et al., 1990). There is very little underlying nucleotide-sequence similarity between the GR-binding sites in the IL6 promoter and conventional GRE sites (Ray et al., 1990); thus descriptions of GRE sites in the IL6 promoter based on computer IL6 expression in a i’ariety

Wild-lype hGR colransfecled with CAT conslrucl

pARlOTKC

U

IL-l cl

IL-l+ D

T

T+ D

F

F+ D

TNF

tNF+ D

~QQQQQQQQQ

pARllTKC

4

ARIO

-173

* -AAll

-

-07

ATGCTAAAGGACGTCACATTGCACAATCTTAAT

AAGG

TACGATTTCCTGCAGTGTAACGTGTTAGAATTA

TTCC

. . . . GAACGA;;G:C:GG;;G;;

hlL-6 bCYP17

Fig. 3. Repression of IL6 enhancer elements by glucocorticoids. Figure illustrates the repression of ILl-, phorbol ester-, forskolin- and TNF-induced MRE I/TK/CAT and MRE II/TK/CAT gene expression by dexamethasone (Dex) in HeLa cells transfected with a wild-type CR constitutive expression plasmid. IL6 promoter oligonucleotides AR10 (- 173 to - 151) and AR1 1 (- 158 to - 145) were linked to pTK_,,, CAT. HeLa cells in loo-mm Falcon dishes were transfected with a mixture of control pSV2neo (3 pg), RSVhGRa (5 pg), and either pARlOTKC (2.5 pg) or pARllTKC (2.5 pg). The cells were then left untreated (U) or treated with 1Lla (5 rig/ml), phorbol ester (T, 100 rig/ml), a combination of forskolin (50 FM) and isobutylmethylxanthine (IBMX; 0.5 mM) (F) or TNF (100 rig/ml) in the presenceor absenceof Dex (D, l FM). The sequencesof AR10 and AR11 are presentedin the lower part of the figure. The similarity of the CRE/TRE II motif in AR1 1 to an atypical CRE identified in the bovine cytochrome P450,,, geneis also shown. Adapted from Ray et al., 1990.

INTERLEUKIN Dex-responsive transcriptional activation or repression can be determined by the relative levels of c-fos and c-jun in a cell-type-specific and target-promoterspecific manner (Diamond et al., 1990). Although it is now clear that an intact DNA-binding domain in GR is necessary for IL6 repression (Ray et al., 1991), we need to leave open the possibility that proteinprotein interactions also contribute to IL6 repression by wt GR in a cell-type-specific manner. In experiments designed to investigate the effect of artificially engineered mutations in the DNAbinding domain (DBD) of GR on the ability of this molecule to mediate repression of IL6 gene transcription, we made the unexpected discovery that a class of mutations involving the first Zn finger (deletion of first finger, point mutation in the Zn-catenation site of first finger or in the steroid-specificity domain at the base of the first finger) converted GR from a Dex-responsive repressor to a Dex-responsive activator that could enhance basal and ILl-induced IL6 promoter function in HeLa cells (Ray et al., 1991). In a manner consistent with the previous characterization of these CR mutants, none of the first Znfinger mutants activated the murine mammary tumour virus-long terminal repeat (MTV-LTR)/CAT construct or the c-fo.s/CAT reporter genes ; additionally, mutations in the second Zn finger or deletion of the entire DBD were completely inactive irrespective of the promoter tested. The first Zn-finger GR mutants that aberrantly activated IL6 transcription in HeLa cells failed to bind to the target IL6 promoter in the conventional DNA-binding-immunOprecipitation assay using extracts from HeLa cells appropriately transfected with the GR mutant expression plasmids. These data suggest the novel hypothesis that these GR mutants might activate the IL6 promoter without directly binding to the target promoter. These data also raise the possibility that naturally occurring point mutations in or deletions of the first Zn-finger of GR (which is coded for by a separate exon) or of other steroid receptors (such as the estrogen receptor which also ordinarily represses IL6 expression) may unleash aberrant transcriptional activity leading to a dysregulated overespression of IL6 and other cellular genes. The possibility that these mutant GR species may interact directly with and activate transcription factors such as NF-IL6 (alias UEBPj3) or NF-IL6P (alias UEBPG) is of great interest. The inhibition of IL6 expression by glucocorticoids, although a phenomenon of great therapeutic value, is but one facet of IL61hormonal interactions during the acute phase response that affects the function of the hypothalamo-pituitary-adrenal-gonadal cl.+. IL6 and other cytokines (e.g. ILl) produced in response to infecrions, tissue injury or even psychological stress are directly or indirectly a stimulus for the secretion of corticotropin-releasing factor by the

6

729

hypothalamus, which in turn leads to the enhanced secretion of adrenocorticotrophic hormone (ACTH) by the anterior pituitary and the subsequent increase in the levels of circulating corticosteroids (Woloski et al., 1985; Naitoh et al., 1988). Additionally, II&, which can itself be produced by the folliculostellate cells of the anterior pituitary (Vankelecom et al., 1989), has been reported to directly stimulate the release of the anterior pituitary hormones ACTH, prolactin, growth hormone, and luteinizing hormone of (Spangelo et al., 1989). The administration IL6-inducing cytokines such as TNF or of bacterial endotoxin to human volunteers leads to the appearance of circulating IL6 and to elevations in plasma ACTH and cortisol levels (Jablons et al., 1989; Fong et al., 1989a). Elevated levels of circulating glucocorticoids during the acute phase response synergize with IL6 in inducing the increased hepatic synthesis and secretion of plasma proteins such as fibrinogen, various antiproteinases, complement factors. and scavenger proteins (e.g. haptoglobin, haemopexin and Creactive protein). In addition, the role of IL6 in the activation of B- and T-cell function also contributes to the ability of the host to combat infection and tissue damage (see other chapters in this volume). However, this acute phase reaction is self-limiting in that glucocorticoids strongly inhibit IL6 gene expression in different tissues. Repression of the IL6 gene is a component in the well-known anti-inflammatory effect of glucocorticoids. The downregulation of IL6 gene expression by estradiol-17/3 in estrogen-sensitive tissues such as endometrial stromal cells (Tabibzadeh et al., 1989a) probably represents an additional feedback regulatory loop affecting circulating IL6 levels in women. The molecular mechanism of estrogen repression of the IL6 promoter remains unexplored.

p53 and RB modulate

the IL6 promoter

The realization that some of the neoplastic cell types that aberrantly overexpress IL6 have been recognized to frequentIy contain mutant forms or deletions of the tumour-suppressor gene products p53 and RB, together with the recognition of a DNA motif in the IL6 promoter that is highly homologous to the RCE in c-fos suggested the hypothesis that wt p53 and RB present in normal tissues might ordinarily serve to repress IL6 expression, whereas “transforming” mutations in these proteins or deletions of these genes might re1iei.e this repression (Santhanam et al., 1991). In transient transfection experiments, overespression of wt p53 or \vt RB using constitutive espression vectors repressed a variety of IL6/CAT reporter constructs irrespective of the inducer used; transforming mutants of human or murine p53 \vere less able to repress IL6 gene expression (Santhanam

730

46th

i=ORU.M

I.\’ I,MI\~~UNOLOG

et ol., 1991). While certain pC3 mutants repressed the IL6 promoter, they enhanced transcription from the MHC I promoter, indicating that the repression of the IL6 promoter was not due to a “toxic” effect on cells (Santhanam er al., 1991). The molecular mechanisms for pj3 and RB effects on the IL6 promoter and their overall biological significance remain to be evaluated. It is noteworthy, however, that the IL6 promoter neither has an E2F site (5’ TTTCGCGC 3’) nor is it known to be regulated in a cell-cycle-dependent manner. Thus, mechanisms for transcriptional repression along the lines of E2FRB-cyclin A-~33~~” or EZF-p 107-cyclin A-~33~~“’ interactions (Ewen er al., 1992; Faha et al., 1992; Cao et al., 1992; Shirodkar et al., 1992) may not be directly relevant to the regulation of the IL6 promoter. IL6 gene expression in vivo High levels of endogenously synthesized IL6 are readily detected in the peripheral circulation in a variety of experimental models of bacterial and viral infection, sterile inflammation, cytokine administration and even solid-tumour implantation (reviewed in Sehgal et al., 1989; Van Snick, 1990; Heinrich et al., 1990). In each instance, whereas the appearance of TNF or IL1 may or may not include a systemic component depending on the severity of the disease process in the animal model, the IL6 response always includes a systemic component. Furthermore, while in some models the prior or intercurrent induction of TNF or IL1 can contribute to the subsequent increase in circulating IL6 levels (e.g. in the endotoxinor E. co/i-treated baboon or the turpentine-abscessbearing mouse) (Gershenwald et al., 1990; Fong et a/., 1989b), in others IL6 induction can occur independent of TNF or IL1 induction (e.g. murine models of systemic Lisferia infection, adenovirus type 5 pneumonia, and of solid tumour implantation) (McIntosh et al., 1989; Have11 and Sehgal, 1991; Ginsberg et al., 1991; Have11 et al., 1992). Elevations in circulating IL6 levels in these experimental models are correlated with the subsequent alterations characteristic of the acute phase plasma protein response. Animals treated with a neutralizing mAb to IL6 (e.g. baboons injected with mAb 5IL6-HI7 or mice injected with mAb MP5-20F3) and an inducer of IL6 (e.g. endotoxin, adenovirus type 2, turpentine abscess, TNF, ILl) can have a lo-IOO-fold increase in the levels of circulating IL6, as judged using either appropriate ELISA or the B9 hybridoma growth factor assay (unpublished data). The increase in plasma/serum levels of biologically active IL6 as assayed e.y viva in cell culture assays following appropriate dilution of serum/plasma even in the presence of “neutralizing” mAb is so dramatic that the data suggest that ILWanti-IL6 antigen/antibody complexes

1’

formed in viva are likely to be strong inducers of e\ en more IL6 and/or that the clearance of IL6 from ~i!e peripheral circulation is dramatically inhibited in th: presence of anti-IL6 mAb. Nevertheless, despite rh: marked increase in e.x viva-measurable B9 HGF activity in murine plasma/serum, mAb such as MP5-20F3 at least partially block the in viva alterations in acute phase plasma protein synthesis in the same mice. The possibility that although there is a large amount of IL6 in plasma, it is held in a form that is not “bioavailable” in viva, i.e. in some sort of a depot or inaccessible form, may help explain this paradox. IL6 is an invariant element in the host-tumour interaction (Gelin et al., 1988; hIcIntosh et al., 1989; Tabibzadeh et al., 1989b). Mice bearing a variety of different solid tumour implants exhibit a weightlosing syndrome that is accompanied by increases in the positive acute phase plasma proteins and a decrease in albumin. In such models, IL6, but not TNF or ILl, is detected in the peripheral circulation (Gelin et al., 1988; McIntosh et al., 1989). Circulating levels of IL6 correlate directly with the tumour size and with the extent of cachexia. It had been reported that anti-TNF antibodies blocked tumourinduced cachexia, but the blocking effect was only partial (Gelin et al., 1991). It has now been demonstrated that the anti-MuIL-6 mAb MPS-20F3 largely blocks tumour-induced weight loss and markedly inhibits the serum amyloid P response in mice bearing the C-26.IVX tumor (Strassman et al., 1992). These data are the first demonstration that endogenous IL6 is a contributor to the development of cancer cachexia. The dilemma created by these data arises from the observation that administration of exogenous IL6 to mice or other experimental animals does not elicit a weight-losing syndrome (Heinrich et al., 1990). Perhaps the continuous induction of endogenous IL6 in the tumour-bearing host elicits biological effects different from those of exogenous IL6. Transcription

factor induction

in vivo

Expression of members of the UEBP family of transcription factors that are implicated, in part, in IL6 induction and in the elicitation of IL6-triggered upregulation of acute phase plasma protein genes is rapidly induced in vivo in mice injected with endotoxin or IL6 (Akira et al., 1990; Alam el al., 1992). Dramatic increases in transcription and mRNA for C/EBPP (alias NF-IL6) and C/EBPG in a variety of different organs (liver, kidney, spleen, brain, heart, lung, testis, fat, etc.) were observed within 4 h of administration of endotoxin to mice (Alam el al., 1992). In light of the fact that increases in circulating IL6 can be observed within 30-45 min of endotoxin administration in experimental models (reviewed in Sehgal et al., 1989; Van Snick, 1990), the major

INTERLEUKIN contribution of the induction of C/EBP transcription factors appears to be to heighten the response to IL6 and not its induction per se. A limitation of all of the available data on the molecular dissection of the IL6 promoter and the involvement of various transcription factors in IL6 induction is that the actual importance of each of these in uivo remains to be evaluated. Comments It is now clear that circulating IL6 levels are elevated in a wide variety of human diseases associated with tissue injury, neoplasia, autoimmune diseases and cutaneous lesions such as psoriasis. In this laboratory, we have found it convenient to think about IL6 as a long-distance alarm signal that alerts the hepatocytes to the presence of tissue damage. We view the role of IL1 and TNF primarily as local or paracrine and that of IL6 as both local and systemic. From this perspective, the hepatic effects of IL6 take on major significance. The alterations in plasma protein synthesis elicited by IL6 can be viewed as increasing the ability of the host to limit tissue damage - a concept explored in considerable detail in other papers in this Forum. Within this context, it is rather efficient that the same cytokine that elicits these “non-specific” damage-limiting responses, i.e. IL6, also be the one that enhances the function of the specific immune responses - immunoglobulin synthesis and T-cell activation that then contribute to host recovery. The stimulation of thrombocytopoiesis and participation in enhancing haemopoietic progenitor cell growth by IL6 can be viewed as part of this overall host-response picture. The interactions of glucocorticoids with IL6 - the stimulation of ACTH secretion by IL6 (and therefore the subsequent cortisol release), the synergistic enhancement of IL6 effects on the hepatocyte by glucocorticoids but the inhibition by glucocorticoids of further IL6 synthesis as a part of a feed-back loop, all point to an exquisitely regulated gene expression system geared to function as part of the host defence to injury. Acknowledgements Research in the author’s laboratory is supported in parr b! Research Grant Al-16262 from the National Institutes of Health. a contract from The National Foundation for Cancer Research and a grant from Toray Industries. References Aarden, L.A. &van Kooten. C. (1992), The action of IL-6 on lymphoid populations, irt “Polyfunctional cytokines: IL-6 and LIF” (D. Metcalf). CIBA Foundation Symposium, vol. 167, 65-79.

6 Akira, S., Isshiki, H., Sugita, T., Tanabe, O., Kinoshita, S., Nishio, Y., Nakajima, T., Hirano, T. & Kishimoto, T. (1990), A nuclear factor for IL-6 expression (NF-IL6) is a member of a UEBP family. EMBO J., 9, 1897-1906. Alam, T., An, M.R. & Papaconstantinou, J. (I992), Differential expression of three C/EBP isoforms in multiple tissues during the acute phase response. J. biol. Chem., 267, 5021-5024. Bowcock, A.M., Kidd, J.R., Lathrop, M., Daneshvar, L., May, L.T., Ray, A., Sehgal, P.B., Kidd, K.K. & Cavalli-Sforza, L.L. (1988), The human “beta-2 interferonlhepatocyte stimulating factor/interIeukin&” gene : DNA polymorphism studies and localization to chromosome 7~21. Genomics, 3, 8-16. Bowcock, A.M., Ray, A., Ehrlich, H.A. & Sehgal, P.B. (1989), Rapid detection and sequencing of alleles in the 3’ flanking region of the interleukin-6 gene. Nucl. Acids Res., 17, 6855-6864. Cao, L., Faha, B., Dembski, M., Tsai, L.H., Harlow, E. & Dyson, N. (1992), Independent binding of the retinoblastoma protein and ~107 tb the transcription factor E2F. Nuture (Lond.), 355, 176-179. Cheung, D.L., Hart, P.H., Vitti, G.F., Whitty, G.A. & Hamilton, J.A. (1990), Contrasting effects of interferon-gamma and interleukin-4 on the interleukin-6 activity of stimulated human monocytes. Immunology, 7 1, 70-75. Content, J., DeWit, L., Poupart, P., Opdenakker, G., VanDamme, J. & Billiau, A. (1985), Induction of 26 kDa-protein mRNA in human cells treated with an interleukin-l-related, leukocyte-derived factor. Europ. J. Biochem., 152, 253-257. Diamond, M.I., Miner, J.N., Yoshinaga, S.K. & Yamamoto, K.R. (1990), Transcription factor interactions: selectors of positive or negative regulation from a single DNA element. Science, 249, 1266-1272. Ewen, M.E., Faha, B., Harlow, E. & Livinston, D.M. (1992), Interaction of ~107 with cyclin A independent of complex formation with viral oncoproteins. Science, 255, 85-81. Faha, B., Ewen, M., Tsai, L.H., Livingston, D.M. & Harlow, E. (1992), Interaction between human cyclin A and adenovirus ElA-associated ~107 protein. Science, 255, 87-90. Ferguson-Smith, .4.C., Chen, Y.F., Newman, M.S., May, L.T., Sehgal, P.B. & Ruddle, F.H. (1988), Regional localization of the “F.-interferon/B-cell stimulatory factor Z/hepatocyte siimulating factor” gene to human chromosome 7pl_i-~21. Genotnics, 2, 203-208. Fong, Y., Moldawer, L.L., llarano, M., Tarter, S.B., Clarick, R.M., Santhanam, U., Sherris, D., May, L.T., Sehgal, P.B. B: Lowry, S.F. (1989a), Endotosemia elicits increased circulating P2-IFN/IL-6 in man. J. Itnmunol., 142, 2321-2324. Fang, Y., Trace?, K.J., Moldawer, L.L., Hesse, D.G., Manogue, K.B.. Kenney. J.S., Lee, A.T., KUO. G.C., Allison, A.C., Lo\vrv, S.F. 8: Cerami, A. (1989b), Antibodies IO cache&, tumor necrosis factor reduce inrerleukin-1; and inrerleukin-6 appearance during lethal bacreremia. J. up. Med., 170, 1627-1633. Fuller, G.Rl. 6: Grenetr, H.E. (l989), The structure and function of the mouse hspatocyte stimulating factor. ,-I nt,. ,V. 1.. ,-1cctd. SC;., 557, 3 I-45. Gauldie. J., Korrhemann, \\‘. S: Fey, G. (1990). IL-6 func-

732

46th FOR I/M

IN I;W\4UNOLOG

tions asan esocrinehormone in inflammation : lack of IL-6 gene expressionin hepatocytesundergoing acute phaseresponses. J. Immunol., 144, 3SO-1-3808. Gershenwald,J.E., Fong, Y., Fahey, T.J., III, Calvano, S.E., Chizzonite. R., Kilian. P.L., Lowry, S.F. 81 Moldawer, L.L. (1990).Interleukin-1 receptorblockade attenuatesthe hostinflammatory response.Proc. natl. Acad. Sci. (\Vash.), 87, 4966-4970. Gelin, J., hloldawer, L.L., Lonroth, C., deMan, P., Svanborg-Eden,C., Lowry, S.F. & Lundholm, K.G. (1988), Appearance of hybridoma growth factoriinterleukin-6 in the serum of mice bearing a methylcholanthrene-induced sarcoma. Biochem. biophys. Res. Commun., 157, 575-579. GeIin, J., hloldawer, L.L., Lonnroth, C., Sherry, B., Chizzonite, R. & Lundholm, K. (1991), Role of endogenoustumor necrosisfactor-a and interleukin-I for experimentaltumor growth and the development of cancer cachexia. Cancer Res., 41, 415-421. Ginsberg, H., Moldawer, L.L., Sehgal,P.B., Redington, M., Kilian, P.L., Chanock, R.M. & Prince, G.A. (1991),A mousemodel for investigatingthe molecular pathogenesis of adenoviruspneumonia.Proc. natl. Acad. Sci. (Wash.), 88, 1651-1655. Grossman, R.M., Krueger, J., Yourish, D., GranelliPiperno, A., Murphy, D.P., May, L.T., Kupper, T.S., Sehgal, P.B. & Gottlieb, A.B. (1989), Interleukin-6 is expressedin high levels in psoriatic skin and stimulatesproliferation of cultured human keratinocytes. Proc. natl. Acad. Sci. (Wash.), 86, 6367-6371. Havell, E.A. & Sehgal,P.B. (1991),Tumor necrosisfactorindependentIL-6 production during murine listeriosis. J. Immunol., 146, 756-761. Havell, E.A., Moldawer, L.L., Helfgott, D., Lilian, P.L. & Sehgal, P.B. (1992), Type I IL-l receptor blockadeexacerbatesmurine listeriosis.J. Immunol., 148, 1486-1492. Heinrich, P.C., Caste]], J.V. & Andus, T. (1990), Interleukin-6 and the acutephaseresponse.Biochem. J., 265, 621-636. Helfgott, D.C., May, L.T., Sthoeger,Z., Tamm, I. & Sehgal, P.B. (1987), Bacterial lipopolysaccharide (endotoxin) enhances expression and secretion of &interferon by human fibroblasts. J. exp. Med., 166, 1300-1309. Helfgott, D.C., Tatter, S.B., Santhanam, U., Clarick, R.H., Bhardwaj, N., May, L.T. & Sehgal, P.B. (1989), Multiple forms of IFN-&/IL-6 in serumand body fluids during acute bacterial infection. J. Immunol., 142, 948-953. Hirano, T. (1992), Interleukin-6 and its relation to inflammation and disease.Clin. Immunol. Immunopath., 62, S60-S65. Hirano, T., Yasukawa, K., Harada, H., Taga, T., Watanabe, Y., Matsuda, T., Kashiwamura, S., Nakajima, K., Koyama, K., Iwamatsu, A., Tsunasawa, S., Sakiyama, F., Matsui, H., Takahara, Y., Taniguchi, T. & Kishimoto, T. (1986), Complementary DNA for a novel humaninterleukin (BSF-2)that inducesB lymphocytes to produce immunoglobulin. Nature (Lond.), 324, 73-76. Isshiki, H., Akira, S., Tanabe, O., Nakajima, T., Shimamoto, T., Hirano, T. & Kishimoto, T. (1990), Constitutive and interleukin-1(IL-1)-inducible factors

Y

interact with the IL-l-responsive elementin the IL-6 gene. Mol. cell. Biol., 10, 2757-2764. Jablons, D.M., Mule, J.J., McIntosh. J.K., Sehgal,P.B.. hlay, L.T., Huang, C.M., Rosenberg,S.A. 6; Lotze. M.T. (1989), Interleukin-6/interferon-j, as a circulating hormone: induction by cytokine administration in man. J. Immunol., l-l2, 1542-15-17. Kirnbauer, R., Kock, A., Neuner, P., Forster, E., Krutmann, J., Urbanski, A., Schauer, E.. Ansel, J.C., Schwarz, T. & Luger, T.A. (1991), Regulation of epidermal cell interleukin-6 production by UV light and corticosteroids. J. Invest. Derm., 96, 484-489. Kohase,M., Henriksen-DeStefano,D., May, L.T., Vilcek, J. & Sehgal,P.B. (1986), Induction of &-interferon by tumor necrosisfactor: a homeostaticmechanism in the control of cell proliferation. Cell, 45, 659-666. Kohase, M., May, L.T., Tamm, I., Vilcek, J. & Sehgal, P.B. (1987a),A cytokine network in human diploid fibroblasts: interactions of P-interferons, tumor necrosisfactor, platelet-derived growth factor, and interleukin-1. Mol. cell. Biol., 7, 273-280. Kohase,.M., Henriksen-DeStefano, D., Sehgal, P.B. & Vilcek, J. (1987b),Dexamethasoneinhibits feedback regulation of the mitogenic activity of tumor necrosisfactor, interleukin-1 and epidermalgrowth factor in humanfibroblasts.J. Cell. Physiol., 132,271-278. Krutmann, J., Kirnbauer, R., Kock, A., Schwarz, T., Schopf, E., May, L.T., Sehgal,P.B. & Luger, T.A. (1990),Cross-linkingFc receptorson monocytestriggersIL-6 production. J. Immunol., 145, 1337-1342. Lee, J.D., Swisher,S.G., Minehart, E.H., McBride, W.H. & Economu, J.S. (1990),Interleukin-4 downregulates interleukin-6 production in human peripheral blood mononuclearcells. J. Leuk. Biol., 47, 475-479. Leutz, A., Damm, K., Sterneck, E., Kowenz, E., Ness, S., Franck, R., Gausepohl, H., Pan, Y.C., Smart, J., Hayman, H. & Graf T. (1989), Molecular cloning of the chicken myelomonocytic growth factor (cMGF) reveals a relationship to interleukin-6 and granulocyte colony stimulating factor. EMBO J., 8, 175-181. Liebermann, T.A. & Baltimore, D. (1990), Activation of interleukin-6 gene expressionthrough the NF-KB transcription factor. Mol. cell. Biol.. 10, 2327-2334. May, L.T., Helfgott, D.C. & Sehgal,P.B. (1986),Anti-Pinterferon antibodiesinhibit the increasedexpression of HLA-B7 mRNA in tumor-necrosisfactor-treated human fibroblasts: structural studiesof the pzinterferon involved. Proc. nafl. Acad. Sci. (Wash.), 83, 8957-8961. McIntosh, J.K., Jablons,D. J., Mule, J.J., Nordan, R.P., Rudikoff, S., Lotze, M.T. & Rosenberg,S.A. (1989). In vivo induction of IL-6 by administration of exogenouscytokines and detection of de novo serum levels of IL-6 in tumor-bearing mice. J. Immunol., 143, 162-167. Metz, R. & Ziff, E. (1991a),CAMP stimulatesthe C/EBPrelated transcription factor rNFIL-6 to trans-locate to the nucleusand induce c-fos transcription. Genes Develop., 5, 1754-1766. Metz, R. & Ziff, E. (1991b),The helix-loop-helix protein rE12 and the C/EBP-related factor rNFIL-6 bind to neighboringsiteswithin the c-fos serumresponseelement. Oncogene, 6, 2165-2178. Mock, B.A., Nordan, R.P., Justice, M.J., Kozak, C.,

INTERLEUKIN

Jenkins,N.A., Copeland, N.G., Clark, S.C., Wong, G.G. 8~Rudikoff, S. (1989), The murine IL-6 gene mapsto the proximal regionof chromosome5. J. Immunol., 142, 1372-1376. Naitoh, Y., Fukata, J., Tominaga, T., Tamai, S., Mori, K. & Imura, H. (1988), Interleukin-6 stimulatesthe secretionof adrenocorticotrophic hormone in conscious, freely moving rats. Biochem. biophys. Res. Commun., 155, 1459-1463. Nijsten, M.W., DeGroot, E.R., Tenduis, H.J., Klesen, H.J., Hack, C.E. & Aarden, L.A. (1987),Serumlevelsof interleukin-6 and acute phaseresponses.Lancer, II, 921. Northemann, W., Braciak, T.A., Hattori, M., Lee, F. & Fey, G.H. (1989), Structure of the rat interleukin-6 geneand its expressionin macrophage-derivedcells. J. biol. Chem., 264, 16072-16082. Ray, A., Tatter, S.B., May, L.T. & Sehgal, P.B. (1988), Activation of the “P,-interferon/hepatocytestimulating factor/interleukin-6” promoter by cytokines, viruses, and second-messenger agonists. Proc. nail. Acad. Sci. (Wash.), 85, 6701-6705. Ray, A., Tatter, S.B., Santhanam, U., Helfgott, D.C., May, L.T. & Sehgal,P.B. (1989a),Regulationof expression of interleukin-6 : molecular and clinical studies.Ann. N. Y. Acud. Sci., 557, 353-362. Ray, A., Sassone-Corsi, P. & Sehgal,P.B. (1989b),A multiple cytokine- and secondmessenger-responsive element in the enhancerof the humaninterleukin-6gene: similaritieswith c-fosgeneregulation.Mol. cell. Biol., 9, 5537-5547. Ray, A., LaForge, K.S. & Sehgal, P.B. (1990), On the mechanismfor efficient repressionof the interleukin-6 promoter by glucocorticoids: enhancer,TATA box, and RNA start site (Inr motif) occlusion. Mol. ceN. Biol., 10, 5736-5746. Ray, A., LaForge, KS. & Sehgal.P.B. (1991), Repressor to activator switch by mutations in the first Zn finger of the glucocorticoid receptor: is direct DNA binding necessary?Proc. narl. Acad. Sci. (Wash.), 88, 7086-7090. Romero, R., Avila, C., Santhanam, U. & Sehgal, P.B. (1990),Amniotic fluid interleukin-6in pretermlabor: association with infection. J. clin. Invest., 85, 1392-1400. Santhanam, l-l., Ray, A. & Sehgal,P.B. (1991), Repression of the interleukin-6 genepromoter by ~53 and the retinoblastomasusceptibilitygeneproduct. Proc. narl. Acad. Sci. (Wash.), 88, 7605-7609. Sehgal, P.B. (1990a). Interleukin-6: a regulator of plasma protein geneespression in hepaticand non-hepatic tissues.n!fol. biol. Med., 7, 117-130. Sehgal,P.B. (1990b),Interleukin-6 in infection andcancer. Proc. Sot. esp. Biol. (N.Y.), 195, 183-191. Sehgal.P.B., Zilberstein, A., Ruggieri, M.R., hlay, L.T., Ferpuson-Smith,A., Slate, D.L., Revel, hl. & Ruddle, F.H. (1986), Human chromosome7 carriesthe pz interferon gene. Proc. natl. .-lead. Sci. (\Vash.), 83, 5719-5222. Sehgnl. P.B., May, L.T., Tamm, I. & Vilc‘ek, J. (1987a). Human & interferon and B-cell differentiation factor BSF-2 are identical. Science, 235, 731-733. Sehgal,P.B., Walther, Z. 6: Tamm, 1. (1987b), Rapid enhanccmentof j,-inrerfcron/B-cell differentiation fnc~?r BSF-2 gene esprcssionin human fibroblasts b!’

6

733

diacylglycerols and the calcium ionophore A23187. Proc. null. Acad. Sci. (Wash.), 84, 3663-3667. Sehgal,P.B., Helfgott, D.C., Santhanam,U., Tatter, S.B., Clarick, R.H., Ghrayeb, J. & May, L.T. (1988), Regulationof the acutephaseand immuneresponses in viral disease: enhanced expression of the “P,-interferon/hepatocyte stimulating factor/interleukin-6” genein virus-infected human fibroblasts. J. exp. Med., 167, 1951-1956. Sehgal,P.B., Grieninger, G. & Tosato, G. (1989), Regulation of the acute phaseand immune responses: interleukin-6. Ann. N. Y. Acad. Sci., 557, l-583. Shirodkar, S., Ewen, M., DeCaprio, J.A., Morgan, J., Livingston, D.M. & Chittenden, T. (1992),The transcription factor E2F interacts with the retinoblastoma product and a pl07-cyclin-A complex in a cell cycle-regulatedmanner. Cell, 68, 157-166. Shimizu, H., Mitomo, K., Watanabe, T., Okamoto, S. & Yamamoto, K.I. (1990), Involvement of an NF-KBlike transcription factor in the activation of the interleukin-6 gene by inflammatory lymphokines. Mol. ceil. Biol., 10, 561-568. Spangelo,B.L., Judd, A.M., Isakson, P.C. & MacLeod, R.M. (1989), Interleukin-6 stimulates anterior pituitary hormone releasein vitro. Endocrinology. 125, 575-577. Strassmann, G., Fong. M., Kenney,J. & Jacob,C.O. (1992), Evidence for the involvement of IL-6 in experimental cancer cachexia. J. c/in. Invest., 89, 1681-1685. Tabibzadeh, S.S., Santhanam,U., Sehgal,P.B. & May, L.T. (1989a), Cytokine-induced production of interferon-&/interleukin-6 by freshly explanted human endometrial stromal cells: modulation by estradiol-17/3.J. Immunol., 142, 31343139. Tabibzadeh, S.S., Poubouridis, D., May, L.T. & Sehgal, P.B. (1989b), Interleukin-6 immunoreactivity in human tumors. Amer. J. Path.. 135, 421-433. Tanabe, O., Akira, S., Kamiya, T., Wong, G.G., Hirano, T. & Kishimoto, T. (1988),Genomic structure of the murine IL-6 gene: high degreeconservationof potential regulatory sequences betweenmouseand human. J. fmmunol., 41, 3875-3881. Tatter, S.B. (1989),Interleukin-6: a mediator of the acute phasereaction. Ph.D. thesis,Rockefeller University. Urbanski, A., Schwarz, T., Neuner, P., Krutmann, J., Kirnbauer, R.. Kock. A. & Luger, T.A. (1990), Ultraviolet light inducescirculating interleukin-6 in humans. J. Invest. Derm., 94, 808-811. Van Oers, M.H.J., Van Der Heyden, A.A.P.A.M. 8: Aarden, L.A. (1988) Interleukin-6in serumand urine of renal transplant recipients. Gin. esp. Znrniunol., 71, 314-319. Van Snick, J. (1990),Interleukin-6: an overview.Ann. Rev. Immunol.,

8, 253-278.

Vankelecom, H., Carmeliet, P., Van Damme,J., Billiau, A. 8r Denef, D. (1989), Production of interleukin-6 by folliculo-stellatecellsof the anterior pituitary gland in a histiocytic cell aggregateculture system.Neuroendocinologv. 49, 102-106. Walther, Z., May, L.T. S:Sehgal,P.B. (1983).Transcriptional regulation of the interferon-&.,B cell differentiation factor BSF-?/hepatocyte stimulating factor genein human fibroblasts by other cytokines. J. IIF mlrno/., 140, 97-1-977. \\‘eissrnbach,J., Chernajovsky. I’., Zee1.i.\I., Shulman,

46111FORUM

734

IA’ I&~IV~UI\‘OLOG

L., Soreq, H., Nir, U., \\‘allach. D., Perricaudet, hl., Tiollais, P. & Revel, M. (19SO), Two interferon mRN.-\s in humanfibroblasts: In viva translationand Esctlerictliacoli cloningstudies.Proc. narl. .-Icad. Sci. (\Vash.). 77, 7152-7156. \\‘oloski, B.ll.R.N.J., Smith, E.11.. Meyer, \\‘.J., III, Fuller, G.M. 8: Blalock, J.E. (1985), Corticotropinreleasing activity of monokines. Science, 230, 1035-1037. Yasukawa, I;., Hirano, T., \Vatanabe, Y., Muratani, K., blatsuda, T. & Kishimoto, T. (1987), Structure and expression of human B-cell stimulatory factor 2 (BSF-L/IL-6) gene. EMBO J., 6, 2939-2935. Zhang, Y., Lin, J.X. & \‘ilCek, J. (1988), Synthesisof

NF-IL6

Y

interleukin-6 (interferon F?.‘B-cell stimulatory fnstor 2) in humanfibroblastsistriggeredby an incrca\in intracellular cyclic AMP. J. biol. Ckem., 263, 6177-6182. Zhang, Y., Lin, J.X. & VilCek, J. (1990),Interleukin-6 induction by tumor necrosisfactor and interleukin-1 in humanfibroblastsinvolvesactivation of a nuclearfactor binding to a KB-like sequence.Mol. cell. Biol., 10, 3818-3923. Zilberstein, A., Ruggieri, R., Korn, J.H. & Revel, hl. (1956),Structure and expressionof cDNA and genes for human interferon-beta-2, a distinct speciesinducible by growth stimulatory cytokines. EMBO J., 5, 2529-2537.

and gene regulation S. Akira

Institure for Molecular and Cellular Biology, Osaka University, l-3 Yamadaoka, Suita, Osaka 565 (Japan)

Introduction NF-IL6 was initially identified as a nuclear facbinding to a 14-bp palindromic sequence (ACATTGCACAATCT) within an IL 1-responsive element in the human IL6 gene (Isshiki et al., 1990). The gene encoding NF-IL6 was cloned from a Xgtl 1 cDNA expression library of LPS-stimulated human peripheral monocytes by a South-Western method (Akira et al., 1990). Interestingly, the cloned NF-IL6 contained a region highly homologous to the Cterminal portion of C/EBP, the first nuclear factor

tor

proposed to contain a leucine zipper structure (LandSchultz et al., 1988). The highly homologous region includes a basic domain and a leucine zipper structure essential for DNA binding and dimerization, respectively. NF-IL6 recognizes the same nucleotide sequences as C/EBP. Both proteins recognize a variety of the divergent nucleotide sequenceswith differ-

ent

affinity

and

the

consensus

sequence

is

However, expression of these two proteins is quite different. C/EBP is ex-

TNF or IL6, indicating that NF-IL6 may be involved in acute phase, immune and inflammatory responses. Indeed, evidence in support of this has recently been provided. NF-IL6

and acute phase gene regulation

Production of acute phase proteins is regulated by IL6 mainly at a transcriptional level in the liver. Site-directed mutagenesis studies of the promoter regions of hepatic acute phase genes, including haptoglobin, haemopexin, CRP, and aZmacroglobulin have revealed two types of IL6 c&acting response elements ; one is the hexanucleotide CTGGGA and the other is a group of the sequences which seem to be dissimilar to each other but are recognized by the same set of proteins, including the IL6-inducible protein (IL6-dependent-DNA binding protein, IL6DPB). We noticed that the latter sequences include the

T(T/G)NNGNNAA(T/G).

recognition sequence of NF-IL6.

pressed in liver and adipose tissues and is supposed to regulate several hepatocyte- and adipocyte-specific genes. BY contrast, NF-IL6 is expressed at an undetectable or a minor level in all normal tissues, but it is drastically induced by stimulation of LPS, ILl,

binant NF-IL6 binds to these IL6 RE. Recently, Cortese and his colleagues (Poli et al., 1990) have cloned a cDNA coding for IL6DBP and it turned out to be a rat homolog of NF-IL6. When the NF-IL6 gene was introduced into a hepatoma cell line Hep3B, basal production as well as IL6-mediated induction of hap-

Actually,

recom-