DEVELOPMENTAL

BIOLOGY

144,301-308 (1991)

Regulation of hsp70 mRNA Levels during Oocyte Maturation and Zygotic Gene Activation in the Mouse FAZAL M. MANEJWALA,CATRIONAY.LOGAN,ANDRICHARD Department

of Biology,

University

of Penlzsylvania, Accepted

December

Philadelphia,

M. SCHULTZ Pennsylvania

1910&6018

28, 1990

Protein phosphorylation catalyzed by the CAMP-dependent protein kinase is implicated in transcriptional activation of the embryonic genome in the two-cell mouse embryo, while heat shock protein (hsp70) has been identified as one of the first products of zygotic gene activation. Using reverse transcription-polymerase chain reaction we have analyzed relative changes in the amount of hsp70 mRNA during oocyte maturation and early embryogenesis. We report that the amount of hsp70 mRNA decreases after germinal vesicle breakdown, while inhibiting germinal vesicle breakdown inhibits this maturation-associated decrease. The amount of hsp70 mRNA increases between the one- and two-cell stages. This increase is inhibited by either a-amanitin or the CAMP-dependent protein kinase inhibitor H-8; the same concentration of H-7, which is a more potent inhibitor of protein kinase C, has little inhibitory effect on this increase in the relative amount of hsp70 mRNA. Last, addition of cycloheximide to one-cell embryos late in G2 inhibits neither cleavage to the two-cell stage nor the increase in the relative amount of hsp70 mRNA. These results strengthen the previous proposal that protein phosphorylation is involved in zygotic gene activation in the two-cell mouse embryo. 0 1991 Academic

Press, Inc.

INTRODUCTION

The fully grown germinal vesicle (GV)-intact mouse oocyte is transcriptionally active, but following oocyte maturation the metaphase II-arrested egg is apparently transcriptionally inactive (Wassarman and Letourneau, 1976; DeLeon et aZ., 1983; Brower et al, 1981). The first cell cycle in the mouse embryo is under maternal control and cleavage to the two-cell stage occurs in the presence of cY-amanitin (Braude et al, 1979). The embryonic genome is activated at the two-cell stage, as evidenced by the synthesis of paternally derived proteins (Sawicki et ah, 1982), and cx-amanitin inhibits the synthesis of a number of proteins that are thought to be products of zygotic gene activation (Bensaude et al., 1983; Flach et al., 1982; Bolton et ab, 1984; Poueymirou and Schultz, 1989). Degradation of maternal RNA is initiated during oocyte maturation (Bachvarova et al., 1985; Paynton et al., 1988) and by the end of the two-cell stage the bulk of the maternal mRNA is degraded (Bachvarova and DeLeon, 1980; Paynton et al, 1988; Giebelhaus et al., 1983; Graves et ak, 1985; Bachvarova et ah, 1989). Thus transcriptional activation is involved in replacing maternal transcripts that are common to both the oocyte and the early embryo, as well as generating novel ones that are likely to be involved in early embryogenesis. Little is known about the molecular basis that regulates the onset of transcriptional activation in the mouse embryo. Transcriptional activation, as assessed by the appearance of a set of proteins whose synthesis is 301

inhibited by a-amanitin (transcription-requiring proteins; TRP), is apparently uncoupled or very loosely coupled to the cell cycle, since transcriptional activation is independent of DNA synthesis (Howlett, 1986b; Poueymirou and Schultz, 1987), cell division (Petzoldt, 1984; Poueymirou and Schultz, 1987, 1989), and the nucleoplasmic/cytoplasmic ratio (Petzoldt and MuggletonHarris, 1987). One member of the TRP is hsp70; (Yamanitin inhibits the appearance in the two-cell embryo of proteins that have two-dimensional gel electrophoretie characteristics and peptide maps similar to those of hsp70 present in F9 cells (Bensaude et al, 1983). The observation that the first cell cycle is under maternal control suggests that post-translational modifications of maternally derived proteins are involved in transcriptional activation. Many of the changes in the pattern of protein synthesis that occur during the first cell cycle are indeed due to post-translational modification (Van Blerkom, 1981; Howlett and Bolton, 1985; Howlett, 1986a). Consistent with this hypothesis is that protein phosphorylation catalyzed by the CAMP-dependent protein kinase (PK-A) apparently regulates transcriptional activation in the two-cell mouse embryo. Three inhibitors of PK-A, each of which inhibits the enzyme by a different mechanism, do not inhibit cleavage of one-cell embryos to the two-cell stage but do inhibit the synthesis of the TRP (Poueymirou and Schultz, 1989). In pursuing our studies on the role of protein phosphorylation in transcriptional activation, we report 0012-1606/91 $3.00 Copyright All rights

0 1991 by Academic Press, Inc. of reproduction in any form reserved.

DEVELOPMENTALBIOLOGY

302

here that the relative amount of hsp70 mRNA increases between the one- and two-cell mouse embryo, and that the addition of a PK-A inhibitor N-[2-(methylamino)ethyl]-5isoquinolinesulfonamide (H-8), which inhibits the synthesis of the TRP, inhibits this increase. We also report that the increase in hsp70 mRNA that coincides with the onset of transcriptional activation seems independent of protein synthesis, since inhibiting protein synthesis in the one-cell embryo in G2 does not inhibit this increase. Last, we demonstrate that a decrease in the relative amount of hsp70 mRNA occurs during oocyte maturation. MATERIALS

AND METHODS

Collection and Culture of Mouse Oocytes, Eggs, and Embryos

Fully grown, GV-intact oocytes from preovulatory antral follicles were obtained from pregnant mare’s serum gonadotropin-primed CF-1 female mice (Harlan) and the oocytes were completely freed of attached cumulus cells as previously described (Schultz et al., 1983). The collection medium was bicarbonate-free minimal essential medium (Earle’s salts) supplemented with pyruvate (100 pg/ml), gentamicin (10 pg/ml), polyvinylpyrrolidone (3 mg/ml), and 25 mA4 Hepes, pH 7.2 (MEM/PVP). To prevent germinal vesicle breakdown (GVBD), 0.2 mM 3-isobutyl-l-methyl xanthine was included (Schultz et aZ.,1983). Oocytes were allowed to resume meiosis by culturing them at 37°C in a humidified atmosphere of 5% CO, in air in MEM/PVP in which the Hepes was replaced with 25 mM sodium bicarbonate and the IBMX was omitted. GVBD was scored by examining the oocytes with a Wild M5A microscope at lOOfold magnification. Ovulated eggs were collected from superovulated CF1 female mice as previously described (Endo et aZ., 1987). The collection medium was MEM/PVP and the eggs were freed from their cumulus cells masses by a brief treatment with hyaluronidase (3 mg/ml; Sigma Chemical Co., St. Louis, MO) in MEM/PVP. One-cell embryos were obtained from superovulated CF-1 female mice (Harlan) mated to B6D2Fl/J males (Jackson Laboratory) as previously described (Poueymirou and Schultz, 1989). Following a brief treatment with hyaluronidase in MEM/PVP, the embryos were washed through four drops of CZB medium (Chatot et ak, 1989) and then cultured in CZB medium at 37°C in a humidified atmosphere of 5% CO, in air. CZB was chosen for the culture medium because it supports development to the blastocyst stage of one-cell embryos obtained from outbred strains of mice (Chatot et al, 1989). RNA Isolation

Oocytes, eggs, or embryos (100 of each) were washed in MEM/PVP and transferred in a minimum volume

vOLUME144,1991 TABLE 1 PRIMERSUSEDFORRT-PCR Primer 5’ hsp70 3'hsp'70 5’a-globin 3’a-globin

Sequence CTCACTGGAGTCCTATGCCT GCCTGAAGAAGCACCACCAG GCAGCCACGGTGGCGAGTAT GTGGGACAGGAGCTTGAAAT

Corresponding bp in cDNA or genomic sequence 1685-1704" 1962-1981 241-260b 555-56'7

a The sequence for the mouse hsp70 cDNA isolated embryonal carcinoma F9 cell line was used (Giebel primers encode for a DNA fragment that is 297 bp. b The sequence for the rabbit a-globin genomic (Cheng et al., 1986). The 3’ primer spans an intron encode for a DNA fragment that is 257 bp.

from the mouse et ak, 1988). The clone was used and the primers

(~5 ~1) to 100 ~1 of lysis buffer [6 Mguanidine thiocyanate containing 5% ,&mercaptoethanol, 10 mM EDTA, pH 7.5, 4% sodium sarkosyl, and 20 fig of rRNA (Boehringer-Mannheim)]. To provide an internal standard, 0.5 pg of rabbit globin mRNA (Bethesda Research Laboratory) was added for every oocyte, egg, or embryo transferred to the lysis buffer. The BRL rabbit globin mRNA is about 80-90% pure and is a mixture of both cy and p globin mRNAs. The samples were then stored at -20°C until use. The sample in lysis buffer was passed through a 25-ga needle to shear genomic DNA and layered onto 100 ~1 of 5.7 1M CsCl containing 10 mM EDTA, pH 7.5. The samples were centrifuged in a Beckman TL-100 ultracentrifuge at 80,000 rpm for 4 hr at room temperature using a TL-100A rotor. The lysis buffer and CsCl layers were carefully removed and the pellet was dissolved in 100 ~1 of 2.5 M ammonium acetate. Ethanol (300 ~1 of a 100% solution) was added and the RNA precipitated on dry ice for 30 min and collected by centrifugation in an Eppendorf microcentrifuge for 30 min. The pellet was carefully washed two times with cold 80% ethanol and residual fluid was removed under reduced pressure. The RNA was taken up in H,O (5-20 ~1) containing 1 unit RNasin/ ~1 (Promega), and to determine recovery, an aliquot was removed to determine the OD,; recoveries of 60-80% of the initial amount of rRNA were routinely obtained. A portion of the remainder of the sample, which corresponded to 20 oocyte, eggs, or embryos, was used for reverse transcription-polymerase chain reaction (RT-PCR). Reverse Transcription-Polymerase Detection of hsp70 mRNA

Chain Reaction

RT-PCR was used to determine relative changes in the amount of hsp70 mRNA. The primers used in these experiments are listed in Table 1. Reverse transcription was performed at 42°C for 1 hr; the incubation mixture

MANEJWALA, LOGAN, AND SCHULTZ

hsp?‘O mRNA

(20 ~1) contained PCR buffer (50 mM KCl, 20 mM TrisHCl, pH 8.4, 2 mM MgCl,, 0.1 mg/ml nuclease-free BSA), 1 unit/p1 RNasin, 1 mM of each dNTP, 0.2 pg of oligo(dT),, (Pharmacia), and 100 units of MMLV reverse transcriptase (Bethesda Research Laboratory). Following reverse transcription, the sample was heated at 95°C for 5 min, and 30 ~1 of 10X PCR buffer containing 20 pmoles of each primer, 2.5 &i [ol-32P]dCTP (sp act 3000 Ci/mmole, Amersham), and 2 units of Taq polymerase (Cetus) were added. DNA amplification was performed on a Bioscycler thermocycler using default profile A, i.e., 35 cycles at 55°C for 20 set, 72°C for 20 set, and 92°C for 20 sec. Following DNA amplification, about 15 pg of RNase A in 0.5 ~1 was added and the sample incubated at 37°C for 10 min to degrade the rRNA; omitting this step resulted in a high background fluorescence following ethidium bromide staining.

in Mouse

Oocytes

und Embryos

303

28s

Agarose Gel Electrophoresis

The samples were subjected to electrophoresis at 4 V/cm in mini-gels comprised of 1% Seakem and 3% NuSeive agarose in TEA buffer (40 mM Tris-HCl, 1 mM EDTA, and 5 mM sodium acetate, pH 7.5) containing 0.5 pg/ml of ethidium bromide. The BRL 123-bp ladder was used for molecular weight markers. When the tracking dye migrated about 75% of the length of the gel, the gel was removed, and the bands corresponding to hsp’70 and globin mRNA were visualized under uv light, cut out, and subjected to Cerenkov counting. The regions in another lane that contained only primers and corresponded to the position of the hsp70 and globin bands were also cut out and counted to correct for the background. Characterization of the RT-PCR Assay fin- Determining Relative Changes in the Amount of hp70 mRNA

The primers selected for analysis of hsp’70 mRNA correspond to sequences present in an hsp70 cDNA isolated from mouse ES cells (Giebel et al, 1988). RNA obtained from two-cell embryos and subjected to RT-PCR generated a DNA fragment of 297 bp, which was the anticipated size (Fig. 1). In addition, this DNA contained the predicted PstI and Sac1 restriction sites, and digestion of the amplified product with either PstI or Sac1 produced the fragments of 145 and 165 bp, and 270 bp, respectively (Fig. 1). The calculated size, which did not include the overhang of four nucleotides, was 138 and 156 for PstI digestion, and 267 bp for Sac1 digestion. The DNA fragment generated from the RT-PCR was due to the presence of hsp70 mRNA, not to genomic contamination. Isolated RNA was treated with either RNase or DNase, extracted with chloroform/phenol, and the aqueous phase dried down under reduced pressure. The sample was then subjected to RT-PCR. Treat-

FIG. 1. Autoradiogram of hsp70 mRNA diagnostic fragment restricted with either PstI or SacI. Following RT-PCR in the presence of [a2P]dCTP of 60 two-cell embryos as described under Materials and Methods, the sample was divided into three portions. One portion was not restricted, whereas the other two portions were treated with either PstI or Sac1 (both from Promega and restricted according to the supplier’s recommendations). The samples were then subjected to gel electrophoresis in 8% polyacrylamide gels (Sambrook et al, 1989), and the gel was dried and subjected to autoradiography. Lane 1, unrestricted hsp70 diagnostic fragment; lane 2, hsp’i’0 diagnostic fragment restricted with &I; lane 3, hsp’70 diagnostic fragment restricted with SUCI.

ment of the sample with RNase abolished the synthesis of the diagnostic hsp70 mRNA fragment, whereas treatment of the sample with DNase did not (data not shown). RNA isolated from either oocytes, eggs, or embryos and subjected to RT-PCR in the presence of the globin primers did not generate the diagnostic globin mRNA fragment of 257 bp (data not shown), and no signal was detected when either hsp70 or globin primers were used alone in the absence of RNA (data not shown). Log-log plots revealed a linear relationship between the amount of radioactivity incorporated into the appropriate diagnostic fragment and the number of oocytes/ eggs/embryos (5-40) or amount of globin mRNA (O.l100 pg) (Fig. 2). Last, log-log plots revealed a linear re-

304

DEVELOPMENTAL BIOLOGY

tooo-

100.I-100 1

10 Number of embryos

10 100 1000

Globin mRNA (pg)

FIG. 2. Relationship between the number of cpm incorporated into the diagnostic fragment and the number of embryos or amount of globin mRNA. The experiment was performed as described under Materials and Methods and two-cell embryos were used in A.

lationship between the ratio of hsp70 mRNA to globin mRNA with increasing numbers of two-cell embryos in the presence of a constant amount of globin mRNA (Fig. 3). Determining

the Relative

Amount

of hsp70 mRNA

The addition of globin mRNA was used to correct for differences in RNA recovery and efficiency of RT-PCR between samples. After subtracting the number of background counts in the region of each band (see above), the ratio of the number of cpm present in the bands that corresponded to hsp70 and globin mRNA was determined. This ratio for a given stage was arbitrarily set as 1 and relative differences in the amount of hsp70 were determined by comparing this ratio to that obtained for other developmental stages.

I

10

1

#of

2-Cell

100 Embryos

FIG. 3. Relationship between the ratio of hsp70 mRNA to globin mRNA and increasing number of embryos using a constant amount of globin mRNA. RNA was isolated from two-cell embryos and amounts that corresponded to the indicated number of embryos were subjected to RT-PCR in the presence of a constant amount of globin mRNA (10 pg/sample). Following agarose gel electrophoresis, the ratio of hsp70 to globin mRNA was determined as described under Materials and Methods.

VOLUME 144.1331

FIG. 4. Photograph of ethidium bromide-stained agarose gel showing relative changes in the amount of hsp70 mRNA during oocyte maturation. RNA from 20 oocytes at different stages of maturation was subjected to RT-PCR as described under Materials and Methods. Lane 1, GV-intact oocytes; lane 2, GV-intact oocytes cultured overnight in the presence of 0.2 mM IBMX; lane 3, oocytes collected 3 hr after transfer to IBMX-free medium (all the oocytes had undergone GVBD); lane 4, oocytes collected 7 hr after transfer to IBMX-free medium (all oocytes had undergone GVBD and were at metaphase I); lane 5; ovulated eggs collected 16 hr post-hCG and arrested at metaphase II; lane 6; oocytes matured in vitro for 16 hr and arrested at metaphase II. The experiment was performed three times and similar results were obtained each time. Shown is a representative example.

RESULTS

Developmental Changes in the Relative Amount of hsp70 mRNA during Oocyte Maturation and Early Embryogenesis Oocyte maturation is accompanied by the decrease in the amount of several mRNAs, e.g., actin (Bachvarova et ah, 1989) and ZP3 (Philpott et aZ., 1987; Roller et ah, 1989). Some of these are replaced by activation of the embryonic genome. The observations that hsp70 is synthesized in the fully grown oocyte (Curci et aZ., 1987) and that hsp70 is one of the first genes transcribed when the embryonic genome is activated (Bensaude et aZ., 1983) led us to investigate whether the relative amount of hsp70 mRNA decreased during oocyte maturation and whether its level increased between the one- and twocell stages. Using the ratio of hsp70 mRNA to globin mRNA in the GV-intact oocyte as loo%, the relative changes in this ratio, which reflect relative changes in the amount of hsp70 mRNA, were determined during oocyte maturation and early embryogenesis. The relative ratio decreased during oocyte maturation; the relative ratio in the ovulated egg arrested at metaphase II was about 30% of that in the GV-intact oocyte (Figs. 4 and 5). A similar decrease in the relative amount of hsp70 mRNA occurred during either in vitro or in vivo oocyte maturation (Fig. 5). In addition, the decrease occurred shortly after GVBD and appeared to be causally related to resumption of meiosis, since inhibiting oocyte maturation with IBMX inhibited the decrease in the relative amount of hsp70 mRNA (Fig. 5). Consistent with the previous suggestion that hsp70 is a product of zygotic gene activation was the observation that there was a two- to threefold increase in the relative ratio between the one- and two-cell stages (Figs. 6-8).

MANEJWALA,LOGAN,ANDSCHULTZ

h-p70

Time (hr)

FIG. 5. Changes in the relative ratio of hsp70/globin mRNA during oocyte maturation. RNA from 20 oocytes at different stages of maturation was subjected to RT-PCR as described under Materials and Methods. The ratio of the number of cpm in the hsp70 diagnostic fragment to that in the a-globin fragment in the GV-intact oocyte was taken as 100% and the ratios obtained from oocytes at other stages of maturation were compared to this. The experiment was performed three times and similar results were obtained each time. The data were pooled and expressed as the mean f SEM. (O), oocytes maturing in vitro; (0) oocyte matured in viva; (A) GV-intact oocytes cultured for 18 hr in the presence of IBMX. GVBD (>95%) occurred by 2 hr and by ‘7 hr the oocytes were at metaphase I.

mRNA

in Mouse

Oocytes

305

and Embryos

As anticipated, incubating one-cell embryos in the presence of cY-amanitin inhibited the accumulation of hsp70 mRNA that occurs between the one- and two-cell stages. H-8 also inhibited this increase, to about the same extent (Fig. 7). The decrease in the relative ratio in these treated embryos, in which transcriptional activation was inhibited, compared with that in the one-cell embryo was probably due to degradation of maternal RNA. The observation that a similar concentration of H-7 had little effect on the accumulation of hsp70 mRNA indicated a specificity to the H-8-mediated inhibition. The extent of inhibition effected by this concentration of H-7 was consistent with its ability to inhibit the synthesis of the TRPs by about 20% (Poueymirou and Schultz, 1989). EJfect of Inhibiting of hsp70 mRNA

Protein Synthesis on Accumulation

The apparent inhibition of transcriptional activation by an inhibitor of PK-A suggested that post-translational modifications were involved in this process. If the proteins involved were stable enough, inhibiting protein synthesis in the G2/M part of the first cell cycle should not inhibit the increase in the amount of hsp70 mRNA that occurred between the one- and two-cell stages. Cycloheximide was added to one-cell embryos at a

Eflect of an Inhibitor of Protein Kinase A and a-Amanitin on Accumulation of hsp?‘OmRNA

We previously demonstrated that three different inhibitors of PK-A, each of which inhibits the enzyme by a different mechanism, inhibit the synthesis of a set of proteins that are markers of transcriptional activation (Poueymirou and Schultz, 1989). Although these results suggested that protein phosphorylation was involved in transcriptional activation, the assay for transcriptional activation was based on protein synthesis. To ascertain more directly the effect of inhibiting PK-A on transcriptional activation, we determined the effect of a PKA inhibitor on the accumulation of hsp70 mRNA between the one- and two-cell stages. H-8 and 1-(5-isoquinolinylsulfonyl)-2-methylpiperazine (H-7) are membrane-permeable inhibitors of protein kinases (Hidaka et ah, 1984). H-8 is a more potent inhibitor of PK-A and H-7 is a more potent inhibitor of PK-C. PK-A may be implicated in a specific biological process, if a given concentration of H-8, but not the same concentration of H-7, inhibits that process. For example, 100 pMH-8 inhibits the synthesis of the TRPs, whereas 100 PM H-7 has little effect (Poueymirou and Schultz, 1989), and 50 pMH-8 inhibits the CAMP-stimulated increase in the rate of both blastocoel expansion and =Na+ uptake, whereas the same concentration of H-7 does not (Manejwala and Schultz, 1989).

Oocyte

Egg

1 -Cell

2-Cell

FIG. 6. Changes in the relative ratio of hsp?‘O/globin mRNA during oocyte maturation and early embryogenesis. RNA from 20 oocytes, eggs, one-cell, and two-cell embryos was subjected to RT-PCR as described under Materials and Methods. The ratio of the number of cpm in the hsp70 diagnostic fragment to that in the a-globin fragment in the GV-intact oocyte was taken as 100% and the ratios obtained from the other stages were compared to this. One-cell embryos were collected about 21 hr post-hCG. This corresponds to late Gl or early S of the first cell cycle. The two-cell embryos were collected about 8 hr after cleavage to the two-cell stage. The experiment was performed two times and qualitatively similar changes were observed each time. The data have been pooled and are expressed as the mean + range.

DEVELOPMENTAL

BIOLOGY

s 0

1c

2c

a-am

H8

H7

FIG. 7. Effect of cY-amanitin, H-8, and H-7 on the relative ratio of hsp’lO/globin mRNA during transcriptional activation. RNA from 20 embryos at different stages of development was subjected to RT-PCR as described under Materials and Methods. The ratio of the number of cpm in the hsp70 diagnostic fragment to that in the a-globin fragment in the one-cell embryo was taken as 100% and the ratios obtained from embryos at other stages of maturation were compared to this. a-Amanitin (24 pg/ml), H-8 (100 pA!f) or H-7 (100 NM) were added about 28 hr post-hCG; under these conditions the extent of cleavage of these treated embryos to the two-cell stage was similar to that of the control embryos. The experiment was performed two times and qualitatively similar changes were observed each time. The data have been pooled and are expressed as the mean f range.

time when about 5-10% had cleaved to the two-cell stage. Thus, cycloheximide was added in late G2/M of the first cell cycle. The concentration of cycloheximide used in these experiments inhibits the incorporation of [YS]methionine into acid-insoluble material by >95% (data not shown). As reported previously (Howlett, 1986a), addition of cycloheximide at this time has little effect on the ability of the embryos to cleave to the twocell stage. For example, in the experiment shown in Fig. 6,165 of the 183 (90%) control one-cell embryos cleaved and 220 of the 270 (81%) cycloheximide embryos cleaved. Relative to the ratio of hsp70 mRNA/globin mRNA determined for the control one-cell embryos, treatment of one-cell embryos with cycloheximide did not inhibit the increase in this ratio; indeed, it resulted in an apparent increase in the ratio in the resulting twocell embryos (Fig. 8). DISCUSSION

Results reported here provide further evidence that protein phosphorylation catalyzed by PK-A is involved in transcriptional activation at the two-cell stage and demonstrate for the first time developmental changes in the relative amount of hsp’70 mRNA during oocyte

VOLUME

144. 1991

maturation and early embryogenesis. In addition, our results suggest that protein synthesis is not required for transcriptional activation, which is consistent with the involvement of post-translation modifications in transcriptional activation. A previous study that used Northern analysis showed that mRNA for the constitutive form of hsp70 is detected in two-cell embryos but not in ovulated mouse eggs, while the inducible form of hsp70 mRNA is not detected in two-cell embryos (Hahnel et al., 1986). We show that RT-PCR, which is more sensitive than Northern analysis, detects the presence of the constitutive form of hsp70 mRNA in two-cell embryos, as well as in eggs and oocytes. The presence of this mRNA in the oocyte was anticipated, since oocytes synthesize the constitutive form of hsp70 (Curci et cd, 1987). Although the synthesis of some proteins increases during oocyte maturation, e.g., plasminogen activator (Huarte et aL, 1985, 1987), the absolute rate of protein synthesis decreases during oocyte maturation (Schultz et al., 1979) and this is paralleled by the initiation of degradation of maternal RNA (Bachvarova and DeLeon, 1980; Paynton et aC, 1988). In many instances a decrease in polyadenylation is accompanied by both a decrease in translation and mRNA degradation, e.g., (Ytubulin (Paynton et al, 1988) and actin (Paynton et al.,

l-Cell

2-Cell

26eil+

CHX

FIG. 8. Effect of cycloheximide on the changes in the relative ratio of hsp’lO/globin mRNA during transcriptional activation. RNA from 20 embryos was subjected to RT-PCR as described under Materials and Methods. The ratio of the number of cpm in the hsp70 diagnostic fragment to that in the ol-globin fragment in the two-cell embryo was taken as 100% and the ratios obtained from embryos at other stages of maturation were compared to this. RNA was obtained from one-cell embryos collected 28 hr post-hCG. RNA was obtained from two-cell control or cycloheximide-treated embryos about 8 hr after cleavage to the two-cell stage. The experiment was performed two times and qualitatively similar changes were observed each time. The data have been pooled and are expressed as the mean f range.

MANEJWALA, LOGAN, AND SCHULTZ

hsp70 mRNA

1988; Bachvarova et ah, 1989; Taylor and Piko, 1990). Results reported here suggest that the amount of hsp70 mRNA decreases during oocyte maturation. The amount of this mRNA apparently increases between the one- and two-cell stages and this coincides with the onset of transcriptional activation. In contrast, the degradation of several mRNAs that is initiated during oocyte maturation continues in the two-cell embryo. A caveat to this interpretation is that reverse transcription was primed with oligo(dT). Although the general trend for oocyte mRNAs examined to date is that deadenylation is accompanied by mRNA degradation, it is possible that a dramatic shortening of the poly(A) tail results in the apparent decrease in hsp70 mRNA observed during oocyte maturation and that readenylation during early embryogenesis is responsible for the observed increase.l This possibility is unlikely for the following reasons. Northern analysis, which is independent of the length of the poly(A) tail, reveals that (1) an increase in the amount of hsp70 mRNA occurs between the egg and two-cell stage (Hahnel et al., 1986) and (2) both a-amanitin and H-8 inhibit the increase in the amount of hsp70 mRNA that occurs between the oneand two-cell stages (Manejwala and Schultz, unpublished observations). These observations and the observation, as determined by RT-PCR, that both a-amanitin and H-8 inhibit the increase in the relative amount of hsp70 mRNA that occurs between the one- and two-cell stages suggest that de novo synthesis rather than readenylation of existing hsp70 mRNA is responsible for the increase. The results reported here provide further evidence that protein phosphorylation of maternally derived proteins is implicated in transcriptional activation. H-8, but not H-7, inhibits the increase in the relative amount of hsp70 mRNA that occurs between the one- and twocell stages to a similar extent as ol-amanitin, and addition of cycloheximide to one-cell embryos late in G2 does not inhibit this increase. The level at which protein phosphorylation regulates transcriptional activation, however, is not known. RNA polymerase II (Cadena and Damus, 1987; Payne et ab, 1989) and transcription factors are modulated by phosphorylation (e.g., CREB; Lamph et al., 1990; Berk, 1989 and references therein) and could be potential targets for either direct or indirect action of PK-A. In addition, changes in nuclear structure that are regulated by phosphorylation could be involved in transcriptional activation. For example, the requirement for enhancers to activate transcription 1 Attempts to analyze the amount of hsp70 mRNA during oocyte maturation using random hexamer priming, which should detect the mRNA independent of the length of its poly(A) tail, were not successful for reasons that are not understood (Manejwala and Schultz, unpublished observations).

in Mouse

and Embryos

Oocytes

307

of microinjected genes in the two-cell mouse embryo may depend on some component of nuclear structure (Martinez-Salas et al, 1989). Inhibiting protein synthesis with cycloheximide results in an apparent increase in the amount of hsp70 mRNA relative to that in untreated embryos. Stabilization of mRNAs in the absence of protein synthesis is a general phenomenon (e.g., histone mRNA, Stimac et ah, 1984) and hsp70 mRNA in the mouse embryo is apparently another example. It is possible that the stabilizing effect elicited by cycloheximide, which inhibits elongation, is due to protection of polysome-associated mRNA. However, inhibiting protein synthesis with either cycloheximide or pactamycin, which prevents initiation and hence inhibits polysome formation, stabilizes the inducible human hsp70 mRNA (Theodorakis and Morimoto, 1987). Additional experiments that identify other proteins that are products of zygotic gene activation and the effect of protein kinase inhibitors on accumulation of their corresponding mRNAs between the one- and twocell stages should provide further evidence for a role of protein phosphorylation in transcriptional activation in the mouse embryo. This research was supported by grants from the NIH (HD 22681 and HD 21355 to R.M.S.). The authors thank Greg Kopf for critically reading the manuscript. REFERENCES BACHVAROVA, R., COHEN, E. M., DELEON, V., TOKUNAGA, K., SAKIYAMA, S., and PAYNTON, B. V. (1989). Amounts and modulation of actin mRNAs in mouse oocytes and embryos. Development 106, 561-565. BACHVAROVA, R., and DELEON, V. (1980). Polyadenylated RNA of the mouse ova and loss of maternal RNA in early development. Deu. Biol 74, l-8. BACHVAROVA, R., DELEON, V., JOHNSON, A., KAPLAN, G., and PAYNTON, B. V. (1985). Changes in total RNA, polyadenylated RNA, and actin mRNA during meiotic maturation of mouse oocytes. Dev. Biol 108,325-331. BENSAUDE, O., BABINET, C., MORANGE, M., and JACOB, F. (1983). Heat shock proteins, first major products of zygotic gene activity. Nature fLondon) 305,331-333. BERK, A. J. (1989). Regulation of eukaryotic transcription factors by post-translational modification. Biochim. Biuphys. Acta 1009, 103106. BOLTON, V. N., OADES, P. J., and JOHNSON,M. H. (1984). The relationship between cleavage, DNA replication, and gene expression in the mouse 2-cell embryo. J. Embryol Exp. Morphol 79,139-163. BRAUDE, P., PELHAM, H., FLACH, G., and LOBAT~O, R. (1979). Posttranscriptional control in the early mouse embryo. Nature (Londo?z) 282,102-105. BROWER, P. T., GIZANG, E., BOREEN, S. M., and SCHULTZ, R. M. (1981). Biochemical studies of mammalian oogenesis: Synthesis and stability of various classes of RNA during growth of the mouse oocyte in vitro.

Dev. Biol

86, 373-383.

CADENA, D. L., and DAMUS, M. E. (1987). Messenger RNA synthesis in mammalian cells is catalyzed by the phosphorylated form of RNA polymerase II. J. Biol. Chem. 262,12,468-12,474.

308

DEVELOPMENTAL BIOLOGY

CHATOT, C. L., ZIOMEK, C. A., BAVISTER, B. D., LEWIS, J. L., and TORRES, I. (1989). An improved culture medium supports development of random-bred l-cell mouse embryos in vitro. J. Reprod Fertil. 86, 679-688. CHENG, J.-F., RAID, L., and HARDISON, R. C. (1986). Isolation and nucleotide sequence of the rabbit globin gene cluster #{-‘-al-&~. Absence of a pair of a-globin genes evolving in concert. J. Biol. Chem. 261,839-848. CURCI,A., BEVILACQUA, A., and MANGIA, F. (1987). Lack of heat-shock response in preovulatory mouse oocytes. Dev. BioL 123,154-160. DELEON, V., JOHNSON,A., and BACHVAROVA, R. (1983). Half-lives and relative amounts of stored and polysomal ribosomes and poly(A)+ RNA in mouse oocytes. Dev. Biol. 98,400-408. ENDO, Y., SCHULTZ, R. M., and KOPF, G. S. (1987). Effects of phorbol esters and a diacylglycerol on mouse eggs: Inhibition of fertilization and modification of the zona pellucida. Dev. BioL 119,199-209. FLACH, G., JOHNSON, M. H., BRAUDE, P. R., TAYLOR, R. A. S., and BOLTON, V. N. (1982). The transition from maternal to embryonic control in the 2-cell mouse embryo. EMBO J. 1,681-686. GIEBEL, L. B., DWORNICZAK, B. P., and BAUT~, E. K. F. (1988). Developmental regulation of a constitutively expressed mouse mRNA encoding a 72-kDa heat shock-like protein. Dev. BioL 125,200-207. GIEBELHAUS, D. H., HEIKKILA, J. J., and SCHULTZ, G. A. (1983). Changes in the quantity of histone and actin mRNA during the development of preimplantation mouse embryos. Dev. BioL 98,148154. GRAVES, R. A., MARZLUFF, W. F., GIEBELHAUS, D. H., and SCHULTZ, G. A. (1985). Qualitative and quantitative changes in histone gene expression during early mouse embryo development. Proc. Natl. Acad

Sci. USA 82,5685-5689.

HAHNEL, A. C., GIFFORD, D. J., HEIKKILA, J. J., and SCHULTZ, G. A. (1986). Expression of the major heat shock protein (hsp 70) family during early mouse embryo development. Teratogen. Carcinogen. Mutagen. 6,493-510. HIDAKA, H., INAGAKI, M., KAWAMOTO, S., and SASAKI, Y. (1984). Isoquinolinesulfonamides, novel and potent inhibitors of cyclic nucleotide dependent protein kinase and protein kinase C. Biochemistry 23,5036-5041. HO~LET~, S. K. (1986a). A set of proteins showing cell cycle dependent modification in the early mouse embryo. Cell 45,387-396. HOWLETT, S. K. (198613). The effect of inhibiting DNA replication in the one-cell mouse embryo. Roux’s Arch. Dev. Biol. 195,499-505. HOWLETT, S. K., and BOLTON, V. N. (1985). Sequence and regulation of morphological and molecular events during the first cell cycle of mouse embryogenesis. J. EmlnyoL Exp. MorphoL 87,175-206. HUARTE, J., BELIN, D., and VASSALLI, J.-D. (1985). Plasminogen activator in mouse and rat oocytes: Induction during meiotic maturation. Cell 43,551-558. HUARTE, J., BELIN, D., VASSALLI, A., STRICKLAND, S., and VASSALLI, J.-D. (1987). Meiotic maturation of mouse oocytes triggers the translation and polyadenylation of dormant tissue-type plasminogen activator mRNA. Genes Dev. 1,1201-1211. LAMPH, W. W., DWARKI, V. J., OFIR, R., MONTMINY, M., and VERMA, I. M. (1990). Negative and positive regulation of transcription factor CAMP response element binding protein is modulated by phosphorylation. Proc. Natl. Acad Sci. USA 87,4320-4324. MANWALA, F. M., and SCHULTZ, R. M. (1989). Blastocoel formation in the mouse preimplantation mouse embryo: Stimulation of sodium uptake by CAMP and role of CAMP-dependent protein kinase. Dev. BioL 136,560-563. MARTINEZ-SALAS, E., LINNEY, E., HASSELL, J., and DEPAMPHILIS, M. L. (1989). The need for enhancers in gene expression first appears during mouse development with the formation of the zygotic nucleus. Genes Dev. 3,1493-1506.

VOLUME 144. 1991

PAYNE, J. M., LAYBOURN, P. J., and DAHMUS, M. E. (1989). The transition of RNA polymerase II from initiation to elongation is associated with phosphorylation of the carboxyl-terminal domain of subunit IIa. J. Biol. Chem. 264,19,621-19,629. PAYNTON, B. V., REMPEL, R., and BACHVAROVA, R. (1988). Changes in state of adenylation and time course of degradation of maternal mRNAs during oocyte maturation and early embryonic development in the mouse. Dev. BioL 129,304-314. PETZOLDT, U. (1984). Regulation of stage-specific gene expression during early mouse development: Effect of cytochalasin B and aphidicolin on stage-specific protein synthesis in mouse eggs. Cell &&er. 15,163-167. PETZOLDT, U., and MUGGLETON-HARRIS, A. (1987). The effect of the nucleocytoplasmic ratio on protein synthesis and expression of stage-specific antigen in early cleaving mouse embryos. Development 99,481-491. PHILPOIT, C. C., RINGUEITE, M. J., and DEAN, J. (1987). Oocyte-specific expression and developmental regulation of ZP3, the sperm receptor of mouse zona pellucida. Dev. BioL 121,568-575. POUEYMIROU, W. T., and SCHULTZ, R. M. (1987). Differential effects of activators of CAMP-dependent protein kinase and protein kinase C on cleavage of one-cell mouse embryos and protein synthesis and phosphorylation in one- and two-cell embryos. Dev. Biol. 121,489498. POUEYMIROU, W. T., and SCHULTZ, R. M. (1989). Regulation of the mouse preimplantation development: Inhibition of synthesis of proteins in the two-cell embryo that require transcription by inhibitors of CAMP-dependent protein kinase. Dev. BioL 133,588-599. ROLLER, R. J., KINLOCH, R. A., HIRAOKA, B. Y., LI, S. S.-L., and WASSARMAN, P. M. (1989). Gene expression during mammalian oogenesis and early embryogenesis: Quantification of three messenger RNAs abundant in fully grown mouse oocytes. Develojmnent 106, 251-261. SAMBROOK, J., FRITSCH, E. F., and MANIATIS, T. (1989). “Molecular Cloning. A Laboratory Manual,” 2nd ed., Vol. 1, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. SAWICKI, J. A., MAGNUSON, T., and EPSTEIN, C. J. (1982). Evidence for the expression of the paternal genome in the two-cell mouse embryo. Nature (London) 294,450-451. SCHULTZ, R. M., LETOURNEAU, G. E., and WASSARMAN, P. M. (1979). Program of early development in the mammal: Changes in the patterns and absolute rates of synthesis of tubulin and total protein during oogenesis and early embryogenesis in the mouse. Dew. BioL 68,341-369. SCHULTZ, R. M., MONTGOMERY, R. R., and BELANOFF, J. R. (1983). Regnlation of mouse oocyte maturation: Implication of a decrease in oocyte CAMP and protein dephosphorylation in commitment to resume meiosis. Dev. BioL 97,264-273. STIMAC, E., GROPPI, V. E., and COFFINO,P. (1984). Inhibition of protein synthesis stabilizes histone mRNA. MoL Cell. BioL 4,2082-2090. TAYLOR, K. D., and PIKO, L. (1990). Quantitative changes in cytoskeletal p- and y-a&in mRNAs and apparent absence of sarcomeric actin gene transcripts in early mouse embryos. Mol. Reprod. De-v. 26, lll121. THEODORAKIS, N. G., and MORIMOTO, R. I. (1987). Post-transcriptional regulation of hsp70 expression in human cells: Effects of heat shock, inhibition of protein synthesis, and adenovirus infections on translation and mRNA stability. MoL CelL BioL 7,4357-4368. VAN BLERKOM, J. (1981). Structural relationship and post-translational modification of stage-specific proteins synthesized during early preimplantation development in the mouse. Proc. NutL Acad Sci. USA 78,7629-7633.

WASSARMAN, P. M., and LETOURNEAU, G. E. (1976). RNA synthesis in fully grown mouse oocytes. Nature (London) 261,73-74.