Transfusion Medicine
|
SHORT COMMUNICATION
Red blood cell antigen portrait of self-identified Black donors in Quebec 3 J. Lavoie,1 E. ´ Deschˆenes1 & J. Perreault1 ´ M. St-Louis, 1 J. Constanzo-Yanez,2 C. Ethier, 1
H´ema-Qu´ebec, Research and Development, Quebec City, 2 H´ema-Qu´ebec, Immunohematology Reference Laboratory, Montreal, and Immunohematology Reference Laboratory, Quebec City, Quebec, Canada
3 H´ ema-Qu´ebec,
Received 22 April 2013; accepted for publication 29 December 2013
SUMMARY Objectives: The goal of this study was to establish a red blood cell antigen portrait of self-identified Black donors for the province of Quebec, Canada. Background: The demand for extensively phenotyped red blood cells is on the rise. A good example is the sickle cell patient cohort. To better answer their transfusion needs, H´emaQu´ebec put forward great efforts to increase the recruitment of donors among cultural communities. Materials and Methods: In October 2009, an optional question was added on the record of donation to indicate the donor’s ethnicity. Self-identified Black donors were extensively phenotyped by the Immunohematology Laboratory, whereas the Research and Development team genotyped red blood cell antigens to complete the picture. Results: Approximately 1500 self-identified Black donors have donated blood at least once since the beginning of the programme. Genotyping results predicted rare phenotypes: 18 S−s− (3 U−, 15 U+w ), 15 Js(a+b−), 5 Hy−, 3 Jo(a−), 34 hrB +w /− and 15 hrB −. Conclusion: These Black donors, with or without a rare phenotype, are precious to the patient cohort depending on blood transfusions and to our organisation as the blood provider for the whole province of Quebec.
products in the field of transfusion medicine and human tissue transplantation. To better fulfil its mission towards cultural communities, in 2008, H´ema-Qu´ebec started an important project to engage the Black communities in donating blood to help patients suffering from sickle-cell disease (800 newborns per year, Provincial Ministry of Health). The 2006 Canadian census reported that 188 100 Blacks lived in the province of Quebec (2·5% of total population) and 90% were located in the Greater Montreal area. French-speaking Haitians accounted for approximately 50%, whereas 6% were English-speaking Jamaicans (Tran et al., 2012). To launch its program, H´ema-Qu´ebec made sure to include cultural intermediaries and religious leaders, because for these communities, donating blood would be more appealing if they felt a social responsibility, if they were asked directly or if their donation went to someone in their community or a sickle cell patient (Tran et al., 2012). Blood drives were organised locally where donors met patients in need of transfusion. The goal of this study was to establish the red blood cell phenotype portrait of Black donors recruited since the programme started and, by doing so, identify rare phenotypes to improve our rare donor database.
MATERIALS AND METHODS Donors’ consent
Key words: alloimmunisation, Black donors, compatible blood, cultural communities, phenotyped blood, rare donors. H´ema-Qu´ebec’s mission is to provide adequate quantities of safe, optimal blood components, human tissues and cord blood to meet the needs of all Quebecers and to provide and develop expertise along with specialised and innovative services and
Correspondence: Maryse St-Louis, PhD, Recherche et d´eveloppement, Direction Innovation, H´ema-Qu´ebec, 1070, Avenue des Sciences-de-la-Vie, Qu´ebec, Qu´ebec G1V 5C3, Canada. Tel.: (418) 780-4362 ext. 3254; fax: (418) 780-2091; e-mail: [email protected]
© 2014 The Authors Transfusion Medicine © 2014 British Blood Transfusion Society
The donor’s consent was obtained before donation by authorised personnel when revising the record of donation form where health and behaviour questions are documented. Since October 2009, an optional question was added to this form to classify donors according to their ethnicity. The question reads as follows: Are you Arab, Asian, Aboriginal, White, East Indian (Asia), Latin-American, Black or Other?
Phenotype and genotype analyses A 7-mL blood tube collected in ethylenediamine triacetic acid (EDTA) was retrieved from the production laboratory after qualification analyses were released. Phenotyping was performed First published online 31 January 2014 doi: 10.1111/tme.12101
106 M. St-Louis et al. by approved serological methods using licensed reagents. The following red blood cell antigens were phenotyped: ABO, D, C, Cw , c, E, e, K, Fya , Fyb , Jka , Jkb , S, s and Kpa . For genotyping, DNA was extracted from 200 μL of whole blood using QIAamp DNA Blood Mini kit (Qiagen, Mississauga, Ontario, Canada) or the BioRobot EZ1 Workstation (Qiagen) according to the manufacturers’ instructions. Classic end-point polymerase chain reaction (PCR) procedures were used to genotype the samples. PCR primers are listed in Table 1 along with restriction enzymes needed for polymerase chain reactionrestriction fragment length polymorphism (PCR-RFLP).
Subjects studied For the purpose of this study, a total of 1476 donors who self-identified as ‘Black’ on the record of donation form were selected through Progesa (Mak-system, Paris, France).
RESULTS Phenotype The 1476 subjects studied were phenotyped O+ (R0 R0 or R0 r) at 42·8%, A+ at 22·9%, B+ at 17·9% and AB+ at 7·4%. Nine per cent were D negative. Similar to the US Black population (Reid et al., 2012), the S−s− phenotype had a prevalence of 1·2%, whereas the prevalence of Fy(a−b−) was lower, at 45·7% (Table 2).
Genotype Not all donors were genotyped for every polymorphism listed in Table 1. RHCE position 733, KEL*06/KEL*07, DO*04 (Hy) and DO*05 (Jo(a)) were performed in all 1476 donors. As for the
other polymorphisms, a subset of samples was tested. Table 2 shows the observed frequency in numbers and percentages, whereas Table 3 represents the total allele frequency that includes homozygous and heterozygous samples. In the RH system, a combined analysis of positions 48, 733 and 1006 of the RHCE gene was performed in 179 donors. Fifteen were found homozygous for allele RHCE*01.01 (48G>C, 8·4%). This allele is responsible for the weakening expression of e antigen. Thirty-four individuals were homozygous for allele RHCE*01.20.01 (733C>G, 19·0%). This polymorphism causes a partial expression of c and e, expression of V and VS antigens. The hrB phenotype is also weakened or negative (hrB +w /−). Twelve donors were identified homozygous for RHCE*01.20.02, which combines both polymorphisms 48G>C and 733C>G (6·7%). The resulting phenotype is similar to the RHCE*01.20.01 allele except for the hrB , which is negative (hrB −). Three samples were RHCE*01.20.03 homozygous (1·7%). This allele combines three polymorphisms: 48G>C, 733C>G and 1006G>T. Its predicted phenotype is the same for the c and e antigens (partial expression). The V and hrB antigens are not expressed (V− hrB −) whereas VS is (VS+). No individuals homozygous for allele RHCE*01.20.05 (733C>G and 1006G>T) were observed. However, the allele frequency was 0·6% (two heterozygous). In homozygous status, the phenotype predicts the expression of a partial e antigen, no V and complete VS (V−VS+). In heterozygous samples, the e antigen might also be affected especially when E is present, and the red blood cells will be VS+. RHCE position 697 was tested in a subset of samples showing polymorphisms at positions 48 and 733. The three combined polymorphisms (48G>C, 697C>G and 733C>G) cause the expression of the Crawford antigen (RHCE*01.20.06). Among the 42 samples analysed, no homozygous were found, but six heterozygous were identified.
Table 1. Polymerase chain reaction - sequence specific primers (PCR-SSP) and PCR-RFLP assays used in genotype donors Assay RHCE*ce48C RHCE*ce733G RHCE*ce1006T GYPB*P2 GYPB*NY He ‘N’ KEL*06 KEL*07 DO*01 DO*02 DO*04 DO*05
Type
Forward primer (5 →3 )
Reverse primer (5 →3 )
Restriction enzyme
PCR-RFLP1 PCR-RFLP PCR-SSP Sequencing2
GTTAACTCCATAGACAGGCCAGCAGAG GTATCAGCTTGAGAGCTCGG CTCTTCATTTCAACAAACTCCCCAT CTGTCTTATTGTTCTATTGCTATG4
ACACTGTTGRCTGAATTTCGGTGC CCCCTGTGACCACCCAGCATCCTT GTGATCTCTCCAAGCAGACA CTGTTTCTCTTCTGAGTTTAACTG4
HhaI or ApaI BfaI N/A N/A
PCR-SSP2 PCR-SSP2 PCR-RFLP
AAATTGTGAGCATATCAGCATGG AAATTGTGAGCATATCAGCATTA GATTCAGTCTGTGGTACCAC
ATTTCAGAGGCTAGAATTCCTCTG ATTTCAGAGGCTAGAATTCCTCTG TTCCTGGAGGGCATGGTTGTCACA
N/A N/A MnlI
PCR-SSP3 PCR-SSP3 PCR-RFLP
CAGGAGTTTGGGAACCAGAC CAGGAGTTTGGGAACCAGAC GCAACCACATTCACCATCTG
GTTGACCTCAACTGCAACCAGTT GTTGACCTCAACTGCAACCAGTC GATCCTGAGTGGCCTCAATTT
N/A N/A BsaJI XcmI
N/A, not applicable. 1 Wagner et al. (1998). 2 Storry et al. (2003). 3 Wu et al. (2001). 4 Nucleotide modified from published primers.
Transfusion Medicine, 2014, 24, 105–108
© 2014 The Authors Transfusion Medicine © 2014 British Blood Transfusion Society
Portrait of self-identified Black donors in Quebec
107
Table 2. RH, MNS, FY, KEL and DO genotype frequency observed in our cohort Observed frequency System RH
MNS
FY KEL
DO
Allele name
Predicted phenotype
Number
Per cent
RHCE*01.01 (48G>C)1 RHCE*01.20.01 (733C>G)1 RHCE*01.20.02 (48G>C, 733C>G)1 RHCE*01.20.03 (48G>C, 733C>G, 1006G>T)1 RHCE*01.20.05 (733C>G, 1006G>T)1 RHCE*01.20.06 (48G>C, 697C>G, 733C>G)1 Normal RHCE allele1 GYP.He (P2) GYP.He (NY) GYPB absent GYPB*06.02 FY*01N.01 KEL*06/KEL*06 KEL*06/KEL*07 KEL*07/KEL*07 DO*01/DO*01 DO*01/DO*02 DO*02/DO*02 DO*02.−04 DO*01.−05
Weak e Partial c, partial e, V+VS+ hrB +w /− Partial c, partial e, V+VS+ hrB − Partial c, partial e, V−VS+ hrB − Partial e, V−VS+ Partial c, partial e, Crawford+, VS+ N/A S−s−U+w He+ S−s−U+w He+ S−s−U− He− S+ He+ Fy(a−b−) Js(a+b−) Js(a+b+) Js(a−b+) Do(a+b−) Do(a+b+) Do(a−b+) Hy− Jo(a−)
15/179 34/179 12/179 3/179 0/179 0/42 7/179 13/1476 2/1476 3/1476 3/220 674/1476 15/1476 228/1476 1233/1476 49/751 283/751 419/751 5/1476 3/1476
8·4 19·0 6·7 1·7 0 0 3·9 0·9 0·1 0·2 1·4 45·7 1·0 15·5 83·5 6·5 37·7 55·8 0·3 0·2
1
Homozygous alleles reported only. See Table 3 for the total allele frequency that includes homozygous and heterozygous samples.
In the MNS system, the 18 donors phenotyped S−s− were genotyped. Fifteen were U+w (13 GYPB*P2 and 2 GYPB*NY) and three were U− (GYPB absent). Additional genotyping indicated that all U+w samples (15) were He+ at the DNA level (Storry et al., 2003). The U heterozygosity status of the other donors was not established. However, 220 S+ samples were tested for He and ‘N’, and 3 samples homozygous for GYPB*06.02 were found (allele frequency: 8·4%). As for the KEL system, 15 rare donors were found with predicted phenotype Js(a+b−) (KEL*02.06, 1·0%). The frequency is exactly as published by Reid et al. (2012). Js(a+b+) frequency is slightly less than previously published data (15·5% compared to 19%, Reid et al., 2012). Different polymorphisms were analysed in the DO system. DO*01 and DO*02 were genotyped to provide compatible units for an active patient who presented clinically significant antibodies against Doa as demonstrated by monocyte monolayer assay (MMA). The predicted phenotype Do(a−b+) was found to be 10% higher than previously published data (55·8% vs 45%, Reid et al., 2012) as shown in Table 2. Five Hy− (DO*02.−04) as well as three Jo(a−) (DO*01.−05) were identified.
DISCUSSION The goal of this work was to establish the red blood cell phenotype portrait of Black donors. In the course of this study, rare donors were identified adding value to these analyses. © 2014 The Authors Transfusion Medicine © 2014 British Blood Transfusion Society
The RHCE variant alleles, U−, U+w , Js(a+b−), Hy− and Jo(a−), were observed. In 2010, Vege et al. (2010) reported an RHCE analysis performed on Black blood individuals living in different areas of the United States. Among their 3721 donors, 166 were VS+/VS+ (4·3%). For other alleles, the frequencies varied depending on the geographical region of the donors. A study carried out on Afro-Americans and Afro-Brazilians showed frequencies of 24·7 and 32%, respectively, for the RHCE*01.01 allele compared to 13·4% in our Black donor population (Horn et al., 2011). More investigations were performed in Brazil on the S−s− phenotype. Omoto et al. (2008) looked at samples from the northeast region of the country, whereas Alves Faria et al. (2012) analysed patients from the southwest region. Their sampling was small, but a difference in the type of variant was noticed. In the northeast region, more GYPB*P2 alleles were seen. In 2012, Dr Thierry Peyrard (Paris, France) presented data on African descent patients and donors (Peyrard et al., 2012). Of the 17 S−s− patients, his group showed 13 U− (76%) and 4 U+w (24%). However, in 37 S−s− donors, the frequency was 46% U− (17/37) and 54% U+w (20/37) (equal proportion of GYPB*P2 and GYPB*NY). These numbers are on the opposite side of our spectrum with 16·7% U− and 83·3% U+w . However, a limited number of samples were S−s− in our study (18 in total). Transfusion Medicine, 2014, 24, 105–108
108 M. St-Louis et al. Table 3. RH, MNS, FY, KEL and DO total allele frequency observed in our cohort that includes homozygous and heterozygous samples Allele frequency System RH
MNS
FY KEL DO
Allele name
Number
Per cent
RHCE*01.01 RHCE*01.20.01 RHCE*01.20.02 RHCE*01.20.03 RHCE*01.20.05 RHCE*01.20.06 Normal RHCE allele GYP.He (P2) GYP.He (NY) GYPB absent GYPB*06.02 FY*01N.01 KEL*06 KEL*07 DO*01 DO*02 DO*02. −04 DO*01. −05
60/358 121/358 75/358 30/358 2/358 6/84 70/358 26/29521 4/29521 6/29521 37/4402 1348/2952 258/2952 2694/2952 381/1502 1121/1502 153/2952 123/2952
16.7 33·8 20·9 8·4 0·6 7·1 19·6 0·9 0·1 0·2 8·4 57·8 8·7 91·3 25·4 74·6 5·2 4·2
1 These 2
assays were only run on 18 S−s− samples. This assay was run on 220 S+ samples.
As for the Js(a+b−) predicted phenotype, similar results were obtained by Silvy et al. (2011) on 1021 donors from La Martinique (9/1021, 0·9%).
REFERENCES Alves Faria, M., Lobato Martins, M., Cayres Schmidt, L. & Fernandes da Silva Malta, M.C. (2012) Molecular analysis of the GYPB gene to infer S, s, and U phenotypes in an admixed population of Minas Gerais, Brazil. Revista Brasileira de Hematologia e Hemoterapia, 34, 212–216. Horn, T., Costa, D.C., Flickinger, C., Keller, M.A., Nance, S., Meny, G. & Castilho, L. (2011) Molecular analysis of RHCE variants among American and Brazilian individuals of African origin (abstract). Transfusion, 51 (Suppl), 34A. Omoto, R., Reid, M.E. & Castilho, L. (2008) Molecular analyses of GYPB in African Brazilians. Immunohematology, 24, 148–153. Peyrard, T., Nataf, J., Menanteau, C. et al. (2012) Transfusion challenges in patients with the rare S−s− (MNS: −3, −4) blood
Transfusion Medicine, 2014, 24, 105–108
The goal of this study was achieved. A red blood cell antigen portrait of our Black donor community is now available. Several rare phenotypes were identified improving our rare donor programme. During the course of this study, patients of African ancestry were referred to the Immunohematology Reference Laboratory for extensive workup. Genotype analyses were also performed. The same alleles described in this report were observed along with a few examples of RHCE*ceAR, RHCE*ceMO, RHCE*ceTI and RHCE*ceAG. The recruitment efforts towards cultural communities will continue to facilitate the search of compatible units for these patients.
ACKNOWLEDGMENTS M. S.-L. designed the research study, analysed the data and wrote the paper; J. C.-Y. provided blood samples, ´ provided blood phenotype and revised the manuscript; C. E. samples, phenotype and revised the manuscript; J. L., E. D. and J. P. performed the genotyping assays, analysed the data and revised the manuscript. The authors would like to thank the Immunohematology Reference Laboratory personnel for their tremendous work typing the red blood cell antigens.
CONFLICT OF INTEREST The authors have declared no conflicts of interest.
type: a 15-year experience (abstract). Vox Sanguinis, 103 (Suppl. 1), 22. Reid, M.E., Lomas-Francis, C. & Olsson, M.L. (2012) The Blood Group Antigen FactsBook Series. Elsevier Academic Press, London, UK. Silvy, M., Di Christofaro, J., Beley, S., Papa, K., Rits, M., Richard, P., Chiaroni, J. & Bailly, P. (2011) Identification of RHCE and KEL alleles in large cohorts of Afro-Caribbean and Comorian donors by multiplex SNaPshot and fragment assays: a transfusion support for sickle cell disease patients. British Journal of Haematology, 154, 260–270. Storry, J.R., Reid, M.E., Fetics, S. & Huang, C.-H. (2003) Mutations in GYPB exon 5 drive the S−s− U+var phenotype in persons of African descent: implications for transfusion. Transfusion, 43, 1738–1747. Tran, N.Y.L., Charbonneau, J. & ValderramaBenitez, V. (2012) Blood donation practices,
motivations and beliefs in Montreal’s Black communities: the modern gift under a new light. Ethnicity & Health. DOI: 10.1080/13557858.2012.734279, 1–22. Vege, S., Thomas, N. & Westhoff, C.M. (2010) A screening method to find rare hrB − donors by large-scale screening (abstract). Transfusion, 50 (Suppl), 150A–151A. Wagner, F.F., Gassner, C., M¨uller, T.H., Sch¨onitzer, D., Schunter, F. & Flegel, W.A. (1998) Three molecular structures cause Rhesus category VI phenotypes with distinct immunohematologic features. Blood, 91, 2157–2168. Wu, G.-G., Jin, S.-Z., Deng, Z.-H. & Zhao, T.M. (2001) Polymerase chain reaction with sequence-specific primers-based genotyping of the human Dombrock blood group DO1 and DO2 alleles and the DO gene frequencies in Chinese blood donors. Vox Sanguinis, 81, 49–51.
© 2014 The Authors Transfusion Medicine © 2014 British Blood Transfusion Society
|
SHORT COMMUNICATION
Red blood cell antigen portrait of self-identified Black donors in Quebec 3 J. Lavoie,1 E. ´ Deschˆenes1 & J. Perreault1 ´ M. St-Louis, 1 J. Constanzo-Yanez,2 C. Ethier, 1
H´ema-Qu´ebec, Research and Development, Quebec City, 2 H´ema-Qu´ebec, Immunohematology Reference Laboratory, Montreal, and Immunohematology Reference Laboratory, Quebec City, Quebec, Canada
3 H´ ema-Qu´ebec,
Received 22 April 2013; accepted for publication 29 December 2013
SUMMARY Objectives: The goal of this study was to establish a red blood cell antigen portrait of self-identified Black donors for the province of Quebec, Canada. Background: The demand for extensively phenotyped red blood cells is on the rise. A good example is the sickle cell patient cohort. To better answer their transfusion needs, H´emaQu´ebec put forward great efforts to increase the recruitment of donors among cultural communities. Materials and Methods: In October 2009, an optional question was added on the record of donation to indicate the donor’s ethnicity. Self-identified Black donors were extensively phenotyped by the Immunohematology Laboratory, whereas the Research and Development team genotyped red blood cell antigens to complete the picture. Results: Approximately 1500 self-identified Black donors have donated blood at least once since the beginning of the programme. Genotyping results predicted rare phenotypes: 18 S−s− (3 U−, 15 U+w ), 15 Js(a+b−), 5 Hy−, 3 Jo(a−), 34 hrB +w /− and 15 hrB −. Conclusion: These Black donors, with or without a rare phenotype, are precious to the patient cohort depending on blood transfusions and to our organisation as the blood provider for the whole province of Quebec.
products in the field of transfusion medicine and human tissue transplantation. To better fulfil its mission towards cultural communities, in 2008, H´ema-Qu´ebec started an important project to engage the Black communities in donating blood to help patients suffering from sickle-cell disease (800 newborns per year, Provincial Ministry of Health). The 2006 Canadian census reported that 188 100 Blacks lived in the province of Quebec (2·5% of total population) and 90% were located in the Greater Montreal area. French-speaking Haitians accounted for approximately 50%, whereas 6% were English-speaking Jamaicans (Tran et al., 2012). To launch its program, H´ema-Qu´ebec made sure to include cultural intermediaries and religious leaders, because for these communities, donating blood would be more appealing if they felt a social responsibility, if they were asked directly or if their donation went to someone in their community or a sickle cell patient (Tran et al., 2012). Blood drives were organised locally where donors met patients in need of transfusion. The goal of this study was to establish the red blood cell phenotype portrait of Black donors recruited since the programme started and, by doing so, identify rare phenotypes to improve our rare donor database.
MATERIALS AND METHODS Donors’ consent
Key words: alloimmunisation, Black donors, compatible blood, cultural communities, phenotyped blood, rare donors. H´ema-Qu´ebec’s mission is to provide adequate quantities of safe, optimal blood components, human tissues and cord blood to meet the needs of all Quebecers and to provide and develop expertise along with specialised and innovative services and
Correspondence: Maryse St-Louis, PhD, Recherche et d´eveloppement, Direction Innovation, H´ema-Qu´ebec, 1070, Avenue des Sciences-de-la-Vie, Qu´ebec, Qu´ebec G1V 5C3, Canada. Tel.: (418) 780-4362 ext. 3254; fax: (418) 780-2091; e-mail: [email protected]
© 2014 The Authors Transfusion Medicine © 2014 British Blood Transfusion Society
The donor’s consent was obtained before donation by authorised personnel when revising the record of donation form where health and behaviour questions are documented. Since October 2009, an optional question was added to this form to classify donors according to their ethnicity. The question reads as follows: Are you Arab, Asian, Aboriginal, White, East Indian (Asia), Latin-American, Black or Other?
Phenotype and genotype analyses A 7-mL blood tube collected in ethylenediamine triacetic acid (EDTA) was retrieved from the production laboratory after qualification analyses were released. Phenotyping was performed First published online 31 January 2014 doi: 10.1111/tme.12101
106 M. St-Louis et al. by approved serological methods using licensed reagents. The following red blood cell antigens were phenotyped: ABO, D, C, Cw , c, E, e, K, Fya , Fyb , Jka , Jkb , S, s and Kpa . For genotyping, DNA was extracted from 200 μL of whole blood using QIAamp DNA Blood Mini kit (Qiagen, Mississauga, Ontario, Canada) or the BioRobot EZ1 Workstation (Qiagen) according to the manufacturers’ instructions. Classic end-point polymerase chain reaction (PCR) procedures were used to genotype the samples. PCR primers are listed in Table 1 along with restriction enzymes needed for polymerase chain reactionrestriction fragment length polymorphism (PCR-RFLP).
Subjects studied For the purpose of this study, a total of 1476 donors who self-identified as ‘Black’ on the record of donation form were selected through Progesa (Mak-system, Paris, France).
RESULTS Phenotype The 1476 subjects studied were phenotyped O+ (R0 R0 or R0 r) at 42·8%, A+ at 22·9%, B+ at 17·9% and AB+ at 7·4%. Nine per cent were D negative. Similar to the US Black population (Reid et al., 2012), the S−s− phenotype had a prevalence of 1·2%, whereas the prevalence of Fy(a−b−) was lower, at 45·7% (Table 2).
Genotype Not all donors were genotyped for every polymorphism listed in Table 1. RHCE position 733, KEL*06/KEL*07, DO*04 (Hy) and DO*05 (Jo(a)) were performed in all 1476 donors. As for the
other polymorphisms, a subset of samples was tested. Table 2 shows the observed frequency in numbers and percentages, whereas Table 3 represents the total allele frequency that includes homozygous and heterozygous samples. In the RH system, a combined analysis of positions 48, 733 and 1006 of the RHCE gene was performed in 179 donors. Fifteen were found homozygous for allele RHCE*01.01 (48G>C, 8·4%). This allele is responsible for the weakening expression of e antigen. Thirty-four individuals were homozygous for allele RHCE*01.20.01 (733C>G, 19·0%). This polymorphism causes a partial expression of c and e, expression of V and VS antigens. The hrB phenotype is also weakened or negative (hrB +w /−). Twelve donors were identified homozygous for RHCE*01.20.02, which combines both polymorphisms 48G>C and 733C>G (6·7%). The resulting phenotype is similar to the RHCE*01.20.01 allele except for the hrB , which is negative (hrB −). Three samples were RHCE*01.20.03 homozygous (1·7%). This allele combines three polymorphisms: 48G>C, 733C>G and 1006G>T. Its predicted phenotype is the same for the c and e antigens (partial expression). The V and hrB antigens are not expressed (V− hrB −) whereas VS is (VS+). No individuals homozygous for allele RHCE*01.20.05 (733C>G and 1006G>T) were observed. However, the allele frequency was 0·6% (two heterozygous). In homozygous status, the phenotype predicts the expression of a partial e antigen, no V and complete VS (V−VS+). In heterozygous samples, the e antigen might also be affected especially when E is present, and the red blood cells will be VS+. RHCE position 697 was tested in a subset of samples showing polymorphisms at positions 48 and 733. The three combined polymorphisms (48G>C, 697C>G and 733C>G) cause the expression of the Crawford antigen (RHCE*01.20.06). Among the 42 samples analysed, no homozygous were found, but six heterozygous were identified.
Table 1. Polymerase chain reaction - sequence specific primers (PCR-SSP) and PCR-RFLP assays used in genotype donors Assay RHCE*ce48C RHCE*ce733G RHCE*ce1006T GYPB*P2 GYPB*NY He ‘N’ KEL*06 KEL*07 DO*01 DO*02 DO*04 DO*05
Type
Forward primer (5 →3 )
Reverse primer (5 →3 )
Restriction enzyme
PCR-RFLP1 PCR-RFLP PCR-SSP Sequencing2
GTTAACTCCATAGACAGGCCAGCAGAG GTATCAGCTTGAGAGCTCGG CTCTTCATTTCAACAAACTCCCCAT CTGTCTTATTGTTCTATTGCTATG4
ACACTGTTGRCTGAATTTCGGTGC CCCCTGTGACCACCCAGCATCCTT GTGATCTCTCCAAGCAGACA CTGTTTCTCTTCTGAGTTTAACTG4
HhaI or ApaI BfaI N/A N/A
PCR-SSP2 PCR-SSP2 PCR-RFLP
AAATTGTGAGCATATCAGCATGG AAATTGTGAGCATATCAGCATTA GATTCAGTCTGTGGTACCAC
ATTTCAGAGGCTAGAATTCCTCTG ATTTCAGAGGCTAGAATTCCTCTG TTCCTGGAGGGCATGGTTGTCACA
N/A N/A MnlI
PCR-SSP3 PCR-SSP3 PCR-RFLP
CAGGAGTTTGGGAACCAGAC CAGGAGTTTGGGAACCAGAC GCAACCACATTCACCATCTG
GTTGACCTCAACTGCAACCAGTT GTTGACCTCAACTGCAACCAGTC GATCCTGAGTGGCCTCAATTT
N/A N/A BsaJI XcmI
N/A, not applicable. 1 Wagner et al. (1998). 2 Storry et al. (2003). 3 Wu et al. (2001). 4 Nucleotide modified from published primers.
Transfusion Medicine, 2014, 24, 105–108
© 2014 The Authors Transfusion Medicine © 2014 British Blood Transfusion Society
Portrait of self-identified Black donors in Quebec
107
Table 2. RH, MNS, FY, KEL and DO genotype frequency observed in our cohort Observed frequency System RH
MNS
FY KEL
DO
Allele name
Predicted phenotype
Number
Per cent
RHCE*01.01 (48G>C)1 RHCE*01.20.01 (733C>G)1 RHCE*01.20.02 (48G>C, 733C>G)1 RHCE*01.20.03 (48G>C, 733C>G, 1006G>T)1 RHCE*01.20.05 (733C>G, 1006G>T)1 RHCE*01.20.06 (48G>C, 697C>G, 733C>G)1 Normal RHCE allele1 GYP.He (P2) GYP.He (NY) GYPB absent GYPB*06.02 FY*01N.01 KEL*06/KEL*06 KEL*06/KEL*07 KEL*07/KEL*07 DO*01/DO*01 DO*01/DO*02 DO*02/DO*02 DO*02.−04 DO*01.−05
Weak e Partial c, partial e, V+VS+ hrB +w /− Partial c, partial e, V+VS+ hrB − Partial c, partial e, V−VS+ hrB − Partial e, V−VS+ Partial c, partial e, Crawford+, VS+ N/A S−s−U+w He+ S−s−U+w He+ S−s−U− He− S+ He+ Fy(a−b−) Js(a+b−) Js(a+b+) Js(a−b+) Do(a+b−) Do(a+b+) Do(a−b+) Hy− Jo(a−)
15/179 34/179 12/179 3/179 0/179 0/42 7/179 13/1476 2/1476 3/1476 3/220 674/1476 15/1476 228/1476 1233/1476 49/751 283/751 419/751 5/1476 3/1476
8·4 19·0 6·7 1·7 0 0 3·9 0·9 0·1 0·2 1·4 45·7 1·0 15·5 83·5 6·5 37·7 55·8 0·3 0·2
1
Homozygous alleles reported only. See Table 3 for the total allele frequency that includes homozygous and heterozygous samples.
In the MNS system, the 18 donors phenotyped S−s− were genotyped. Fifteen were U+w (13 GYPB*P2 and 2 GYPB*NY) and three were U− (GYPB absent). Additional genotyping indicated that all U+w samples (15) were He+ at the DNA level (Storry et al., 2003). The U heterozygosity status of the other donors was not established. However, 220 S+ samples were tested for He and ‘N’, and 3 samples homozygous for GYPB*06.02 were found (allele frequency: 8·4%). As for the KEL system, 15 rare donors were found with predicted phenotype Js(a+b−) (KEL*02.06, 1·0%). The frequency is exactly as published by Reid et al. (2012). Js(a+b+) frequency is slightly less than previously published data (15·5% compared to 19%, Reid et al., 2012). Different polymorphisms were analysed in the DO system. DO*01 and DO*02 were genotyped to provide compatible units for an active patient who presented clinically significant antibodies against Doa as demonstrated by monocyte monolayer assay (MMA). The predicted phenotype Do(a−b+) was found to be 10% higher than previously published data (55·8% vs 45%, Reid et al., 2012) as shown in Table 2. Five Hy− (DO*02.−04) as well as three Jo(a−) (DO*01.−05) were identified.
DISCUSSION The goal of this work was to establish the red blood cell phenotype portrait of Black donors. In the course of this study, rare donors were identified adding value to these analyses. © 2014 The Authors Transfusion Medicine © 2014 British Blood Transfusion Society
The RHCE variant alleles, U−, U+w , Js(a+b−), Hy− and Jo(a−), were observed. In 2010, Vege et al. (2010) reported an RHCE analysis performed on Black blood individuals living in different areas of the United States. Among their 3721 donors, 166 were VS+/VS+ (4·3%). For other alleles, the frequencies varied depending on the geographical region of the donors. A study carried out on Afro-Americans and Afro-Brazilians showed frequencies of 24·7 and 32%, respectively, for the RHCE*01.01 allele compared to 13·4% in our Black donor population (Horn et al., 2011). More investigations were performed in Brazil on the S−s− phenotype. Omoto et al. (2008) looked at samples from the northeast region of the country, whereas Alves Faria et al. (2012) analysed patients from the southwest region. Their sampling was small, but a difference in the type of variant was noticed. In the northeast region, more GYPB*P2 alleles were seen. In 2012, Dr Thierry Peyrard (Paris, France) presented data on African descent patients and donors (Peyrard et al., 2012). Of the 17 S−s− patients, his group showed 13 U− (76%) and 4 U+w (24%). However, in 37 S−s− donors, the frequency was 46% U− (17/37) and 54% U+w (20/37) (equal proportion of GYPB*P2 and GYPB*NY). These numbers are on the opposite side of our spectrum with 16·7% U− and 83·3% U+w . However, a limited number of samples were S−s− in our study (18 in total). Transfusion Medicine, 2014, 24, 105–108
108 M. St-Louis et al. Table 3. RH, MNS, FY, KEL and DO total allele frequency observed in our cohort that includes homozygous and heterozygous samples Allele frequency System RH
MNS
FY KEL DO
Allele name
Number
Per cent
RHCE*01.01 RHCE*01.20.01 RHCE*01.20.02 RHCE*01.20.03 RHCE*01.20.05 RHCE*01.20.06 Normal RHCE allele GYP.He (P2) GYP.He (NY) GYPB absent GYPB*06.02 FY*01N.01 KEL*06 KEL*07 DO*01 DO*02 DO*02. −04 DO*01. −05
60/358 121/358 75/358 30/358 2/358 6/84 70/358 26/29521 4/29521 6/29521 37/4402 1348/2952 258/2952 2694/2952 381/1502 1121/1502 153/2952 123/2952
16.7 33·8 20·9 8·4 0·6 7·1 19·6 0·9 0·1 0·2 8·4 57·8 8·7 91·3 25·4 74·6 5·2 4·2
1 These 2
assays were only run on 18 S−s− samples. This assay was run on 220 S+ samples.
As for the Js(a+b−) predicted phenotype, similar results were obtained by Silvy et al. (2011) on 1021 donors from La Martinique (9/1021, 0·9%).
REFERENCES Alves Faria, M., Lobato Martins, M., Cayres Schmidt, L. & Fernandes da Silva Malta, M.C. (2012) Molecular analysis of the GYPB gene to infer S, s, and U phenotypes in an admixed population of Minas Gerais, Brazil. Revista Brasileira de Hematologia e Hemoterapia, 34, 212–216. Horn, T., Costa, D.C., Flickinger, C., Keller, M.A., Nance, S., Meny, G. & Castilho, L. (2011) Molecular analysis of RHCE variants among American and Brazilian individuals of African origin (abstract). Transfusion, 51 (Suppl), 34A. Omoto, R., Reid, M.E. & Castilho, L. (2008) Molecular analyses of GYPB in African Brazilians. Immunohematology, 24, 148–153. Peyrard, T., Nataf, J., Menanteau, C. et al. (2012) Transfusion challenges in patients with the rare S−s− (MNS: −3, −4) blood
Transfusion Medicine, 2014, 24, 105–108
The goal of this study was achieved. A red blood cell antigen portrait of our Black donor community is now available. Several rare phenotypes were identified improving our rare donor programme. During the course of this study, patients of African ancestry were referred to the Immunohematology Reference Laboratory for extensive workup. Genotype analyses were also performed. The same alleles described in this report were observed along with a few examples of RHCE*ceAR, RHCE*ceMO, RHCE*ceTI and RHCE*ceAG. The recruitment efforts towards cultural communities will continue to facilitate the search of compatible units for these patients.
ACKNOWLEDGMENTS M. S.-L. designed the research study, analysed the data and wrote the paper; J. C.-Y. provided blood samples, ´ provided blood phenotype and revised the manuscript; C. E. samples, phenotype and revised the manuscript; J. L., E. D. and J. P. performed the genotyping assays, analysed the data and revised the manuscript. The authors would like to thank the Immunohematology Reference Laboratory personnel for their tremendous work typing the red blood cell antigens.
CONFLICT OF INTEREST The authors have declared no conflicts of interest.
type: a 15-year experience (abstract). Vox Sanguinis, 103 (Suppl. 1), 22. Reid, M.E., Lomas-Francis, C. & Olsson, M.L. (2012) The Blood Group Antigen FactsBook Series. Elsevier Academic Press, London, UK. Silvy, M., Di Christofaro, J., Beley, S., Papa, K., Rits, M., Richard, P., Chiaroni, J. & Bailly, P. (2011) Identification of RHCE and KEL alleles in large cohorts of Afro-Caribbean and Comorian donors by multiplex SNaPshot and fragment assays: a transfusion support for sickle cell disease patients. British Journal of Haematology, 154, 260–270. Storry, J.R., Reid, M.E., Fetics, S. & Huang, C.-H. (2003) Mutations in GYPB exon 5 drive the S−s− U+var phenotype in persons of African descent: implications for transfusion. Transfusion, 43, 1738–1747. Tran, N.Y.L., Charbonneau, J. & ValderramaBenitez, V. (2012) Blood donation practices,
motivations and beliefs in Montreal’s Black communities: the modern gift under a new light. Ethnicity & Health. DOI: 10.1080/13557858.2012.734279, 1–22. Vege, S., Thomas, N. & Westhoff, C.M. (2010) A screening method to find rare hrB − donors by large-scale screening (abstract). Transfusion, 50 (Suppl), 150A–151A. Wagner, F.F., Gassner, C., M¨uller, T.H., Sch¨onitzer, D., Schunter, F. & Flegel, W.A. (1998) Three molecular structures cause Rhesus category VI phenotypes with distinct immunohematologic features. Blood, 91, 2157–2168. Wu, G.-G., Jin, S.-Z., Deng, Z.-H. & Zhao, T.M. (2001) Polymerase chain reaction with sequence-specific primers-based genotyping of the human Dombrock blood group DO1 and DO2 alleles and the DO gene frequencies in Chinese blood donors. Vox Sanguinis, 81, 49–51.
© 2014 The Authors Transfusion Medicine © 2014 British Blood Transfusion Society
