Virus Genes DOI 10.1007/s11262-013-1011-2
Recombinant influenza A H3N2 viruses with mutations of HA transmembrane cysteines exhibited altered virological characteristics Jianqiang Zhou • Shun Xu • Jun Ma • Wen Lei • Kang Liu • Qiliang Liu • Yida Ren Chunyi Xue • Yongchang Cao
•
Received: 2 September 2013 / Accepted: 6 November 2013 Ó Springer Science+Business Media New York 2013
Abstract Influenza A H3N2 virus as the cause of 1968 pandemic has since been circulating in human and swine. Our earlier study has shown that mutations of one or two cysteines in the transmembrane domain of H3 hemagglutinin (HA) affected the thermal stability and fusion activity of recombinant HA proteins. Here, we report the successful generation of three recombinant H3N2 mutant viruses (C540S, C544L, and 2C/SL) with mutations of one or two transmembrane cysteines of HA in the background of A/swine/Guangdong/01/98 [H3N2] using reverse genetics, indicating that the mutated cysteines were not essential for virus assembly and growth. Further characterization revealed that recombinant H3N2 mutant viruses exhibited larger plaque sizes, increased growth rate in cells, enhanced fusion activity, reduced thermal and acidic resistances, and increased virulence in embryonated eggs. These results demonstrated that the transmembrane cysteines (C540 and C544) in H3 HA have profound effects on the virological features of H3N2 viruses. Keywords Influenza virus Hemagglutinin Transmembrane domain Cysteine Reverse genetics
Electronic supplementary material The online version of this article (doi:10.1007/s11262-013-1011-2) contains supplementary material, which is available to authorized users. J. Zhou S. Xu J. Ma W. Lei K. Liu Q. Liu Y. Ren C. Xue Y. Cao (&) State Key Laboratory of Biocontrol, Life Sciences School, Guangzhou Higher Education Mega Center, Sun Yat-sen University, Guangzhou 510006, People’s Republic of China e-mail: [email protected]
Introduction In the twentieth century, there were three influenza pandemics caused by influenza A viruses, including the 1918 H1N1 virus, the 1957 H2N2 virus, and the 1968 H3N2 virus [1–3]. Since 1968, H3N2 virus has caused the global persistence of influenza virus circulating in human and swine population [4–6]. Influenza A viruses contain eight segments of single-stranded, negative-sense RNA that encode for more than 11 proteins [7, 8] including hemagglutinin (HA). The HA gene is a genetic determinant of pathogenicity, whose introduction and adaptation from an animal host to humans contributed to these pandemics. HA is a spike glycoprotein present on the viral membrane and recognized as the major surface antigen. HA initiates viral infection by binding to sialylated cell surface receptors, undergoes endocytosis, and mediates the fusion of the viral and endosomal membranes, allowing viral RNAs to enter the cytoplasm [9, 10]. HA is present as a homotrimer, and each monomer contains a long ectodomain, a transmembrane (TM) domain, and a short cytoplasmic domain. HA monomer is synthesized as a single polypeptide, HA0, and cleaved into the disulfide-linked polypeptides, HA1 and HA2 [11–13]. Previous studies have indicated that HA TM domain plays roles in viral entry, HA-mediated membrane fusion, and HA apical sorting [14, 15]. When HA TM domain was substituted with a glycosylphosphatidylinositol (GPI) anchor, the expressed GPI-anchored HA in cells could support only hemifusion to target membranes at low pH [15, 16], implying a role for the TM domain in transitioning membrane hemifusion to full fusion. When the TM domain was replaced by the TM domain of the fusogenic glycoprotein F of Sendai virus, the fusion activity of the chimeric protein was not altered [17]. On the other hand, a
123
Virus Genes
mutational study demonstrated a stringent TM domain length requirement for supporting full membrane fusion [18], strongly suggesting that the TM domain needed to span both inner and outer leaflets to fulfill its function. In addition, it has been found that the residues within HA TM domain are important for raft association as sequence substitutions in the TM domain ablated HA association with rafts (nonraft HA) [19]. HA protein of H3N2 virus among 16 subtypes of influenza A viruses is the only one containing two cysteine residues (C540 and C544) in its TM domain [20–22]. Our earlier study has shown that mutations of one or two of these two cysteines affected the thermal stability and fusion activity of recombinant H3 HA proteins [20]. The enticing and necessary question was what effects of the incorporation of these recombinant mutant HAs would be on the recombinant H3N2 viruses. In this study, we generated three recombinant H3N2 mutant viruses (wildtype, C540S, C544L, and 2C/SL) carrying mutations of one or two TM cysteines (C540 and C544) in the HA TM domain and one wildtype (WT) recombinant H3N2 virus in the background of A/swine/Guangdong/01/98 [H3N2] using reverse genetics. The results showed that the mutations affected various characteristics of the recombinant H3N2 viruses including growth rate, fusion activity, thermal and acidic resistances, and infectivity and virulence in embryonated eggs.
Materials and methods Cells and viruses Human embryonic kidney cells (293T) and MDCK cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM; Invitrogen) supplemented with 10 % fetal bovine serum (FBS; Invitrogen), GlutaMAX (200 mM; Invitrogen), penicillin (100 units/ml), and streptomycin (100 lg/ml) in an atmosphere of 5 % CO2 at 37 °C. The H3N2 strain (A/swine/Guangdong/01/98 [H3N2]) was isolated in Guangdong province, China in 1998; the nucleotide sequences are available from GenBank under accession numbers FJ830852.1–FJ830859.1. The handling of experiments with live viruses was conducted in a biosafety 2 plus facility under the guidelines issued by China authority. Plasmids and constructs The eight genome-sense (pHH21) plasmids (a gift from Y. Kawaoka, University of Wisconsin-Madison) and four protein-expressing (pcDNA3.0) plasmids used to generate
123
influenza virus by reverse genetics have been described previously [23–25]. For rescue of recombinant H3N2 viruses, eight genome-sense plasmids together with expression plasmids encoding the RNP complex (pcDNA– PB1, pcDNA–PB2, pcDNA–PA, and pcDNA–NP) were transfected into 293T cells using Lipofectamine2000 (Invitrogen). The transfected cell culture supernatant was collected at 48–60 h post-transfection and used to passage onto MDCK cells or 10-days-old embryonated chicken eggs for the propagation of the recombinant viruses. Virus production was monitored by hemagglutination titer. To generate pHH21 encoding the mutant HAs (C540S, C544L, and 2C/SL), the pHH21 vector encoding WT HA was subjected to site-directed mutagenesis using the Stratagene Quick-Change mutagenesis kit (Stratagene, La Jolla, CA, USA). Primers used in the generation of these constructs were as follows: 50 GATTTCCTTTGCCAT AT CAAGCTTTTTGCTTTGTGTTG30 [forward (fo)] and 50 CAACACAAAGCAA AAAGCTTGATATGGCAAAG GAAATC30 [reverse (re)] for exchange of cysteine at position 540; 50 CATATCATGCTTTTTGCTTCTTGTTG TTTTGCTGGGGTTC30 (fo) and 50 GAACCCCAGCAAA ACAACAAGAAGCAAAAAGCATGATATG30 (re) for exchange of cysteine at position 544; 50 CATATCAAGCT TTTTGCTTCTTGTT GTTTTGCTGGGGTTC30 (fo) and 50 GAACCCCAGCAAAACAACAAGAAGCA AAAAGC TTGATATG30 (re) for exchange of cysteines at position 540 and 544 (the mutation sites are indicated by the underlined characters). The recombinant mutant viruses were generated as described above and the entire genome of the recombinant viruses was confirmed by sequencing.
Virus growth and plaque assay MDCK cells were grown in 24-well plates and inoculated in triplicate with viruses at a multiplicity of infection (MOI) of 0.001 per well in phosphate-buffered saline (PBS) containing 0.2 % BSA for 1 h. Unbound viruses were washed away, and 0.5 ml serum-free medium containing 0.2 % BSA and 2 lg/ml TPCK-trypsin was added to each well. The supernatants were collected every 12 h until 72 h post-infection. The viral titers in the supernatants were determined by plaque assay on MDCK cells. For plaque assays, MDCK cells in 6-well plates were infected with serial tenfold dilutions of the recovered viruses for 1 h at 37 °C. After washing, the media in the dish were then replaced with MEM-1 % agarose containing 2 lg/ml of trypsin. Plaques were formed by incubation for 3 days at 37 °C. Cells were stained with 0.01 % neutral red and the formed plaques were photographed.
Virus Genes
Virus purification, immunoblotting, and electron microscopy The WT and mutant viruses were propagated in embryonated eggs and purified by centrifugation on 20–60 % sucrose density gradients [26]. Purified virions were boiled for 5 min at 100 °C in the loading buffer (50 mM Tris, 100 mM dithiothreitol, 2 % SDS, 0.1 % bromophenol blue, and 10 % glycerol). And viral proteins were separated by 10 % SDS polyacrylamide gel electrophoresis. After that proteins were transferred to polyvinylidene fluoride membrane (Millipore, Billerica, MA). Membranes were blocked in 3 % BSA and then incubated with mouse sera against virus A/swine/GD/ 01/98 (1:3,000) for 2 h, followed by incubation with horseradish peroxidase-conjugated secondary antibody for 1 h. Proteins were detected with the commercial ECL kit (Pierce). The intensity of each band was quantified using GeneTools software (SynGene). The procedure of the negative staining of purified virions was done as described [27]. In brief, purified recombinant viruses were attached onto parlodion-coated nickel grids for 2 min. And the virions were stained by the phosphotungstic acid buffer for 2 min. The shape of the viruses was photographed by the JEOL JEM-100 CX-II electron microscope.
(RBC) (2 % RBC concentration) on ice for 10 min. Then the pH was lowered from 5.8 to 4.6 by addition of the sodium citrate buffer. After incubation at room temperature for 30 min, the chicken RBC were removed by centrifugation (3,000 rpm for 3 min) and supernatants were transferred to an ELISA plate for determination of NADPH content by optical density measurement (340 nm) with a Bio-Tek (Bio-Tek Instruments, Inc., Winooski, VT, USA) ELISA plate reader. NADPH was present in the supernatant as a function of fusion-induced red blood cell lysis. Baseline NADPH activity values were derived from samples without viruses that underwent identical treatment. Characterization of recombinant viruses in embryonated chicken eggs According to the standard protocol [29], 9 or 10-days-old specific-pathogen-free (SPF) embryonated eggs were inoculated with a series of tenfold dilution of recombinant virus stocks, respectively. All recombinant virus stocks had a titer of 5 9 106 pfu per ml. The dilutions of 100, 10-1, 10-2, 10-3, and 10-4 for assaying 50 % egg lethal doses (ELD50). And the samples of every dilution were tested for the infection rate and mortality in the following 5 days. Values of ELD50 were calculated by the Reed–Muench method [30].
Virus resistance assays HA receptor-binding assay in MDCK cells In the thermal resistance assay, the viruses with the same HA titers were incubated at a temperature ranging from 48 to 60 °C for 30 min in a Peltier Gradient Thermal Cycler (BioRad, Richmond, CA); then the HA titers were measured. In the acidic resistance assay, the viruses with the same PFUs were incubated in an acidic buffer (10 mM HEPES, 10 mM MES in PBS) at pH 7.4, 5.2, or 5.0 at 37 °C for 30 min; then the solutions were adjusted to pH 7.0; then MDCK cells were infected with the recombinant viruses in 24-well plates at a MOI of 2; mock-infected wells were negative controls. After 30 min of adsorption at 37 °C, cells were washed three times with PBS and replaced with the serum-free medium containing 2 lg/ml TPCK-trypsin. The infected plates were fixed with 4 % paraformaldehyde at 5 h post-infection for 15 min at room temperature and permeabilized with 0.2 % Triton X-100 in PBS for 15 min followed by staining using the FITC-labeled mAb against NP (Abcam, Cambridge, UK). Images were observed under the Zeiss Observer Z1 inverted fluorescence microscope. Virus–cell fusion assay The virus–cell fusion assay has been described [28]. In brief, the WT and mutant viruses were standardized to HA 256 units and incubated with chicken red blood cells
As previously described [31, 32], HA receptor-binding affinity of recombinant viruses was determined using MDCK cells. MDCK cells in 24-well plates were inoculated with the four recombinant viruses at a MOI of 1.0 for 30 min. The infected cells were washed three times with PBS and incubated at 33 °C for 6 h with the medium containing 1 lg/ml TPCK-trypsin. The inoculated plates were then fixed with 1 % paraformaldehyde, permeabilized with 0.2 % Triton X-100 in PBS, and stained with anti-NP monoclonal antibodies. The cell images were captured by the Zeiss Observer Z1 inverted fluorescence microscope and the percentage of infected cells was analyzed by the Image-Pro Plus software (Media Cybernetics, Silver Springs, MD, USA). Ethics statement The viruses propagation studies in embryonated eggs were approved by the Institutional Animal Care and Use Committee of Sun Yat-sen University and the Institutional Animal Ethics Committee of Sun Yat-sen University (Permit Number: IACUC-2012-0701). Research was conducted in compliance with guidelines of the Ordinance on Laboratory Animals Management set by the State Scientific and Technological Commission of China.
123
Virus Genes Fig. 1 Schematic diagram of WT and mutant HAs. The nomenclature of the recombinant viruses is shown on the left
Statistical analysis Data are presented as mean ± SEM from at least three independent experiments. All statistical analysis was done using OriginPro 8 SR3 (Origin Lab Corp.). The differences between groups were determined by the Student’s t test with two-tailed t test when only two groups were compared. When more than two groups were compared, they were analyzed by one-way analysis of variance (ANOVA). Differences were considered statistically significant at P \ 0.05.
Results Generation of recombinant WT and mutant influenza H3N2 viruses (C540S, C544L, and 2C/SL) Our earlier study has demonstrated that the two cysteines (C540 and C544) in H3 HA TM domain affected the thermal stability and fusion activity of H3 HA proteins [20]. Since serine (S) at position 540 and leucine (L) at position 544 are common in most of the subtypes including H1, H5, and H9, the two cysteines (C540 and C544) in the H3 HA TM were mutated into serine or leucine individually (C540S and C544L) or in combination (2C/SL) (Fig. 1). The eight genomic segments from A/swine/ Guangdong/01/98 (H3N2) were cloned and the HA was mutated using site-directed mutagenesis. To facilitate the recovery of mutant viruses, we used a well-characterized reverse genetics system in which 293T cells and MDCK cells were co-cultured and transfected with eight genomeencoding plasmids and four protein (PB1, PB2, PA, and NP)-expressing plasmids [24, 33]. The authenticity of the recombinant viruses was confirmed by sequencing all genome segments (data not shown). The generated recombinant viruses showed the typical phenotype of influenza viruses with surface spikes under electron microscope (Fig. 2a). As showed in Fig. 2c, the recombinant viruses produced the plaques with different sizes; the cysteines mutant viruses formed larger plaques than the WT virus, especially the C540S and 2C/SL mutants. The results taken together indicated that the mutations
123
introduced into the TM domain did not impede the assembly and propagation of recombinant H3N2 viruses. Cysteine mutations did not significantly alter the viral protein compositions of virions The four recombinant H3N2 viruses (WT, C540S, C544L, and 2C/SL) were propagated in embryonated eggs and purified. The viral proteins of all four purified virions were separated on reduced SDS-PAGE gel, and the separated proteins were blotted by the sera from whole inactivated H3N2 virus-immunized mice (Fig. 2b). The results showed that HA1, HA2, NP, and M1 proteins were present and their individual expression levels were comparable in all four recombinant viruses (Fig. S1), demonstrating that the mutations of cysteines in H3 HA TM did not significantly alter the viral protein compositions of the virions. Recombinant mutant viruses (C540S, C544L, and 2C/SL) had increased growth rate We next analyzed the growth rate of four recombinant viruses by infecting MDCK cells with viruses at a low multiplicity of infection (MOI of 0.001) and measured the titers of plaque-forming units (pfu) at 0, 12, 24, 36, 48, 60, and 72 h after infection. The results showed that the pfu titers of all three recombinant mutant viruses were higher than that of the recombinant WT virus (Fig. 3). In particular, the pfu titers of C540S, C544L, and 2C/SL mutant viruses at 48 h were significantly higher than that of WT virus (P \ 0.05), while the pfu titer of C544L mutant virus at 48 h was lower than that of C540S and 2C/SL mutant viruses but higher than that of WT virus (about twofold increase) at the 48 h post-infection. In summary, C540S, C544L, and 2C/SL recombinant viruses showed increased growth rates in MDCK cells. Recombinant mutant viruses showed increased fusion activity We next investigated the fusion activities of all four recombinant viruses using virus-induced erythrocyte
Virus Genes Fig. 2 Verification of the recombinant viruses. a Negatively stained purified influenza virions. Images are at 980,000 (Bar 200 nm.). b Western blot analysis of SDSPAGE separated viral polypeptides. Blots were probed with antiserum for A/swine/GD/ 98. The recombinant viruses were grown in embryonated eggs and purified through sucrose gradients. c Plaque phenotypes of recombinant viruses. MDCK cell monolayers were inoculated with viruses and subsequently covered with an agarose-containing medium overlay. After 3 days of incubation, plaques were visualized by staining with neutral red
Fig. 3 Growth curves of recombinant H3N2 viruses. Monolayers of MDCK cells were inoculated at a MOI of 0.001. The amount of infectious viruses in the supernatants harvested at the indicated times was determined by plaque assay. Error bars represent the standard deviation from triplicate experiments. *on WT means P \ 0.05, compared with all mutant viruses
hemolysis assay [28]. When all four recombinant viruses were subjected to the virus-induced erythrocyte hemolysis assay at a pH range of 4.6, 4.8, 5.0, 5.2, 5.4, 5.6 and 5.8, the mutant viruses (C540S, C544L, and 2C/SL) showed significant higher fusion activity than that of WT virus in the pH range from 4.6 to 5.0 (P \ 0.01) (Fig. 4). The data
indicated that there was no difference in the HA activation pH between the mutants and WT virus; instead, the difference was the extent of membrane fusion. These results were in line with our earlier study [20], validating the usefulness of using recombinant HA proteins to study the HA functions.
123
Virus Genes Fig. 4 Fusion activities of recombinant H3N2 viruses. Fusion activity was measured by the red blood cell fusion assay. Viruses standardized to 256 HA units were mixed with 2 % chicken red blood cells and then the buffer was replaced with the acidic buffer which varied between 4.6 and 5.8. The hemolysis representing the fusion activity was expressed as the optical density at 340 nm (OD340) minus the baseline NADPH value obtained from no virus treatment condition. Error bars represent the standard deviation from triplicate experiments. At pH 4.6, 4.8, 5.0, **P \ 0.01, compared with all mutant viruses
Fig. 5 Thermal resistance of recombinant H3N2 viruses. For four recombinant viruses, the preparations which had originally 256 HA units were incubated at indicated temperatures for 30 min in the thermal cycler. And their HA titers were measured by hemagglutination. *P \ 0.05, compared with all mutant viruses
Recombinant mutant viruses exhibited reduced thermal and acidic resistances We then used the thermal resistance assay [34] to examine the thermal resistance of recombinant viruses at the temperature range of 48, 50, 52, 54, 56, 58, and 60 °C. The temperature range was chosen after our preliminary studies showed that all four recombinant viruses had similar thermal resistance below 50 °C and retained no HA titers
123
over 60 °C. All four recombinant viruses with the same HA titers were incubated at the designated temperatures for 30 min, and their HA titers were measured after cooling to room temperature. The results showed that all four recombinant viruses started to lose their HA titers from 50 °C, and gradually to completely lose their HA titers at 60 °C (Fig. 5). More importantly, the three recombinant mutant viruses (C540S, C544L, and 2C/SL) lost significantly more HA titers than the WT recombinant virus at 56 and 58 °C (P \ 0.05), indicating that the recombinant mutant viruses had reduced thermal resistances (Fig. 5). We also examined whether the treatment with acidic solutions prior to infections would affect the infectivity of the recombinant viruses. All four recombinant viruses with the same PFUs were treated with a buffer of pH 5.0, 5.2, and 7.4 at 37 °C for 30 min; and then their infectivity was tested by infecting MDCK cells. In the pH range tested, pH 5.0 distinguished the WT recombinant virus from all three recombinant mutant viruses, where only the WT recombinant virus retained partial infectivity while all other three completely lost their infectivity (Fig. 6). In summary, the mutations of either one or both of the two TM cysteines rendered the recombinant mutant viruses with reduced thermal and acidic resistances. All recombinant viruses shared similar receptor-binding affinity We then investigated whether the mutations of the TM cysteines would affect the receptor-binding affinity of the recombinant viruses. For assaying the receptor-binding
Virus Genes Fig. 6 Acidic resistance of recombinant H3N2 viruses. Virus samples were incubated with MES buffer at indicated pH values for 30 min. And then samples were returned to neutral pH (7.4) prior to infection at MOI = 2. The cells were processed for immunofluorescence staining after 5 h of incubation at 37 °C
Fig. 7 HA receptor-binding affinity of recombinant viruses. The recombinant viruses were adsorbed to MDCK cells at a MOI of 1.0 for 30 min, washed three times with PBS. The cells were then
processed for immunofluorescence staining after 6 h of incubation at 37 °C. The percentage of infected cells (mean ± standard deviation) indicated in each image is an average of six images
affinity, MDCK cells were infected at an MOI of 1.0 with viruses and immuno-stained with anti-NP monoclonal antibodies after 6 h [31, 32]. The receptor-binding affinities were presented by the percentage of the infected cells. The results showed that all four recombinant viruses had similar receptor-binding affinities (Fig. 7).
constructed cannot also infect mice; thus we examined the pathogenicity of recombinant viruses in SPF embryonated chicken eggs by ELD50 assays [35]. The WT, C540S, C544L, and 2C/SL viruses had the mean titers of ELD50 -1.5, -3, -2.33, and -2.5, respectively (Table 1). The results showed that all recombinant mutant viruses (C540S, C544L, and 2C/SL) exhibited enhanced virulence, indicating that the two cysteines in the TM domain are involved in regulating the virulence of H3N2 influenza viruses.
Recombinant mutant viruses manifested higher ELD50 titers than recombinant WT virus We next examined whether the cysteine mutations affected the pathogenicity of recombinant mutant viruses. The mouse model has been widely used for assaying the pathogenicity of influenza A viruses. However, our preliminary studies showed that the H3N2 strain used in our study was poor in infecting mice and the mutants viruses we
Discussion This study attempted to investigate the relationship of H3 HA TM domain structure and the biological functions of
123
Virus Genes Table 1 Pathogenicity of recombinant H3N2 viruses in eggs Virus
Log10 ELD50
rH3N2/A/swine/GD/01/98-HA-WT
-1.5
rH3N2/A/swine/GD/01/98-HA-C540S
-3
rH3N2/A/swine/GD/01/98-HA-C544L
-2.33
rH3N2/A/swine/GD/01/98-HA-2C/SL
-2.5
recombinant H3N2 viruses. More specifically, we generated by reverse genetics four recombinant H3N2 viruses, of which three contained a H3 HA with mutation of one or two TM cysteines (C540S, C544L, and 2C/SL); all four recombinant H3N2 viruses showed the similar viral composition, indicating that these two TM cysteines were not indispensable for the assembly and propagation of H3N2 viruses. Our results showed that while all four recombinant H3N2 viruses had similar receptor-binding affinity, the three recombinant mutant viruses manifested different biological characteristics than the recombinant WT virus, including different plaque sizes, higher growth rate, increased fusion activity, reduced thermal and acidic resistances, and increased EID50 and ELD50 titers. During membrane fusion, HA forms a helical structure consisting of its TM and fusion peptide at the end of the molecule [36]. For influenza virus HA, a TM domain with ]17 amino acids was able to efficiently promote full fusion in all HAs [18]. Previous work indicated that addition of palmitic acid to cysteines, which are highly conserved among the 16 HA subtypes, located in the TM domain boundary region may regulate the membrane fusion [37–40]. Our study for the first time provided direct evidence showing that the TM cysteines (C540 and C544) contributed to the regulation of fusion activity of H3N2 viruses, reaffirming previous studies on HA molecules [17, 18]. Takeda et al. [19] had studied the effects of the TM amino acids of HA on the growth of H3N2 viruses in detail by alanine scanning mutagenesis. They showed that HA mutants 530–532 and 533–535 had a slower growth rate and a titer of about 3 logs lower than WT virus [19]. Interestingly, the HA mutant 539–541 was the only one showing higher growth rate than WT virus. This strongly corroborated our results showing that C540S mutant virus had the higher growth rate than WT virus (Fig. 3), because the mutant 539–541 in Takeda et al. [19] had the C540 residue changed to alanine. In addition, the positions of the amino acids in the TM might affect their contributions to the growth rate. In Takeda et al. [19], different mutants had different growth rates. Our results also supported this point by showing that C540S and C544L mutants had different growth rates. Furthermore, the reasons for the increased growth rates for C540S, C544L, and 2C/SL mutant H3N2
123
viruses might be their increased fusion activity. A number of previous studies reported that the elevated fusion activity could enhance the virus growth [41–44]. In the present study, the growth rates of the mutant H3N2 viruses were correlated with their fusion activities (Figs. 3, 4). This adds another support for the relationship between the virus growth rate and their fusion activity. Previous studies have demonstrated that the conformational changes of HA proteins might affect the thermal resistances of influenza viruses [34, 45], and that elevated pH for membrane fusion could change the stability of the viruses [42, 44–46]. The results in our study showed that the recombinant WT H3N2 viruses were more resistant to elevated temperature exposure or acidic treatment than the mutant viruses (Figs. 5, 6), indicating that the TM cysteines might contribute to the conformational stability of H3 HA proteins in H3N2 viruses. In addition, for the paramyxoviruses, the fusion protein activation involves cytoplasmic tails signaling to the ectodomain [47, 48] and TM domain can affect ectodomain stability [49–51]. The HA TM domain can probably modulate the membrane fusion by the inside-out signaling. Our results provided a plausible explanation for the previous studies showing that the TM domain of the H3N2 strain A/X-31 exhibited a strong potential for the stable oligomers [52, 53] and more tightly associated within trimers [54]. The recombinant mutant H3N2 viruses exhibited increased infectivity and virulence in the embryonated eggs; this is to the best of our knowledge the first time a study showing that mutations of one or two TM cysteines in the H3 HA could increase the infectivity and virulence of H3N2 viruses. These results should not be surprising since these recombinant mutants H3N2 viruses have been shown to have increased growth rate and fusion activity. Even though we made a strong case for arguing that there is a causal relationship between the increased infectivity and virulence and the increased growth rate and fusion activity, further studies are needed to establish such a relationship. In summary, our results have demonstrated that mutations of one or two cysteines in the TM domain of H3 HA protein could alter many characteristics of recombinant mutant H3N2 viruses including plaque size, increased growth rate, fusion activity, reduced thermal and acidic resistances. This study has important practical applications, for example, the recombinant mutant H3N2 viruses with increased growth rate could be developed to improve H3N2 influenza vaccine production. Furthermore, it would be interesting to know whether an insertion of the corresponding TM cysteines into the TM domains of other subtype HA proteins could decrease the infectivity and virulence of the resultant recombinant viruses; for example, if the infectivity and virulence of H5N1 viruses could be reduced by such insertions in their HA proteins, it might
Virus Genes
facilitate the development of vaccines against H5N1 viruses. Acknowledgments This work was supported by grants from the State Key Laboratory of Biocontrol at Sun Yat-sen University. We thank George D. Liu for critical review and revision of the manuscript and Professor A.D. Osterhaus of Erasmus University Medical Center, Rotterdam and Professor Y. Kawaoka of University of WisconsinMadison for offering the plasmids.
References 1. K. Stohr, Lancet Infect. Dis 2, 517 (2002) 2. M.R. Sandbulte, K.B. Westgeest, J. Gao, X. Xu, A.I. Klimov, C.A. Russell, D.F. Burke, D.J. Smith, R.A. Fouchier, M.C. Eichelberger, Proc. Natl. Acad. Sci. USA 108, 20748–20753 (2011) 3. J.C. Krause, T. Tsibane, T.M. Tumpey, C.J. Huffman, R. Albrecht, D.L. Blum, I. Ramos, A. Fernandez-Sesma, K.M. Edwards, A. Garcia-Sastre, C.F. Basler, J.E. Crowe Jr, J. Virol. 86, 6334–6340 (2012) 4. C.A. Russell, T.C. Jones, I.G. Barr, N.J. Cox, R.J. Garten, V. Gregory, I.D. Gust, A.W. Hampson, A.J. Hay, A.C. Hurt, J.C. de Jong, A. Kelso, A.I. Klimov, T. Kageyama, N. Komadina, A.S. Lapedes, Y.P. Lin, A. Mosterin, M. Obuchi, T. Odagiri, A.D. Osterhaus, G.F. Rimmelzwaan, M.W. Shaw, E. Skepner, K. Stohr, M. Tashiro, R.A. Fouchier, D.J. Smith, Science 320, 340–346 (2008) 5. J. Bahl, M.I. Nelson, K.H. Chan, R. Chen, D. Vijaykrishna, R.A. Halpin, T.B. Stockwell, X. Lin, D.E. Wentworth, E. Ghedin, Y. Guan, J.S. Peiris, S. Riley, A. Rambaut, E.C. Holmes, G.J. Smith, Proc. Natl. Acad. Sci. USA 108, 19359–19364 (2011) 6. R.J. Garten, C.T. Davis, C.A. Russell, B. Shu, S. Lindstrom, A. Balish, W.M. Sessions, X. Xu, E. Skepner, V. Deyde, M. OkomoAdhiambo, L. Gubareva, J. Barnes, C.B. Smith, S.L. Emery, M.J. Hillman, P. Rivailler, J. Smagala, M. de Graaf, D.F. Burke, R.A. Fouchier, C. Pappas, C.M. Alpuche-Aranda, H. Lopez-Gatell, H. Olivera, I. Lopez, C.A. Myers, D. Faix, P.J. Blair, C. Yu, K.M. Keene, P.D. Dotson Jr, D. Boxrud, A.R. Sambol, S.H. Abid, K. St George, T. Bannerman, A.L. Moore, D.J. Stringer, P. Blevins, G.J. Demmler-Harrison, M. Ginsberg, P. Kriner, S. Waterman, S. Smole, H.F. Guevara, E.A. Belongia, P.A. Clark, S.T. Beatrice, R. Donis, J. Katz, L. Finelli, C.B. Bridges, M. Shaw, D.B. Jernigan, T.M. Uyeki, D.J. Smith, A.I. Klimov, N.J. Cox, Science 325, 197–201 (2009) 7. R.A. Lamb, R.M. Krug, in Fields Virology, 4th edn., ed. by D.M. Knipe, P.M. Howley (Lippincott Williams & Wilkins, Philadelphia, 2001), pp. 1487–1532 8. M.L. Grantham, W.H. Wu, E.N. Lalime, M.E. Lorenzo, S.L. Klein, A. Pekosz, J. Virol. 83, 8655–8661 (2009) 9. J.J. Skehel, D.C. Wiley, Annu. Rev. Biochem. 69, 531–569 (2000) 10. H.D. Klenk, R. Rott, Adv. Virus Res. 34, 247–281 (1988) 11. E.J. Schrauwen, T.M. Bestebroer, V.J. Munster, E. de Wit, S. Herfst, G.F. Rimmelzwaan, A.D. Osterhaus, R.A. Fouchier, J. Gen. Virol. 92, 1410–1415 (2011) 12. E.J. Schrauwen, S. Herfst, L.M. Leijten, P. van Run, T.M. Bestebroer, M. Linster, R. Bodewes, J.H. Kreijtz, G.F. Rimmelzwaan, A.D. Osterhaus, R.A. Fouchier, T. Kuiken, D. van Riel, J. Virol. 86, 3975–3984 (2012) 13. W.H. Wu, A. Pekosz, J. Virol. 82, 1059–1063 (2008) 14. P. Scheiffele, M.G. Roth, K. Simons, EMBO J. 16, 5501–5508 (1997)
15. G.W. Kemble, T. Danieli, J.M. White, Cell 76, 383–391 (1994) 16. G.B. Melikyan, J.M. White, F.S. Cohen, J. Cell Biol. 131, 679–691 (1995) 17. B. Schroth-Diez, E. Ponimaskin, H. Reverey, M.F. Schmidt, A. Herrmann, J. Virol. 72, 133–141 (1998) 18. R.T. Armstrong, A.S. Kushnir, J.M. White, J. Cell Biol. 151, 425–437 (2000) 19. M. Takeda, G.P. Leser, C.J. Russell, R.A. Lamb, Proc. Natl. Acad. Sci. USA 100, 14610–14617 (2003) 20. S. Xu, J. Zhou, K. Liu, Q. Liu, C. Xue, X. Li, J. Zheng, D. Luo, Y. Cao, Virus Genes 47, 20–26 (2013) 21. E. Nobusawa, T. Aoyama, H. Kato, Y. Suzuki, Y. Tateno, K. Nakajima, Virology 182, 475–485 (1991) 22. R.D. Tall, M.A. Alonso, M.G. Roth, Traffic 4, 838–849 (2003) 23. G. Neumann, T. Watanabe, H. Ito, S. Watanabe, H. Goto, P. Gao, M. Hughes, D.R. Perez, R. Donis, E. Hoffmann, G. Hobom, Y. Kawaoka, Proc. Natl. Acad. Sci. USA 96, 9345–9350 (1999) 24. E. Fodor, L. Devenish, O.G. Engelhardt, P. Palese, G.G. Brownlee, A. Garcia-Sastre, J. Virol. 73, 9679–9682 (1999) 25. E. Hoffmann, G. Neumann, G. Hobom, R.G. Webster, Y. Kawaoka, Virology 267, 310–317 (2000) 26. H. Jin, K. Subbarao, S. Bagai, G.P. Leser, B.R. Murphy, R.A. Lamb, J. Virol. 70, 1406–1414 (1996) 27. H. Jin, G.P. Leser, J. Zhang, R.A. Lamb, EMBO J 16, 1236–1247 (1997) 28. T.T. Wang, G.S. Tan, R. Hai, N. Pica, E. Petersen, T.M. Moran, P. Palese, PLoS Pathog. 6, e1000796 (2010) 29. D.E. Swayne, D.A. Halvorson, Influenza in Diseases of Poultry, 11th edn. (Iowa State Press, Iowa City, 2003) 30. A.K. Thakur, W.L. Fezio, Drug Chem. Toxicol. 4, 297–305 (1981) 31. B. Lu, H. Zhou, D. Ye, G. Kemble, H. Jin, J. Virol. 79, 6763–6771 (2005) 32. B. Lu, H. Zhou, W. Chan, G. Kemble, H. Jin, Vaccine 24, 6691–6693 (2006) 33. E. Hoffmann, G. Neumann, Y. Kawaoka, G. Hobom, R.G. Webster, Proc. Natl. Acad. Sci. USA 97, 6108–6113 (2000) 34. A. Farnsworth, T.D. Cyr, C. Li, J. Wang, X. Li, Vaccine 29, 1529–1533 (2011) 35. H. Sun, P. Jiao, B. Jia, C. Xu, L. Wei, F. Shan, K. Luo, C. Xin, K. Zhang, M. Liao, Vet. Microbiol. 152, 258–265 (2011) 36. Z.N. Li, B.J. Lee, W.A. Langley, K.C. Bradley, R.J. Russell, D.A. Steinhauer, J. Virol. 82, 6337–6348 (2008) 37. L.V. Kordyukova, M.V. Serebryakova, L.A. Baratova, M. Veit, J. Virol. 82, 9288–9292 (2008) 38. B.J. Chen, M. Takeda, R.A. Lamb, J. Virol. 79, 13673–13684 (2005) 39. R. Wagner, A. Herwig, N. Azzouz, H.D. Klenk, J. Virol. 79, 6449–6458 (2005) 40. T. Sakai, R. Ohuchi, M. Ohuchi, J. Virol. 76, 4603–4611 (2002) 41. S. Murakami, T. Horimoto, M. Ito, R. Takano, H. Katsura, M. Shimojima, Y. Kawaoka, J. Virol. 86, 1405–1410 (2012) 42. M.L. Reed, H.L. Yen, R.M. DuBois, O.A. Bridges, R. Salomon, R.G. Webster, C.J. Russell, J. Virol. 83, 3568–3580 (2009) 43. M.L. Reed, O.A. Bridges, P. Seiler, J.K. Kim, H.L. Yen, R. Salomon, E.A. Govorkova, R.G. Webster, C.J. Russell, J. Virol. 84, 1527–1535 (2010) 44. Y.P. Lin, S.A. Wharton, J. Martin, J.J. Skehel, D.C. Wiley, D.A. Steinhauer, Virology 233, 402–410 (1997) 45. B.M. Krenn, A. Egorov, E. Romanovskaya-Romanko, M. Wolschek, S. Nakowitsch, T. Ruthsatz, B. Kiefmann, A. Morokutti, J. Humer, J. Geiler, J. Cinatl, M. Michaelis, N. Wressnigg, S. Sturlan, B. Ferko, O.V. Batishchev, A.V. Indenbom, R. Zhu, M. Kastner, P. Hinterdorfer, O. Kiselev, T. Muster, J. Romanova, PLoS One 6, e18577 (2011)
123
Virus Genes 46. R.S. Daniels, J.C. Downie, A.J. Hay, M. Knossow, J.J. Skehel, M.L. Wang, D.C. Wiley, Cell 40, 431–439 (1985) 47. D.L. Waning, C.J. Russell, T.S. Jardetzky, R.A. Lamb, Proc. Natl. Acad. Sci. USA 101, 9217–9222 (2004) 48. D.L. Waning, A.P. Schmitt, G.P. Leser, R.A. Lamb, J. Virol. 76, 9284–9297 (2002) 49. S. Seth, A.L. Goodman, R.W. Compans, J. Virol. 78, 8513–8523 (2004) 50. M. Li, Z.N. Li, Q. Yao, C. Yang, D.A. Steinhauer, R.W. Compans, J. Virol. 80, 6106–6114 (2006)
123
51. M.L. Bissonnette, J.E. Donald, W.F. DeGrado, T.S. Jardetzky, R.A. Lamb, J. Mol. Biol. 386, 14–36 (2009) 52. S.A. Tatulian, L.K. Tamm, Biochemistry 39, 496–507 (2000) 53. L. Godley, J. Pfeifer, D. Steinhauer, B. Ely, G. Shaw, R. Kaufmann, E. Suchanek, C. Pabo, J.J. Skehel, D.C. Wiley et al., Cell 68, 635–645 (1992) 54. L.V. Kordyukova, M.V. Serebryakova, A.A. Polyansky, E.A. Kropotkina, A.V. Alexeevski, M. Veit, R.G. Efremov, I.Y. Filippova, L.A. Baratova, Biochim. Biophys. Acta 1808, 1843–1854 (2011)
Recombinant influenza A H3N2 viruses with mutations of HA transmembrane cysteines exhibited altered virological characteristics Jianqiang Zhou • Shun Xu • Jun Ma • Wen Lei • Kang Liu • Qiliang Liu • Yida Ren Chunyi Xue • Yongchang Cao
•
Received: 2 September 2013 / Accepted: 6 November 2013 Ó Springer Science+Business Media New York 2013
Abstract Influenza A H3N2 virus as the cause of 1968 pandemic has since been circulating in human and swine. Our earlier study has shown that mutations of one or two cysteines in the transmembrane domain of H3 hemagglutinin (HA) affected the thermal stability and fusion activity of recombinant HA proteins. Here, we report the successful generation of three recombinant H3N2 mutant viruses (C540S, C544L, and 2C/SL) with mutations of one or two transmembrane cysteines of HA in the background of A/swine/Guangdong/01/98 [H3N2] using reverse genetics, indicating that the mutated cysteines were not essential for virus assembly and growth. Further characterization revealed that recombinant H3N2 mutant viruses exhibited larger plaque sizes, increased growth rate in cells, enhanced fusion activity, reduced thermal and acidic resistances, and increased virulence in embryonated eggs. These results demonstrated that the transmembrane cysteines (C540 and C544) in H3 HA have profound effects on the virological features of H3N2 viruses. Keywords Influenza virus Hemagglutinin Transmembrane domain Cysteine Reverse genetics
Electronic supplementary material The online version of this article (doi:10.1007/s11262-013-1011-2) contains supplementary material, which is available to authorized users. J. Zhou S. Xu J. Ma W. Lei K. Liu Q. Liu Y. Ren C. Xue Y. Cao (&) State Key Laboratory of Biocontrol, Life Sciences School, Guangzhou Higher Education Mega Center, Sun Yat-sen University, Guangzhou 510006, People’s Republic of China e-mail: [email protected]
Introduction In the twentieth century, there were three influenza pandemics caused by influenza A viruses, including the 1918 H1N1 virus, the 1957 H2N2 virus, and the 1968 H3N2 virus [1–3]. Since 1968, H3N2 virus has caused the global persistence of influenza virus circulating in human and swine population [4–6]. Influenza A viruses contain eight segments of single-stranded, negative-sense RNA that encode for more than 11 proteins [7, 8] including hemagglutinin (HA). The HA gene is a genetic determinant of pathogenicity, whose introduction and adaptation from an animal host to humans contributed to these pandemics. HA is a spike glycoprotein present on the viral membrane and recognized as the major surface antigen. HA initiates viral infection by binding to sialylated cell surface receptors, undergoes endocytosis, and mediates the fusion of the viral and endosomal membranes, allowing viral RNAs to enter the cytoplasm [9, 10]. HA is present as a homotrimer, and each monomer contains a long ectodomain, a transmembrane (TM) domain, and a short cytoplasmic domain. HA monomer is synthesized as a single polypeptide, HA0, and cleaved into the disulfide-linked polypeptides, HA1 and HA2 [11–13]. Previous studies have indicated that HA TM domain plays roles in viral entry, HA-mediated membrane fusion, and HA apical sorting [14, 15]. When HA TM domain was substituted with a glycosylphosphatidylinositol (GPI) anchor, the expressed GPI-anchored HA in cells could support only hemifusion to target membranes at low pH [15, 16], implying a role for the TM domain in transitioning membrane hemifusion to full fusion. When the TM domain was replaced by the TM domain of the fusogenic glycoprotein F of Sendai virus, the fusion activity of the chimeric protein was not altered [17]. On the other hand, a
123
Virus Genes
mutational study demonstrated a stringent TM domain length requirement for supporting full membrane fusion [18], strongly suggesting that the TM domain needed to span both inner and outer leaflets to fulfill its function. In addition, it has been found that the residues within HA TM domain are important for raft association as sequence substitutions in the TM domain ablated HA association with rafts (nonraft HA) [19]. HA protein of H3N2 virus among 16 subtypes of influenza A viruses is the only one containing two cysteine residues (C540 and C544) in its TM domain [20–22]. Our earlier study has shown that mutations of one or two of these two cysteines affected the thermal stability and fusion activity of recombinant H3 HA proteins [20]. The enticing and necessary question was what effects of the incorporation of these recombinant mutant HAs would be on the recombinant H3N2 viruses. In this study, we generated three recombinant H3N2 mutant viruses (wildtype, C540S, C544L, and 2C/SL) carrying mutations of one or two TM cysteines (C540 and C544) in the HA TM domain and one wildtype (WT) recombinant H3N2 virus in the background of A/swine/Guangdong/01/98 [H3N2] using reverse genetics. The results showed that the mutations affected various characteristics of the recombinant H3N2 viruses including growth rate, fusion activity, thermal and acidic resistances, and infectivity and virulence in embryonated eggs.
Materials and methods Cells and viruses Human embryonic kidney cells (293T) and MDCK cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM; Invitrogen) supplemented with 10 % fetal bovine serum (FBS; Invitrogen), GlutaMAX (200 mM; Invitrogen), penicillin (100 units/ml), and streptomycin (100 lg/ml) in an atmosphere of 5 % CO2 at 37 °C. The H3N2 strain (A/swine/Guangdong/01/98 [H3N2]) was isolated in Guangdong province, China in 1998; the nucleotide sequences are available from GenBank under accession numbers FJ830852.1–FJ830859.1. The handling of experiments with live viruses was conducted in a biosafety 2 plus facility under the guidelines issued by China authority. Plasmids and constructs The eight genome-sense (pHH21) plasmids (a gift from Y. Kawaoka, University of Wisconsin-Madison) and four protein-expressing (pcDNA3.0) plasmids used to generate
123
influenza virus by reverse genetics have been described previously [23–25]. For rescue of recombinant H3N2 viruses, eight genome-sense plasmids together with expression plasmids encoding the RNP complex (pcDNA– PB1, pcDNA–PB2, pcDNA–PA, and pcDNA–NP) were transfected into 293T cells using Lipofectamine2000 (Invitrogen). The transfected cell culture supernatant was collected at 48–60 h post-transfection and used to passage onto MDCK cells or 10-days-old embryonated chicken eggs for the propagation of the recombinant viruses. Virus production was monitored by hemagglutination titer. To generate pHH21 encoding the mutant HAs (C540S, C544L, and 2C/SL), the pHH21 vector encoding WT HA was subjected to site-directed mutagenesis using the Stratagene Quick-Change mutagenesis kit (Stratagene, La Jolla, CA, USA). Primers used in the generation of these constructs were as follows: 50 GATTTCCTTTGCCAT AT CAAGCTTTTTGCTTTGTGTTG30 [forward (fo)] and 50 CAACACAAAGCAA AAAGCTTGATATGGCAAAG GAAATC30 [reverse (re)] for exchange of cysteine at position 540; 50 CATATCATGCTTTTTGCTTCTTGTTG TTTTGCTGGGGTTC30 (fo) and 50 GAACCCCAGCAAA ACAACAAGAAGCAAAAAGCATGATATG30 (re) for exchange of cysteine at position 544; 50 CATATCAAGCT TTTTGCTTCTTGTT GTTTTGCTGGGGTTC30 (fo) and 50 GAACCCCAGCAAAACAACAAGAAGCA AAAAGC TTGATATG30 (re) for exchange of cysteines at position 540 and 544 (the mutation sites are indicated by the underlined characters). The recombinant mutant viruses were generated as described above and the entire genome of the recombinant viruses was confirmed by sequencing.
Virus growth and plaque assay MDCK cells were grown in 24-well plates and inoculated in triplicate with viruses at a multiplicity of infection (MOI) of 0.001 per well in phosphate-buffered saline (PBS) containing 0.2 % BSA for 1 h. Unbound viruses were washed away, and 0.5 ml serum-free medium containing 0.2 % BSA and 2 lg/ml TPCK-trypsin was added to each well. The supernatants were collected every 12 h until 72 h post-infection. The viral titers in the supernatants were determined by plaque assay on MDCK cells. For plaque assays, MDCK cells in 6-well plates were infected with serial tenfold dilutions of the recovered viruses for 1 h at 37 °C. After washing, the media in the dish were then replaced with MEM-1 % agarose containing 2 lg/ml of trypsin. Plaques were formed by incubation for 3 days at 37 °C. Cells were stained with 0.01 % neutral red and the formed plaques were photographed.
Virus Genes
Virus purification, immunoblotting, and electron microscopy The WT and mutant viruses were propagated in embryonated eggs and purified by centrifugation on 20–60 % sucrose density gradients [26]. Purified virions were boiled for 5 min at 100 °C in the loading buffer (50 mM Tris, 100 mM dithiothreitol, 2 % SDS, 0.1 % bromophenol blue, and 10 % glycerol). And viral proteins were separated by 10 % SDS polyacrylamide gel electrophoresis. After that proteins were transferred to polyvinylidene fluoride membrane (Millipore, Billerica, MA). Membranes were blocked in 3 % BSA and then incubated with mouse sera against virus A/swine/GD/ 01/98 (1:3,000) for 2 h, followed by incubation with horseradish peroxidase-conjugated secondary antibody for 1 h. Proteins were detected with the commercial ECL kit (Pierce). The intensity of each band was quantified using GeneTools software (SynGene). The procedure of the negative staining of purified virions was done as described [27]. In brief, purified recombinant viruses were attached onto parlodion-coated nickel grids for 2 min. And the virions were stained by the phosphotungstic acid buffer for 2 min. The shape of the viruses was photographed by the JEOL JEM-100 CX-II electron microscope.
(RBC) (2 % RBC concentration) on ice for 10 min. Then the pH was lowered from 5.8 to 4.6 by addition of the sodium citrate buffer. After incubation at room temperature for 30 min, the chicken RBC were removed by centrifugation (3,000 rpm for 3 min) and supernatants were transferred to an ELISA plate for determination of NADPH content by optical density measurement (340 nm) with a Bio-Tek (Bio-Tek Instruments, Inc., Winooski, VT, USA) ELISA plate reader. NADPH was present in the supernatant as a function of fusion-induced red blood cell lysis. Baseline NADPH activity values were derived from samples without viruses that underwent identical treatment. Characterization of recombinant viruses in embryonated chicken eggs According to the standard protocol [29], 9 or 10-days-old specific-pathogen-free (SPF) embryonated eggs were inoculated with a series of tenfold dilution of recombinant virus stocks, respectively. All recombinant virus stocks had a titer of 5 9 106 pfu per ml. The dilutions of 100, 10-1, 10-2, 10-3, and 10-4 for assaying 50 % egg lethal doses (ELD50). And the samples of every dilution were tested for the infection rate and mortality in the following 5 days. Values of ELD50 were calculated by the Reed–Muench method [30].
Virus resistance assays HA receptor-binding assay in MDCK cells In the thermal resistance assay, the viruses with the same HA titers were incubated at a temperature ranging from 48 to 60 °C for 30 min in a Peltier Gradient Thermal Cycler (BioRad, Richmond, CA); then the HA titers were measured. In the acidic resistance assay, the viruses with the same PFUs were incubated in an acidic buffer (10 mM HEPES, 10 mM MES in PBS) at pH 7.4, 5.2, or 5.0 at 37 °C for 30 min; then the solutions were adjusted to pH 7.0; then MDCK cells were infected with the recombinant viruses in 24-well plates at a MOI of 2; mock-infected wells were negative controls. After 30 min of adsorption at 37 °C, cells were washed three times with PBS and replaced with the serum-free medium containing 2 lg/ml TPCK-trypsin. The infected plates were fixed with 4 % paraformaldehyde at 5 h post-infection for 15 min at room temperature and permeabilized with 0.2 % Triton X-100 in PBS for 15 min followed by staining using the FITC-labeled mAb against NP (Abcam, Cambridge, UK). Images were observed under the Zeiss Observer Z1 inverted fluorescence microscope. Virus–cell fusion assay The virus–cell fusion assay has been described [28]. In brief, the WT and mutant viruses were standardized to HA 256 units and incubated with chicken red blood cells
As previously described [31, 32], HA receptor-binding affinity of recombinant viruses was determined using MDCK cells. MDCK cells in 24-well plates were inoculated with the four recombinant viruses at a MOI of 1.0 for 30 min. The infected cells were washed three times with PBS and incubated at 33 °C for 6 h with the medium containing 1 lg/ml TPCK-trypsin. The inoculated plates were then fixed with 1 % paraformaldehyde, permeabilized with 0.2 % Triton X-100 in PBS, and stained with anti-NP monoclonal antibodies. The cell images were captured by the Zeiss Observer Z1 inverted fluorescence microscope and the percentage of infected cells was analyzed by the Image-Pro Plus software (Media Cybernetics, Silver Springs, MD, USA). Ethics statement The viruses propagation studies in embryonated eggs were approved by the Institutional Animal Care and Use Committee of Sun Yat-sen University and the Institutional Animal Ethics Committee of Sun Yat-sen University (Permit Number: IACUC-2012-0701). Research was conducted in compliance with guidelines of the Ordinance on Laboratory Animals Management set by the State Scientific and Technological Commission of China.
123
Virus Genes Fig. 1 Schematic diagram of WT and mutant HAs. The nomenclature of the recombinant viruses is shown on the left
Statistical analysis Data are presented as mean ± SEM from at least three independent experiments. All statistical analysis was done using OriginPro 8 SR3 (Origin Lab Corp.). The differences between groups were determined by the Student’s t test with two-tailed t test when only two groups were compared. When more than two groups were compared, they were analyzed by one-way analysis of variance (ANOVA). Differences were considered statistically significant at P \ 0.05.
Results Generation of recombinant WT and mutant influenza H3N2 viruses (C540S, C544L, and 2C/SL) Our earlier study has demonstrated that the two cysteines (C540 and C544) in H3 HA TM domain affected the thermal stability and fusion activity of H3 HA proteins [20]. Since serine (S) at position 540 and leucine (L) at position 544 are common in most of the subtypes including H1, H5, and H9, the two cysteines (C540 and C544) in the H3 HA TM were mutated into serine or leucine individually (C540S and C544L) or in combination (2C/SL) (Fig. 1). The eight genomic segments from A/swine/ Guangdong/01/98 (H3N2) were cloned and the HA was mutated using site-directed mutagenesis. To facilitate the recovery of mutant viruses, we used a well-characterized reverse genetics system in which 293T cells and MDCK cells were co-cultured and transfected with eight genomeencoding plasmids and four protein (PB1, PB2, PA, and NP)-expressing plasmids [24, 33]. The authenticity of the recombinant viruses was confirmed by sequencing all genome segments (data not shown). The generated recombinant viruses showed the typical phenotype of influenza viruses with surface spikes under electron microscope (Fig. 2a). As showed in Fig. 2c, the recombinant viruses produced the plaques with different sizes; the cysteines mutant viruses formed larger plaques than the WT virus, especially the C540S and 2C/SL mutants. The results taken together indicated that the mutations
123
introduced into the TM domain did not impede the assembly and propagation of recombinant H3N2 viruses. Cysteine mutations did not significantly alter the viral protein compositions of virions The four recombinant H3N2 viruses (WT, C540S, C544L, and 2C/SL) were propagated in embryonated eggs and purified. The viral proteins of all four purified virions were separated on reduced SDS-PAGE gel, and the separated proteins were blotted by the sera from whole inactivated H3N2 virus-immunized mice (Fig. 2b). The results showed that HA1, HA2, NP, and M1 proteins were present and their individual expression levels were comparable in all four recombinant viruses (Fig. S1), demonstrating that the mutations of cysteines in H3 HA TM did not significantly alter the viral protein compositions of the virions. Recombinant mutant viruses (C540S, C544L, and 2C/SL) had increased growth rate We next analyzed the growth rate of four recombinant viruses by infecting MDCK cells with viruses at a low multiplicity of infection (MOI of 0.001) and measured the titers of plaque-forming units (pfu) at 0, 12, 24, 36, 48, 60, and 72 h after infection. The results showed that the pfu titers of all three recombinant mutant viruses were higher than that of the recombinant WT virus (Fig. 3). In particular, the pfu titers of C540S, C544L, and 2C/SL mutant viruses at 48 h were significantly higher than that of WT virus (P \ 0.05), while the pfu titer of C544L mutant virus at 48 h was lower than that of C540S and 2C/SL mutant viruses but higher than that of WT virus (about twofold increase) at the 48 h post-infection. In summary, C540S, C544L, and 2C/SL recombinant viruses showed increased growth rates in MDCK cells. Recombinant mutant viruses showed increased fusion activity We next investigated the fusion activities of all four recombinant viruses using virus-induced erythrocyte
Virus Genes Fig. 2 Verification of the recombinant viruses. a Negatively stained purified influenza virions. Images are at 980,000 (Bar 200 nm.). b Western blot analysis of SDSPAGE separated viral polypeptides. Blots were probed with antiserum for A/swine/GD/ 98. The recombinant viruses were grown in embryonated eggs and purified through sucrose gradients. c Plaque phenotypes of recombinant viruses. MDCK cell monolayers were inoculated with viruses and subsequently covered with an agarose-containing medium overlay. After 3 days of incubation, plaques were visualized by staining with neutral red
Fig. 3 Growth curves of recombinant H3N2 viruses. Monolayers of MDCK cells were inoculated at a MOI of 0.001. The amount of infectious viruses in the supernatants harvested at the indicated times was determined by plaque assay. Error bars represent the standard deviation from triplicate experiments. *on WT means P \ 0.05, compared with all mutant viruses
hemolysis assay [28]. When all four recombinant viruses were subjected to the virus-induced erythrocyte hemolysis assay at a pH range of 4.6, 4.8, 5.0, 5.2, 5.4, 5.6 and 5.8, the mutant viruses (C540S, C544L, and 2C/SL) showed significant higher fusion activity than that of WT virus in the pH range from 4.6 to 5.0 (P \ 0.01) (Fig. 4). The data
indicated that there was no difference in the HA activation pH between the mutants and WT virus; instead, the difference was the extent of membrane fusion. These results were in line with our earlier study [20], validating the usefulness of using recombinant HA proteins to study the HA functions.
123
Virus Genes Fig. 4 Fusion activities of recombinant H3N2 viruses. Fusion activity was measured by the red blood cell fusion assay. Viruses standardized to 256 HA units were mixed with 2 % chicken red blood cells and then the buffer was replaced with the acidic buffer which varied between 4.6 and 5.8. The hemolysis representing the fusion activity was expressed as the optical density at 340 nm (OD340) minus the baseline NADPH value obtained from no virus treatment condition. Error bars represent the standard deviation from triplicate experiments. At pH 4.6, 4.8, 5.0, **P \ 0.01, compared with all mutant viruses
Fig. 5 Thermal resistance of recombinant H3N2 viruses. For four recombinant viruses, the preparations which had originally 256 HA units were incubated at indicated temperatures for 30 min in the thermal cycler. And their HA titers were measured by hemagglutination. *P \ 0.05, compared with all mutant viruses
Recombinant mutant viruses exhibited reduced thermal and acidic resistances We then used the thermal resistance assay [34] to examine the thermal resistance of recombinant viruses at the temperature range of 48, 50, 52, 54, 56, 58, and 60 °C. The temperature range was chosen after our preliminary studies showed that all four recombinant viruses had similar thermal resistance below 50 °C and retained no HA titers
123
over 60 °C. All four recombinant viruses with the same HA titers were incubated at the designated temperatures for 30 min, and their HA titers were measured after cooling to room temperature. The results showed that all four recombinant viruses started to lose their HA titers from 50 °C, and gradually to completely lose their HA titers at 60 °C (Fig. 5). More importantly, the three recombinant mutant viruses (C540S, C544L, and 2C/SL) lost significantly more HA titers than the WT recombinant virus at 56 and 58 °C (P \ 0.05), indicating that the recombinant mutant viruses had reduced thermal resistances (Fig. 5). We also examined whether the treatment with acidic solutions prior to infections would affect the infectivity of the recombinant viruses. All four recombinant viruses with the same PFUs were treated with a buffer of pH 5.0, 5.2, and 7.4 at 37 °C for 30 min; and then their infectivity was tested by infecting MDCK cells. In the pH range tested, pH 5.0 distinguished the WT recombinant virus from all three recombinant mutant viruses, where only the WT recombinant virus retained partial infectivity while all other three completely lost their infectivity (Fig. 6). In summary, the mutations of either one or both of the two TM cysteines rendered the recombinant mutant viruses with reduced thermal and acidic resistances. All recombinant viruses shared similar receptor-binding affinity We then investigated whether the mutations of the TM cysteines would affect the receptor-binding affinity of the recombinant viruses. For assaying the receptor-binding
Virus Genes Fig. 6 Acidic resistance of recombinant H3N2 viruses. Virus samples were incubated with MES buffer at indicated pH values for 30 min. And then samples were returned to neutral pH (7.4) prior to infection at MOI = 2. The cells were processed for immunofluorescence staining after 5 h of incubation at 37 °C
Fig. 7 HA receptor-binding affinity of recombinant viruses. The recombinant viruses were adsorbed to MDCK cells at a MOI of 1.0 for 30 min, washed three times with PBS. The cells were then
processed for immunofluorescence staining after 6 h of incubation at 37 °C. The percentage of infected cells (mean ± standard deviation) indicated in each image is an average of six images
affinity, MDCK cells were infected at an MOI of 1.0 with viruses and immuno-stained with anti-NP monoclonal antibodies after 6 h [31, 32]. The receptor-binding affinities were presented by the percentage of the infected cells. The results showed that all four recombinant viruses had similar receptor-binding affinities (Fig. 7).
constructed cannot also infect mice; thus we examined the pathogenicity of recombinant viruses in SPF embryonated chicken eggs by ELD50 assays [35]. The WT, C540S, C544L, and 2C/SL viruses had the mean titers of ELD50 -1.5, -3, -2.33, and -2.5, respectively (Table 1). The results showed that all recombinant mutant viruses (C540S, C544L, and 2C/SL) exhibited enhanced virulence, indicating that the two cysteines in the TM domain are involved in regulating the virulence of H3N2 influenza viruses.
Recombinant mutant viruses manifested higher ELD50 titers than recombinant WT virus We next examined whether the cysteine mutations affected the pathogenicity of recombinant mutant viruses. The mouse model has been widely used for assaying the pathogenicity of influenza A viruses. However, our preliminary studies showed that the H3N2 strain used in our study was poor in infecting mice and the mutants viruses we
Discussion This study attempted to investigate the relationship of H3 HA TM domain structure and the biological functions of
123
Virus Genes Table 1 Pathogenicity of recombinant H3N2 viruses in eggs Virus
Log10 ELD50
rH3N2/A/swine/GD/01/98-HA-WT
-1.5
rH3N2/A/swine/GD/01/98-HA-C540S
-3
rH3N2/A/swine/GD/01/98-HA-C544L
-2.33
rH3N2/A/swine/GD/01/98-HA-2C/SL
-2.5
recombinant H3N2 viruses. More specifically, we generated by reverse genetics four recombinant H3N2 viruses, of which three contained a H3 HA with mutation of one or two TM cysteines (C540S, C544L, and 2C/SL); all four recombinant H3N2 viruses showed the similar viral composition, indicating that these two TM cysteines were not indispensable for the assembly and propagation of H3N2 viruses. Our results showed that while all four recombinant H3N2 viruses had similar receptor-binding affinity, the three recombinant mutant viruses manifested different biological characteristics than the recombinant WT virus, including different plaque sizes, higher growth rate, increased fusion activity, reduced thermal and acidic resistances, and increased EID50 and ELD50 titers. During membrane fusion, HA forms a helical structure consisting of its TM and fusion peptide at the end of the molecule [36]. For influenza virus HA, a TM domain with ]17 amino acids was able to efficiently promote full fusion in all HAs [18]. Previous work indicated that addition of palmitic acid to cysteines, which are highly conserved among the 16 HA subtypes, located in the TM domain boundary region may regulate the membrane fusion [37–40]. Our study for the first time provided direct evidence showing that the TM cysteines (C540 and C544) contributed to the regulation of fusion activity of H3N2 viruses, reaffirming previous studies on HA molecules [17, 18]. Takeda et al. [19] had studied the effects of the TM amino acids of HA on the growth of H3N2 viruses in detail by alanine scanning mutagenesis. They showed that HA mutants 530–532 and 533–535 had a slower growth rate and a titer of about 3 logs lower than WT virus [19]. Interestingly, the HA mutant 539–541 was the only one showing higher growth rate than WT virus. This strongly corroborated our results showing that C540S mutant virus had the higher growth rate than WT virus (Fig. 3), because the mutant 539–541 in Takeda et al. [19] had the C540 residue changed to alanine. In addition, the positions of the amino acids in the TM might affect their contributions to the growth rate. In Takeda et al. [19], different mutants had different growth rates. Our results also supported this point by showing that C540S and C544L mutants had different growth rates. Furthermore, the reasons for the increased growth rates for C540S, C544L, and 2C/SL mutant H3N2
123
viruses might be their increased fusion activity. A number of previous studies reported that the elevated fusion activity could enhance the virus growth [41–44]. In the present study, the growth rates of the mutant H3N2 viruses were correlated with their fusion activities (Figs. 3, 4). This adds another support for the relationship between the virus growth rate and their fusion activity. Previous studies have demonstrated that the conformational changes of HA proteins might affect the thermal resistances of influenza viruses [34, 45], and that elevated pH for membrane fusion could change the stability of the viruses [42, 44–46]. The results in our study showed that the recombinant WT H3N2 viruses were more resistant to elevated temperature exposure or acidic treatment than the mutant viruses (Figs. 5, 6), indicating that the TM cysteines might contribute to the conformational stability of H3 HA proteins in H3N2 viruses. In addition, for the paramyxoviruses, the fusion protein activation involves cytoplasmic tails signaling to the ectodomain [47, 48] and TM domain can affect ectodomain stability [49–51]. The HA TM domain can probably modulate the membrane fusion by the inside-out signaling. Our results provided a plausible explanation for the previous studies showing that the TM domain of the H3N2 strain A/X-31 exhibited a strong potential for the stable oligomers [52, 53] and more tightly associated within trimers [54]. The recombinant mutant H3N2 viruses exhibited increased infectivity and virulence in the embryonated eggs; this is to the best of our knowledge the first time a study showing that mutations of one or two TM cysteines in the H3 HA could increase the infectivity and virulence of H3N2 viruses. These results should not be surprising since these recombinant mutants H3N2 viruses have been shown to have increased growth rate and fusion activity. Even though we made a strong case for arguing that there is a causal relationship between the increased infectivity and virulence and the increased growth rate and fusion activity, further studies are needed to establish such a relationship. In summary, our results have demonstrated that mutations of one or two cysteines in the TM domain of H3 HA protein could alter many characteristics of recombinant mutant H3N2 viruses including plaque size, increased growth rate, fusion activity, reduced thermal and acidic resistances. This study has important practical applications, for example, the recombinant mutant H3N2 viruses with increased growth rate could be developed to improve H3N2 influenza vaccine production. Furthermore, it would be interesting to know whether an insertion of the corresponding TM cysteines into the TM domains of other subtype HA proteins could decrease the infectivity and virulence of the resultant recombinant viruses; for example, if the infectivity and virulence of H5N1 viruses could be reduced by such insertions in their HA proteins, it might
Virus Genes
facilitate the development of vaccines against H5N1 viruses. Acknowledgments This work was supported by grants from the State Key Laboratory of Biocontrol at Sun Yat-sen University. We thank George D. Liu for critical review and revision of the manuscript and Professor A.D. Osterhaus of Erasmus University Medical Center, Rotterdam and Professor Y. Kawaoka of University of WisconsinMadison for offering the plasmids.
References 1. K. Stohr, Lancet Infect. Dis 2, 517 (2002) 2. M.R. Sandbulte, K.B. Westgeest, J. Gao, X. Xu, A.I. Klimov, C.A. Russell, D.F. Burke, D.J. Smith, R.A. Fouchier, M.C. Eichelberger, Proc. Natl. Acad. Sci. USA 108, 20748–20753 (2011) 3. J.C. Krause, T. Tsibane, T.M. Tumpey, C.J. Huffman, R. Albrecht, D.L. Blum, I. Ramos, A. Fernandez-Sesma, K.M. Edwards, A. Garcia-Sastre, C.F. Basler, J.E. Crowe Jr, J. Virol. 86, 6334–6340 (2012) 4. C.A. Russell, T.C. Jones, I.G. Barr, N.J. Cox, R.J. Garten, V. Gregory, I.D. Gust, A.W. Hampson, A.J. Hay, A.C. Hurt, J.C. de Jong, A. Kelso, A.I. Klimov, T. Kageyama, N. Komadina, A.S. Lapedes, Y.P. Lin, A. Mosterin, M. Obuchi, T. Odagiri, A.D. Osterhaus, G.F. Rimmelzwaan, M.W. Shaw, E. Skepner, K. Stohr, M. Tashiro, R.A. Fouchier, D.J. Smith, Science 320, 340–346 (2008) 5. J. Bahl, M.I. Nelson, K.H. Chan, R. Chen, D. Vijaykrishna, R.A. Halpin, T.B. Stockwell, X. Lin, D.E. Wentworth, E. Ghedin, Y. Guan, J.S. Peiris, S. Riley, A. Rambaut, E.C. Holmes, G.J. Smith, Proc. Natl. Acad. Sci. USA 108, 19359–19364 (2011) 6. R.J. Garten, C.T. Davis, C.A. Russell, B. Shu, S. Lindstrom, A. Balish, W.M. Sessions, X. Xu, E. Skepner, V. Deyde, M. OkomoAdhiambo, L. Gubareva, J. Barnes, C.B. Smith, S.L. Emery, M.J. Hillman, P. Rivailler, J. Smagala, M. de Graaf, D.F. Burke, R.A. Fouchier, C. Pappas, C.M. Alpuche-Aranda, H. Lopez-Gatell, H. Olivera, I. Lopez, C.A. Myers, D. Faix, P.J. Blair, C. Yu, K.M. Keene, P.D. Dotson Jr, D. Boxrud, A.R. Sambol, S.H. Abid, K. St George, T. Bannerman, A.L. Moore, D.J. Stringer, P. Blevins, G.J. Demmler-Harrison, M. Ginsberg, P. Kriner, S. Waterman, S. Smole, H.F. Guevara, E.A. Belongia, P.A. Clark, S.T. Beatrice, R. Donis, J. Katz, L. Finelli, C.B. Bridges, M. Shaw, D.B. Jernigan, T.M. Uyeki, D.J. Smith, A.I. Klimov, N.J. Cox, Science 325, 197–201 (2009) 7. R.A. Lamb, R.M. Krug, in Fields Virology, 4th edn., ed. by D.M. Knipe, P.M. Howley (Lippincott Williams & Wilkins, Philadelphia, 2001), pp. 1487–1532 8. M.L. Grantham, W.H. Wu, E.N. Lalime, M.E. Lorenzo, S.L. Klein, A. Pekosz, J. Virol. 83, 8655–8661 (2009) 9. J.J. Skehel, D.C. Wiley, Annu. Rev. Biochem. 69, 531–569 (2000) 10. H.D. Klenk, R. Rott, Adv. Virus Res. 34, 247–281 (1988) 11. E.J. Schrauwen, T.M. Bestebroer, V.J. Munster, E. de Wit, S. Herfst, G.F. Rimmelzwaan, A.D. Osterhaus, R.A. Fouchier, J. Gen. Virol. 92, 1410–1415 (2011) 12. E.J. Schrauwen, S. Herfst, L.M. Leijten, P. van Run, T.M. Bestebroer, M. Linster, R. Bodewes, J.H. Kreijtz, G.F. Rimmelzwaan, A.D. Osterhaus, R.A. Fouchier, T. Kuiken, D. van Riel, J. Virol. 86, 3975–3984 (2012) 13. W.H. Wu, A. Pekosz, J. Virol. 82, 1059–1063 (2008) 14. P. Scheiffele, M.G. Roth, K. Simons, EMBO J. 16, 5501–5508 (1997)
15. G.W. Kemble, T. Danieli, J.M. White, Cell 76, 383–391 (1994) 16. G.B. Melikyan, J.M. White, F.S. Cohen, J. Cell Biol. 131, 679–691 (1995) 17. B. Schroth-Diez, E. Ponimaskin, H. Reverey, M.F. Schmidt, A. Herrmann, J. Virol. 72, 133–141 (1998) 18. R.T. Armstrong, A.S. Kushnir, J.M. White, J. Cell Biol. 151, 425–437 (2000) 19. M. Takeda, G.P. Leser, C.J. Russell, R.A. Lamb, Proc. Natl. Acad. Sci. USA 100, 14610–14617 (2003) 20. S. Xu, J. Zhou, K. Liu, Q. Liu, C. Xue, X. Li, J. Zheng, D. Luo, Y. Cao, Virus Genes 47, 20–26 (2013) 21. E. Nobusawa, T. Aoyama, H. Kato, Y. Suzuki, Y. Tateno, K. Nakajima, Virology 182, 475–485 (1991) 22. R.D. Tall, M.A. Alonso, M.G. Roth, Traffic 4, 838–849 (2003) 23. G. Neumann, T. Watanabe, H. Ito, S. Watanabe, H. Goto, P. Gao, M. Hughes, D.R. Perez, R. Donis, E. Hoffmann, G. Hobom, Y. Kawaoka, Proc. Natl. Acad. Sci. USA 96, 9345–9350 (1999) 24. E. Fodor, L. Devenish, O.G. Engelhardt, P. Palese, G.G. Brownlee, A. Garcia-Sastre, J. Virol. 73, 9679–9682 (1999) 25. E. Hoffmann, G. Neumann, G. Hobom, R.G. Webster, Y. Kawaoka, Virology 267, 310–317 (2000) 26. H. Jin, K. Subbarao, S. Bagai, G.P. Leser, B.R. Murphy, R.A. Lamb, J. Virol. 70, 1406–1414 (1996) 27. H. Jin, G.P. Leser, J. Zhang, R.A. Lamb, EMBO J 16, 1236–1247 (1997) 28. T.T. Wang, G.S. Tan, R. Hai, N. Pica, E. Petersen, T.M. Moran, P. Palese, PLoS Pathog. 6, e1000796 (2010) 29. D.E. Swayne, D.A. Halvorson, Influenza in Diseases of Poultry, 11th edn. (Iowa State Press, Iowa City, 2003) 30. A.K. Thakur, W.L. Fezio, Drug Chem. Toxicol. 4, 297–305 (1981) 31. B. Lu, H. Zhou, D. Ye, G. Kemble, H. Jin, J. Virol. 79, 6763–6771 (2005) 32. B. Lu, H. Zhou, W. Chan, G. Kemble, H. Jin, Vaccine 24, 6691–6693 (2006) 33. E. Hoffmann, G. Neumann, Y. Kawaoka, G. Hobom, R.G. Webster, Proc. Natl. Acad. Sci. USA 97, 6108–6113 (2000) 34. A. Farnsworth, T.D. Cyr, C. Li, J. Wang, X. Li, Vaccine 29, 1529–1533 (2011) 35. H. Sun, P. Jiao, B. Jia, C. Xu, L. Wei, F. Shan, K. Luo, C. Xin, K. Zhang, M. Liao, Vet. Microbiol. 152, 258–265 (2011) 36. Z.N. Li, B.J. Lee, W.A. Langley, K.C. Bradley, R.J. Russell, D.A. Steinhauer, J. Virol. 82, 6337–6348 (2008) 37. L.V. Kordyukova, M.V. Serebryakova, L.A. Baratova, M. Veit, J. Virol. 82, 9288–9292 (2008) 38. B.J. Chen, M. Takeda, R.A. Lamb, J. Virol. 79, 13673–13684 (2005) 39. R. Wagner, A. Herwig, N. Azzouz, H.D. Klenk, J. Virol. 79, 6449–6458 (2005) 40. T. Sakai, R. Ohuchi, M. Ohuchi, J. Virol. 76, 4603–4611 (2002) 41. S. Murakami, T. Horimoto, M. Ito, R. Takano, H. Katsura, M. Shimojima, Y. Kawaoka, J. Virol. 86, 1405–1410 (2012) 42. M.L. Reed, H.L. Yen, R.M. DuBois, O.A. Bridges, R. Salomon, R.G. Webster, C.J. Russell, J. Virol. 83, 3568–3580 (2009) 43. M.L. Reed, O.A. Bridges, P. Seiler, J.K. Kim, H.L. Yen, R. Salomon, E.A. Govorkova, R.G. Webster, C.J. Russell, J. Virol. 84, 1527–1535 (2010) 44. Y.P. Lin, S.A. Wharton, J. Martin, J.J. Skehel, D.C. Wiley, D.A. Steinhauer, Virology 233, 402–410 (1997) 45. B.M. Krenn, A. Egorov, E. Romanovskaya-Romanko, M. Wolschek, S. Nakowitsch, T. Ruthsatz, B. Kiefmann, A. Morokutti, J. Humer, J. Geiler, J. Cinatl, M. Michaelis, N. Wressnigg, S. Sturlan, B. Ferko, O.V. Batishchev, A.V. Indenbom, R. Zhu, M. Kastner, P. Hinterdorfer, O. Kiselev, T. Muster, J. Romanova, PLoS One 6, e18577 (2011)
123
Virus Genes 46. R.S. Daniels, J.C. Downie, A.J. Hay, M. Knossow, J.J. Skehel, M.L. Wang, D.C. Wiley, Cell 40, 431–439 (1985) 47. D.L. Waning, C.J. Russell, T.S. Jardetzky, R.A. Lamb, Proc. Natl. Acad. Sci. USA 101, 9217–9222 (2004) 48. D.L. Waning, A.P. Schmitt, G.P. Leser, R.A. Lamb, J. Virol. 76, 9284–9297 (2002) 49. S. Seth, A.L. Goodman, R.W. Compans, J. Virol. 78, 8513–8523 (2004) 50. M. Li, Z.N. Li, Q. Yao, C. Yang, D.A. Steinhauer, R.W. Compans, J. Virol. 80, 6106–6114 (2006)
123
51. M.L. Bissonnette, J.E. Donald, W.F. DeGrado, T.S. Jardetzky, R.A. Lamb, J. Mol. Biol. 386, 14–36 (2009) 52. S.A. Tatulian, L.K. Tamm, Biochemistry 39, 496–507 (2000) 53. L. Godley, J. Pfeifer, D. Steinhauer, B. Ely, G. Shaw, R. Kaufmann, E. Suchanek, C. Pabo, J.J. Skehel, D.C. Wiley et al., Cell 68, 635–645 (1992) 54. L.V. Kordyukova, M.V. Serebryakova, A.A. Polyansky, E.A. Kropotkina, A.V. Alexeevski, M. Veit, R.G. Efremov, I.Y. Filippova, L.A. Baratova, Biochim. Biophys. Acta 1808, 1843–1854 (2011)
