Mol Biol Rep DOI 10.1007/s11033-014-3192-8

Recombinant expression and characterization of a novel endoglucanase from Bacillus subtilis in Escherichia coli Muddassar Zafar • Sibtain Ahmed • Muhammad Imran Mahmood Khan Amer Jamil

•

Received: 18 April 2013 / Accepted: 22 January 2014 Ó Springer Science+Business Media Dordrecht 2014

Abstract The goal of this work was to produce high levels of endoglucanase in Escherichia coli for its potential usage in different industrial applications. Endoglucanase gene was amplified from genomic DNA of Bacillus subtilis JS2004 by PCR. The isolated putative endoglucanase gene consisted of an open reading frame of 1,701 nucleotides and encoded a protein of 567 amino acids with a molecular mass of 63-kDa. The gene was cloned into pET-28a(?) and expressed in E. coli BL21 (DE3). Optimum temperature and pH of the recombinant endoglucanase were 50 °C and 9, respectively which makes it very attractive for using in bio-bleaching and pulp industry. It had a KM of 1.76 lmol and Vmax 0.20 lmol/min with carboxymethylcellulose as substrate. The activity of recombinant endoglucanse was enhanced by Mg2?, Ca2?, isopropanol and Tween 20 and inhibited by Hg2?, Zn2?, Cu2?, Ni2? and SDS. The activity of this recombinant endoglucanase was significantly higher than wild type. Therefore, this recombinant enzyme has potential for many industrial applications

M. Zafar  A. Jamil (&) Department of Biochemistry, Pir Mehr Ali Shah Arid Agriculture University, Rawalpindi, Pakistan e-mail: [email protected] S. Ahmed Department of Chemistry and Biochemistry, University of Agriculture, Faisalabad, Pakistan S. Ahmed (&) University of California, San Diego, 9500 Gilman Drive, La Jolla, CA 92093, USA e-mail: [email protected] M. I. M. Khan School of Biological Sciences, University of the Punjab, Lahore, Pakistan

involving biomass conversions, due to characteristic of broad pH and higher temperature stability. Keywords Expression  Purification  Endoglucanase  Bacillus subtlis  Carboxymethylcellulase

Introduction Cellulose is the most abundant organic polymer in this planet and is an important renewable energy source along with sugars and starches [1]. Cellulase degradation and its subsequent utilizations are important for global carbon sources. The value of cellulose as a renewable source of energy has made cellulose hydrolysis the subject of intense research and industrial interest [2, 3]. Cellulases and hemicellulases are two important classes of enzymes produced by microorganisms including filamentous fungi and secreted into the cultivation medium [4, 5]. Cellulase enzymes, which can hydrolyze cellulose forming glucose and other commodity chemicals, can be divided into three types: endoglucanase (endo-1, 4-b-Dglucanase, EG, EC 3.2.1.4); exoglucanase (also called as cellobiohydrolase) (exo-1,4-b-D-glucanase, CBH, EC 3.2.1.91) and b-glucosidase (1,4-b-D-glucosidase, BG, EC 3.2.1.21) [6]. The cleavage of cellulose is based on synergistic actions of exo-b-1,4-glucanase (EC 3.2.9.11), endo-b-1,4-glucanase (EC 3.2.1.4) and b-glucosidase (EC 3.2.1.21) [7]. Endoglucanases are mainly responsible for hydrolyzing the internal glycosidic bond to decrease the length of the cellulose chains. Cellulases play key role in increasing the yield of the fruit juices, beer filtration, oil extraction and in improving the nutritive quality of bakery products and animal feed [8]. The application of cellulases to the hydrolysis of lignocellulosic

123

Mol Biol Rep

materials (biomass) in order to further convert the released fermentable sugars into ethanol has increased because of their worldwide demand for renewable fuels [9]. Xylanases and cellulases together with pectinases account for 20 % of the world enzyme market [10, 11]. There are many industrial applications of endoglucanases such as in animal feed production, in processing of beer and fruit juice [12]. Elevated temperatures (above 40 °C) during industrial processes result in decrease of activity of native glucanases. So the search for recombinant endoglucanase with enhanced activity and improved thermal stability continues [13]. Therefore, exploration of new microbes capable of producing cellulolytic enzymes with increased specific activities and higher efficiency are always welcomed [14]. For the purpose of optimization of industrial processes and energy saving, it is necessary that endoglucanases exhibit reasonably high activities [15]. Cellulases have been produced by many fungal and bacterial strains. Bacteria have good potential for cellulase production because their growth rate is much higher than fungi. However there is not sufficient information available for recombinant expression of cellulases for industrial applications. Escherichia coli is a very important microorganism for scientist working on ceullosic biofuels because of its ease of genetic manipulation. E. coli has been manipulated for ethanol production [16], advanced biofuel molecules, such as butanol [17], fatty acids [18], biodiesel [19] and alkanes/alkenes [20]. Although E. coli is well known to be an ideal host for recombinant protein production, secreting proteins into the extracellular medium has been a difficult task in E. coli [21]. If E. coli could efficiently secrete recombinant proteins, such as cellulases, a consolidated bioprocessing approach could be applied where the same organism could hydrolyze the biomass and produce biofuel [22]. A few attempts have been made in this regard by various groups [19, 20], but there is a need for a systematic analysis of this approach. Advancement in gene manipulation techniques has created a favorable environment for production and applications of cellulases at industrial level. The introduction of new techniques and search for improved strains of microorganisms to be used in industry has led towards multitude of future industrial potential of cellulases. In this study, cloning and sequencing of the gene encoding endoglucanse and its heterologous expression in E. coli are described along with the characterization of recombinant enzyme.

(X-Gal) and isopropyl-1-thio-b-D-galactopyranoside (IPTG) were purchased from Sigma, USA. Genomic DNA isolation kits, cloning and expression vectors, restriction enzymes, modifying enzymes, T4 DNA ligase and Taq DNA polymerase were obtained from Fermentas. Kits used for the isolation of plasmid DNA were from Qiagen. The bacterial strain was selected on Luria–Bertani (LB) medium and cultured in LB broth. The antibiotics, ampicillin and kanamycin were obtained from Sigma and were used for selection with concentrations of 100 and 50 lg/mL, respectively. Microorganism and plasmids Bacillus subtilis was used as a source for the amplification of endoglucanse gene in the present study. It was isolated in the laboratory from the alkaline soil sample and designated as B. subtilis JS2004. B. subtilis JS2004 was cultured in LB medium containing 1 % CMC at 37 °C. pTZ57R/T cloning vector was used for sequencing endoglucanse gene. E. coli BL21 and vector pET-28(?) were used for expression of endoglucanase. Cloning and sequence analysis of endoglucanase gene Standard protocols were employed for the DNA manipulations [23]. Genomic DNA of B. subtilis JS2004 was isolated as described previously [24]. Endoglucanse gene was isolated from genomic DNA of B. subtilis JS2004 by PCR technique using primers MZ1 and MZ2 (Table 1). The PCR amplification procedure consisted of an initial denaturing step of 5 min at 94 °C, followed by 30 cycles of denaturation (94 °C) for 1 min, 1 min annealing (56 °C) and 1 min elongation (72 °C). The amplified gene was purified from the agarose gel after electrophoresis using Qiagen DNA extraction kit and ligated into the pTZ57R/T cloning vector. The ligation mixture was placed at 22 °C overnight. Transformations were performed by heat shock method [23]. The bacteria transformed with the ligation mixture were spread on IPTG-XGAL-LB-agar-ampicillin plates. The ampicillin was added in the medium to a final concentration of 100 lg/mL and the plates with bacteria were incubated at 37 °C overnight. The recombinant colonies were isolated by blue/white screening method. The Table 1 Primers used in this study

Materials and methods Materials Carboxymethylcellulose (CMC), Cellulose, glucose, maltose, 5-bromo-4-chloro-3-indoyl-b-D-galactopyranoside

123

0

0

Primers

Sequences (5 ? 3 )

MZ1

CCATGGATCATGAGGATGTGAAAACTC

MZ2

CTCGAGTGAATTGGTTGTCTGAGCTG

MZ3

CAGTCCCATGGGAAAACTCTCG

MZ4

GCGTGCATCTCGAGTCTTGTC TTAAACCC

Mol Biol Rep

positive transformants were re-plated on IPTG-Xgal-LBagar-ampicillin plates. After isolation of plasmid DNA through MiniPrep kit (Qiagen), it was digested with BamHI and EcoRI restriction enzymes using appropriate buffer at 37 °C for one hour. The endoglucanase gene was sequenced from DNA sequencing facility of Centre for Applied Molecular Biology (CAMB), Lahore, Pakistan. GenBank was used for the retrieval of DNA sequence, PRF was used to get peptide information, SwissProt was used to get functional information and PIR was used for structural classification of protein [25].

buffers used for this purpose included 50 mM concentrations of citric acid buffer (pH 3–6), phosphate buffer (pH 6–8), Tris–HCl (pH 8–9) and glycine-NaOH buffer (pH 9–10). Before addition of the substrate, enzyme fractions were incubated with buffers for 90 min and enzyme activity was determined by Dinitrosalicylic acid (DNS) method. The enzyme was incubated in 50 mM GlycineNaOH buffer (pH 9) at different temperatures (25–65 °C) up to 4 h and optimum temperature was assayed.

Expression of the endoglucanase gene in E. coli

The substrate specificity of purified recombinant endoglucanase was determined by employing different substrates: CMC, pNPC, avicel, cellubiose, alpha-glucan and xylan. For determination of Michaelis constant (KM) and maximum velocity (Vmax), the enzyme was treated with 50 mM Glycine-NaOH buffer (pH 9) using CMC as substrate with 0.15–2.5 lmol concentrations. Lineweaver–Burk plots were drawn for the determination of the Vmax and KM.

Endoglucanse gene was amplified from B. subtilis JS2004 using primers MZ3 and MZ4 (Table 1), which have the restriction sites for NcoI and XhoI, for expression in pET28a(?). The amplified endoglucanase gene was digested by NcoI and XhoI and ligated into the corresponding sites of pET-28a(?) expression vector. The recombinant plasmid pET-28a(?)-e.g. was transformed in E. coli (BL21) strain. The recombinant strain was grown in LB medium containing 100 lg/mL kanamycin. The culture was induced at 0.6 OD600nm by the addition of isopropyl-b-D-thiogalactopyranoside (IPTG) After addition of IPTG, fractions of the culture were collected at intervals of 2, 4, 6, 8 and 10 h for measuring absorbance and SDS-PAGE analysis. The inducer (IPTG) was added to the culture at different concentrations (0.1–1 mM). The culture was allowed to incubate up to 16 h at 37 °C. One mL culture from each flask was collected and centrifuged for 3 min at 3,000g. The pellets were resuspended and subjected to expression analysis by SDS-PAGE.

Determination of substrate specificity and kinetics parameters of recombinant endoglucanase

Effect of metal ions and chemicals on recombinant endoglucanse activity The effect of metal ions and other chemicals on recombinant endoglucanase activity was also studied. For this purpose, purified recombinant enzyme extract in glycineNaOH buffer (50 mM, pH 9) was incubated (15 min, 37 °C) with HgCl2, ZnCl2, CuCl2, NiCl2, CaCl2, SDS, isopropanol, b-mercaptoethanol and tween 20. The enzyme activity was defined as 100 % in the absence of metal ion [26].

Purification of the recombinant endoglucanse SDS PAGE analysis Recombinant E. coli expressing endoglucanse at maximum activity was sonicated and centrifuged at 8,000g for 15 min. The supernatants were precipitated in 60 % ammonium sulphate. The reaction was carried out at 4 °C for 50 min. After dissolution, the sonicated product was dialyzed overnight with 50 mM Glycine-NaOH buffer (pH 9). The protein was further purified by affinity chromatography using HiTrap IMAC HP column (Sigma-Aldrich) following manuals instructions.

Recombinant enzyme characterization Optimum pH and temperature Optimum pH of the recombinant enzyme was determined by measuring its activity at different pH values (3–12). The

SDS–polyacrylamide gel electrophoresis was performed for the analysis of expression of recombinant endoglucanase. For molecular mass determination, a prestained protein molecular weight marker was used and proteins were stained with Coomassie brilliant blue [27]. Endoglucanse assay The activity of endoglucanase was assayed. Briefly two hundred microlitres of diluted enzyme was added to 1.8 mL of carboxymethylcellulose (1 %) prepared in NaOH-glycine buffer (pH 9) and incubated at 40 °C for 30 min. The reaction was stopped by addition of 3.0 mL DNS and then the reaction mixture was incubated in water bath at 100 °C for 15 min [28] and ice cooled for color stabilization. The absorbance was noted at 540 nm. The

123

Mol Biol Rep

Fig. 1 Nucleotide sequence of endoglucanase gene from B. subtilis JS2004. The sites for ribosomal binding, restriction enzymes, promoter and operator are underlined. The sites for transcriptional

start and stop codon are also mentioned. The GenBank database was used for retrieval of gene sequence

enzyme unit was defined as the amount of enzyme liberating 1 lg reducing sugar equivalent to glucose per minute.

pET28a(?) expression vector and expressed in an IPTG inducible system of E. coli (BL21). Protein expression was induced with 1 mM IPTG. The endoglucanase activity of pET28a(?) reached optimal activity after 5 h induction, and the activity was significantly higher than that of the wild type strain. The supernatant of the culture broth was subjected to ammonium sulphate precipitation and desalting. The enzyme was purified to homogeneity of more than 90 % purity in sufficient yield. After purification of endoglucanase through first and second HiTrap IMAC HP (Sigma-Aldrich), following manual instructions, it showed a single band on SDS–PAGE which is in accordance with expected molecular mass of 63-kDa (Fig. 2).

Determination of protein concentration Protein concentration was determined by Bradford method [29]. Bovine serum albumin (BSA) was used as standard.

Results Cloning of endoglucanase gene from B. subtilis JS2004 Bacterial originated cellulase would be ideal for expression in E. coli. We therefore used endoglucanase gene from B. subtilis JS2004 strain for expression in E. coli. The endoglucanse production from this strain was maximum after 24 h of growth in LB medium containing 1 % CMC at 37 °C (Data not shown). DNA was extracted from 24 h grown culture for PCR amplification of endoglucanse gene. Endoglucanse gene was amplified by PCR and cloned in pTZ57R/T cloning vector and sequenced. The sequence results indicated that endoglucanase gene sequence contained an open reading frame (ORF) of 1,701 nucleotides that started with an ATG start codon and terminated with a TGA stop codon (Fig. 1). It encodes a protein of 567 amino acids with a predicted molecular mass of 63-kDa. Recombinant expression and purification of endoglucanase The endoglucanase gene was expressed under the control of T7 RNA polymerase promoter in E. coli strain BL21 CodonPlus (DE3). Endoglucanse gene was ligated into

123

Properties of the recombinant endoglucanase The optimum pH of recombinant endoglucanse was found to be 9 (Fig. 3a). A rapid decrease in activity above pH 9 was observed. Optimum temperature for recombinant endoglucanse was found to be 50 °C (Fig. 3b). A rapid decrease in activity below 50 °C was observed. Moreover, no activity was observed above 60 °C. The effect of pH on the stability of recombinant endoglucanse showed that 80 % of the activity was between pH 7.0–12.0 (Fig. 3c) and a fast decrease below pH 6.0 was observed, which indicated that the recombinant endoglucanase was alkali-stable. The effect of thermo stability on the recombinant endoglucanse showed that it was thermostable between 30 and 40 °C (Fig. 3d), after that there was decline in thermostability. The recombinant endoglucanse showed highest activities against carboxymethylcellulose, pNPC and avicel. The enzyme was unable to degrade Alpha-glucan, cellobiose and xylan. The KM and Vmax values for the recombinant

Mol Biol Rep

endoglucanase were 1.76 lmol and 0.20 lmol/min, respectively using Carboxymethyl cellulose as substrate. Several metal ions were assayed for their effects on recombinant endoglucanse activity. The activity of recombinant endoglucanse was enhanced by Mg2?, Ca2?, isopropanol and Tween 20 and inhibited by Hg2?, Zn2?, Cu2?, Ni2? and SDS (Table 2).

Discussion Over recent years, great interest has been given for the development of recombinant cellulases with efficient pH and temperature stability. In this paper, we reported expression and characteristics of recombinant endoglucanase from B. subtilis, which may be used for biobleaching and pulp industry where higher pH and temperature is required. The potential of cellulose degrading enzymes has been studied previously and research is being conducted for the production of industrial enzymes which are constituted by different compartments [30]. The industrial needs for the production of recombinant cellulases, which can work even at higher temperatures, have been suggested by researchers [31]. Conversion methods that involve enzymatic cleavage of cellulose by microbial cellulases instead of chemical hydrolysis are better because their employment for bioconversion lead to decreased contribution towards environmental pollution [32]. Bacillus sp. isolated from an alkaline source was used in this study for the amplification of endoglucanse gene. The microorganisms having cellulase enzymes even at high temperatures have been isolated from different environments earlier [33]. In addition to bacteria, cellulosedegrading enzymes have also been isolated from different fungi [34–36]. But there are several advantages of production of cellulase enzymes from bacteria. The generation

Fig. 3 Biochemical characterization of recombinant endoglucanase from Bacillus subtilis JS 2004. Error bars show standard deviation among three observations. a Effect of different pH on endoglucanase activity; b Effect of different temperature on endoglucanase activity. The 50 mM NaOH-glycine (pH 9) buffer was used during measuring the enzyme activity; c pH stability. The enzyme was pre-incubated at different pH values (3–12) for 30 min at 50 °C; d Thermal stability of recombinant endoglucanase produced by Bacillus subtilis JS2004. The enzyme was incubated in 50 mM Glycine-NaOH buffer (pH 9) at 25, 30, 35, 40, 45, 50, 55, 60 and 65 °C

time of bacteria is short, can be easily grown to highly elevated cell density using cheaper sources of nitrogen and carbon. The expression system and exploitation of bacteria is very convenient as expression of endogenous cellulases at increased levels is more easily obtained in bacteria than in fungi [32]. Therefore, production of recombinant cellulase enzymes from bacterial origin is preferred.

Fig. 2 SDS–PAGE analysis of endoglucanase gene from the recombinant E. coli BL21 (DE3). Lane 1, E. coli harboring recombinant pET28a-end. The arrow is indicating an expression product (63 kDa) of recombinant endoglucanase gene. Lane 2, Purified recombinant endoglucanase by affinity chromatography. Lane 3, negative control. Lane 4, protein molecular mass marker showing bands of different size (kDa)

123

Mol Biol Rep Table 2 Effect of metal ions and chemicals on recombinant activity of EG Effectora

Relative activity (%) (Mean ± SD)

Control

100 ± 0.003

HgCl2

40 ± 0.040

ZnCl2 CuCl2

21 ± 0.012 18 ± 0.047

NiCl2

27 ± 0.017

MgCl2

145 ± 0.019

CaCl2

127 ± 0.031

SDS Iso propanol Beta mercaptoethanol Tween 20

7 ± 0.011 130 ± 0.061 70 ± 0.043 150 ± 0.012

a

The final concentration of the various cations was 1 mM. Data are given as mean ± SD

Endoglucanse gene was cloned in pTZ57R/T cloning vector and sequenced. The open reading frame (ORF) of endoglucanase gene consisted of 1,701 nucleotides encoding a protein of endoglucanse gene. Different researchers have reported cloning and expression of Bacillus cellulase genes in different hosts [32, 37–43]. Endoglucanase gene from B. subtilis JS2004 strain was expressed in E. coli in this study. This achievement of successful expression of endoglucanse as demonstrated by a single band of 63-kDa suggests the possibility of using this E. coli expression system for production of other bacterial cellulases for their purification and characterization. Since no native cellulases are present in E. coli, therefore it is much better for cellulases production compared to wild type bacteria which contain different types of cellulases and it, is difficult to purify and characterize individual cellulases from them. The recombinant enzymes are preferred than native due to many reasons. The production environment in recombinant enzymes can be well controlled through choice of expression vector and strain following the cloning of an enzymatic system. A more purified product with decreased processing duration is produced in a recombinant enzyme system than native. Larger yields are obtained through recombinant and overexpressed enzymes as compared to native strains [44]. Moreover, recombinant enzymes can be easily manipulated which leads to the commercialization of new enzymes with potential industrial applications. The optimum pH of recombinant endoglucanse found in this study was 9 and enzyme exhibited more than 60 % activity at pH 7–10. The stability of the fungal cellulases is commonly between pH 3.0 and pH 8.0 [45, 46].

123

Recombinant endoglucanse with optimum activity at pH 9 and could potentially be employed in bio-bleaching process where a higher pH is required. Currently, the limiting factor to the economic viability of ethanol production from cellulosic materials is the efficient release of its component glucose molecules for subsequent fermentation. One favored approach is to pretreat the cellulosic material (e.g., straw) with alkaline reagents to release the cellulose from other plant cell wall polymers and its subsequent neutralization before digestion with a cocktail of cellulolytic enzymes [47]. Enzymes that are more active under alkaline conditions would help to reduce the costs associated with the pretreatment process [48]. Recombinant endoglucanse showed optimal activity at 50 °C. Cellulases in general show optimum temperature between 30 and 55 °C [45, 46]. The optimum activity of recombinant endoglucanse at 50 °C, makes it suitable for usage in pulp industry where a higher temperature is required. These kinetic and substrate properties of recombinant endoglucanse observed in this study are in accordance with previous studies on endoglucanases. The recombinant endoglucanse showed highest activities against carboxymethylcellulose, pNPC and avicel. The enzyme was unable to degrade Alpha-glucan, cellobiose and xylan. This substrate specificity of the characteristic of recombinant endoglucanse was in accordance with earlier studies [48–51]. The KM and Vmax values for the recombinant endoglucanase were 1.76 lmol and 0.20 lmol/min, respectively using CMC as substrate. The recombinant endoglucanse activity was strongly inhibited by SDS and divalent ions (Hg2?, Zn2 and Ni2? with 1 mM concentration. Hg2? ions inhibition was not only due to binding with the thiol groups but also because of interactions at residue of tryptophan or the carboxyl group of amino acids in the enzyme [52]. However, there was significant increase in the enzyme activity by Mg2?, Ca2?, isopropanol and Tween 20. This inhibition and increase in the activity of endoglucanase by metal ions and Tween-20 is in accordance with the results reported previously [40].

Conclusion We have successfully cloned, expressed and characterized an endoglucanase gene from strain B. subtilis JS2004. The recombinant enzyme had broad substrate specificity, completely hydrolyzed cello-oligosaccharides and showed stability even at high temperature. As this recombinant endoglucanse is stable in alkaline conditions, it has potential as one of the component of enzymes mixtures for degradation of cellulosic material for ethanol production.

Mol Biol Rep Acknowledgments We acknowledge the financial support from Higher Education Commission (HEC), Pakistan for this research work.

References 1. Ahmed S, Riaz S, Jamil A (2009) Molecular cloning of fungal xylanases: an overview. Appl Microbiol Biotechnol 84(1):19–35 2. Ahmed S, Aslam N, Latif F, Rajoka MI, Jamil A (2005) Molecular cloning of cellulase genes from Trichoderma harzianum. Atta-ur-Rehman/Choudhary/Khan, Eds.), Frontiers in Natural Product Chemistry. Bentham Science Publishers, The Netherlands, 1: 73–75 3. Ahmed S, Qurrat-ul-Ain, Aslam N, Naeem S, Sajjad-ur-Rehman, Jamil A (2003) Induction of xylanase and cellulase genes from Trichoderma harzianum with different carbon sources. Pak J Biol Sci 6(22):1912–1916 4. Ahmed S, Imdad SS, Jamil A (2012) Comparative study for the kinetics of extracellular xylanases from Trichoderma harzianum and Chaetomium thermophilum. Electron J Biotechnol. doi:10. 2225/vol15-issue3-fulltext-2 5. Saadia M, Ahmed S, Jamil A (2008) Isolation and cloning of cre1 gene from a filamentous fungus Trichoderma harzianum. Pak J Bot 40(1):421–426 6. Ahmed S, Bashir A, Saleem H, Saadia M, Jamil A (2009) Production and purification of cellulose-degrading enzymes from a filamentous fungus Trichoderma harzianum. Pak J Bot 41(3):1411–1419 7. Li W, Zhou Y, Ma QY, Chen YL (2009) Simultaneous cloning and expression of two cellulase genes from Bacillus subtilis newly isolated from Golden Takin. Biochem Biophys Res Commun 383(4):397–400 8. Bhat MK (2000) Cellulases and related enzymes in biotechnology. Biotechnol Adv 18(5):355–383 9. de Castro AMde, de Carvalho MLDA, Leite SGf, Pereira N (2010) Cellulases from Penicillium funiculosum: production, properties and application to cellulose hydrolysis. J Ind Microbiol Biotechnol 37(2):151–158 10. Ahmed S, Jabeen A, Jamil A (2007) Xylanase from Trichoderma harzianum: enzyme characterization and gene isolation. J Chem Soc Pak 29(2):176–182 11. Saleem F, Ahmed S, Jamil A (2008) Isolation of a xylan degrading gene from genomic DNA library of a thermophilic fungus Chaetomium thermophile ATCC 28076. Pak J Bot 40(3):1225–1230 12. Yujuan W, Wang HYJ, Zengliang Y (2009) Truncation of the cellulose binding domain improved thermal stability of endo-b1,4-glucanase from Bacillus subtilis JA18. Bioresour Technol 100(1):345–349 13. Wen T, Chen J, Lee S, Yang N, Shyur L (2005) A truncated Fibrobacter succinogenes 1, 3–1, 4-b-glucanase with improved enzymatic activity and thermotolerance. Biochemistry 44(25):9197–9205 14. Zhang M, Shi ML, Zhou Z, Yang S, Yuan ZY (2006) Production of Alcaligenes faecalis penicillin G acylase in Bacillus subtilis WB600 (pMA5) fed with partially hydrolyzed starch. Enzyme Microb Technol 39(4):555–560 15. Chaoning L, Fioronic M, Rodriguez-Roperoc F, Xuea Y, Schwanebergc U, Maa Y (2011) Directed evolution of a thermophilic endoglucanase (Cel5A) into highly active Cel5A variants with an expanded temperature profile. J Biotechnol 154(1):46–53 16. Jarboe LR, Grabar TB, Yomano LP, Shanmugan KT, Ingram LO (2007) Development of ethanologenic bacteria. Adv Biochem Eng Biotechnol 108:237–261

17. Atsumi S, Cann AF, Connor MR, Shen CR, Smith KM, Brynildsen MP, Chou KJ, Hanai T, Liao JC (2008) Metabolic engineering of Escherichia coli for 1-butanol production. Metab Eng 10(6):305–311 18. Liu H, Yu C, Feng D, Cheng T, Meng X, Liu W, Zou H, Xian M (2012) Production of extracellular fatty acid using engineered Escherichia coli. Microb Cell Fact 11:41. doi:10.1186/14752859-11-41 19. Steen EJ, Kang Y, Bokinsky G, Hu Z, Schirmer A, McClure A, Del Cardayre SB, Keasling JD (2010) Microbial production of fatty-acid-derived fuels and chemicals from plant biomass. Nature 463(7280):559–562 20. Schirmer A, Rude MA, Li X, Popova E, del Cardayre SB (2010) Microbial biosynthesis of alkanes. Science 329(5991):559–562 21. Gupta S, Adlakha N, Yazdani SS (2013) Efficient extracellular secretion of an endoglucanase and a b-glucosidase in E. coli. Protein Expr Purif 88(1):20–25 22. Lynd LR, van Zyl WH, McBride JE, Laser M (2006) Consolidated bioprocessing of cellulosic biomass: an update. Curr Opin Biotechnol 16(5):577–583 23. Sambrook J, Russel D (2001) Molecular cloning: a laboratory manual, 3rd edn. Cold Spring Harbor Laboratory Press, Cold Spring Harbor 24. Yamada YM, Koiche M, Hossan O, Kumito N, Yayoi Y, Masako O (2002) Comparison of two different methods for extraction of mitochondrial DNA from human pathogen yeast. Jpn J Infect Dis 55(4):122–125 25. Hingamp P, Broek AE, Sto¨sser G, Baker W (1999) The EMBL nucleotide sequence database. Contributing and accessing data. Mol Biotechnol 12(3):255–267 26. Yildirim N, Ciftci M, Kufreviog OI (2002) Kinetic analysis of multi enzyme systems: a case study of the closed system of creatine kinase, hexokinase and glucose 6-phosphate dehydrogenase. J Math Chem 31(1):121–130 27. Laemmli UK (1970) Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227(5259):680–685 28. Miller GL, Blum R, Glennon WE, Burton AL (1960) Measurement of carboxymethylcellulase activity. Anal Biochem 1(2):32–127 29. Bradford MM (1976) Rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem 72(1–2):248–254 30. Dienes D, Borjessonb J, Stalbrandb H, Reczey K (2006) Production of Trichoderma reesei Cel7B and its catalytic core on glucose medium and its application for the treatment of secondary fibers. Process Biochem 41(9):2092–2096 31. Haki GD, Rakshit SK (2003) Developments in industrially important thermostable enzymes: a review. Bioresour Technol 89(1):17–34 32. Li, Zhang WW, Yang MM, Chen YL (2008) Cloning of the thermostable cellulase gene from newly isolated Bacillus subtilis and its expression in Escherichia coli. Mol Biotechnol 40(2):195–201 33. Ng S, Li CW, Yeh YF, Chen PT, Chir JL, Ma CH, Yu SM, Ho TH, Tong CG (2009) A novel endo-glucanase from the thermophilic bacterium Geobacillus sp. 70PC53 with high activity and stability over a broad range of temperatures. Extremophiles 13(3):425–435 34. Ghori MI, Ahmed S, Malana MA, Jamil A (2012) Kinetics of exoglucanase and endoglucanase produced by Aspergillus niger NRRL 567. Afr J Biotechnol 11(28):7227–7231 35. Ghori MI, Ahmed S, Malana MA, Jamil A (2011) Corn stoverenhanced cellulase production by Aspergillus niger NRRL 567. Afr J Biotechnol 10(31):5878–5886

123

Mol Biol Rep 36. Jamil A, Naim S, Ahmed S, Ashraf M (2005) Production of industrially important enzymes using molecular approaches: cellulases and xylanases. In: Thangadurai D, Pullaiah T, Pedro A (eds) Balatti genetic resources and biotechnology II, vol 2. Regency publications, New Delhi, pp 143–183 37. Ogura J, Toyoda A, Kurosawa T, Chong AL, Chohnan S, Masaki T (2006) Purification, characterization, and gene analysis of cellulase (Cel8A) from Lysobacter sp. IB-9374. Biosci Biotechnol Biochem 70(10):2420–2428 38. You JL, Kima BK, Lee BH, Joa KI, Leea NK (2008) Purification and characterization of cellulase produced by Bacillus amyoliquefaciens DL-3 utilizing rice hull. Bioresour Technol 99(2):378–386 39. Bo KK, Lee BH, Leeb YJ, Jina H, Chunga CH, Lee JW (2009) Purification and characterization of carboxymethylcellulase isolated from a marine bacterium Bacullus subtilis subsp. A-53. Enzyme Microb Technol 44(6–7):411–416 40. Odeniyi OA, Onilude AA, Ayodele MA (2009) Production characteristics and properties of cellulose polygalacturonase by a Bacillus coagulans strain from a fermenting palm-fruit industrial residue. Afr J Microbiol Res 3(8):407–417 41. Gurdeep R, Bhallaa A, Adhikaria A, Bischoff KM, Hughesb SR, Christopherc LP, Sani RK (2010) Characterization of thermostable cellulases produced by Bacillus and Geo bacillus strains. Bioresour Technol 101(22):8798–8806 42. Thirumalai P, Piriyaa PS, Prabhua DIG, Vennison SJ (2011) Cellulosic ethanol production by Zymomonas mobilis harboring an endoglucanase gene from Enterobacter cloacae. Bioresour Technol 102(3):2585–2589 43. Zhuo Y, Peia X, Wu Z (2011) Introduction of glycine and proline residues onto protein surface increases the thermostability of endoglucanase CelA from Clostridium thermocellum. Bioresour Technol 102(3):3636–3638 44. Maria JM, Rosana VM, Adrian AL, Maximiliano JA, Sergio EA, Gladys MC (2006) Production of recombinant enzymes of wide

123

45.

46.

47.

48.

49.

50.

51.

52.

use for research. Elect J Biotech. doi:10.2225/vol9-issue3-full text-16 Xu Z, Shih MC, Poulton JE (2006) An extracellular exo-beta(1,3)-glucanase from Pichia pastoris: purification, characterization, molecular cloning, and functional expression. Protein Expr Purif 47(1):118–127 Peng Y, Chi ZM, Wang XH, Li J (2009) Purification and molecular characterization of exo-beta-1,3-glucanases from the marine yeast Williopsis saturnus WC91-2. Appl Microbiol Biotechnol 85(1):85–94 Anne BB, Anne BO, Tomas F, Annette P, Anette SS (1996) Pretreatment of wheat straw using combined wet oxidation and alkaline hydrolysis resulting inconvertible cellulose and hemicellulose. Biotechnol Bioeng 49(5):568–577 Zhang F, Chen J-J, Ren W-Z, Nie G-X, Ming H, Tang S-K, Li W-J (2011) Cloning, expression and characterization of an alkaline thermostable GH9 endoglucanase from Thermobifida halotolerans YIM 90462T. Bioresour Technol 102(21):10143–10146 Endo K, Hakamada Y, Takizawa S, Kubota H, Sumitomo N, Kobayashi T, Ito S (2001) A novel alkaline endoglucanase from an alkaliphilic Bacillus isolate: enzymatic properties, and nucleotide and deduced amino acid sequences. Appl Microbiol Biotechnol 57(1–2):109–116 Sharma P, Gupta JK, Vadehra DV, Dube DK (1990) Purification and properties of an endoglucanase from a Bacillus isolate. Enzyme Microb Technol 12(2):132–137 Jo KI, Lee YJ, Kim BK, Lee BH, Jung CH, Nam SW (2008) Pilot-scale production of carboxymethylcellulase from rice hull by Bacillus amyloliquefaciens DL-3. Biotechnol Bioprocess Eng 13(2):182–188 Lamed R, Tormo, Chirino AJ, Morag E, Bayer EA (1994) Crystallization and preliminary X-ray analysis of the major cellulose-binding domain of the cellulase from Clostridium thermocellum. J Mol Biol 244(2):236–237