Journal of Medical Virology

HIV-1 Prevalence and Subtype/Recombinant Distribution Among Travelers Entering China from Vietnam at the HeKou Port in the Yunnan Province, China, Between 2003 and 2012 Yajuan Wang,1 Yaobo Liang,2 Yue Feng,1 Binghui Wang,1 Yaping Li,2 Zhikun Wu,3 Jianchun Zhang,3 Zulqarnain Baloch,1 A-Mei Zhang,1 Li Liu,1 Weihong Qin,2 and Xueshan Xia1* 1

Faculty of Life Science and Technology, Center for Molecular Medicine in Yunnan province, Kunming University of Science and Technology, Yunnan, China 2 Care Center for International Travel Health in Yunnan, Yunnan, China 3 HeKou Entry-Exit Inspection and Quarantine Bureau, Yunnan, China

The aim of this study was to assess HIV-1 prevalence and the distribution of HIV-1 subtypes among travelers crossing the border at the HeKou land port. Between 2003 and 2012, 22,799 persons were randomly recruited from people entering China from Vietnam. In this crossing border population, a total of 161 (0.71%) travelers were determined as HIV-1-positive. From them, 140 HIV-1-positive serum samples were collected for RNA extraction and subsequent RT-nested PCR amplification of the group-specific antigen (gag)-RT with a length of 2.6 kb. The DNA sequences were analyzed to determine the HIV-1 subtypes/recombinants. We found that the circulating recombinant form 01_AE (CRF01_AE) was the most common HIV-1 subtype, accounting for 49.4% (41/83) of the subtyped 83 samples, followed by CRF08_BC (26.5%, 22/83) and CRF07_BC (7.2%, 6/83). Only 1 sample was classified as subtype C. Thirteen cases could not be clustered into any known subtypes or CRFs and presented as unique recombinant forms (URFs). Of them, 6 recombination patterns were identified. They had distinct structures consisting of fragments of subtypes B, C, CRF01_AE, CRF07_BC and CRF08_BC. Between 2003 and 2012, CRF01_AE and CRE08_BC were shown to be the most prevalent recombinant forms identified each year. But yearly change of each subtype is uncertain regular among in these travelers during the past decade. Understanding the distribution of HIV-1 subtypes/recombinants and how it changes across time among individuals entering China from Vietnam through this land port is crucial to establish strategies for the prevention of HIV cross-border transmission. J. Med. Virol. 9999: XX–XX, 2015. # 2015 Wiley Periodicals, Inc. C 2015 WILEY PERIODICALS, INC. 

KEY WORDS:

human immunodeficiency virus; molecular epidemiology; subtype distribution

INTRODUCTION Due to the wide use of highly active retroviral therapy and effective prevention measures, the AIDS epidemic has been effectively curbed, and the number of new HIV-1 infection has declined. However, HIV-1 infection is still a serious threat to human health, particularly in developing countries. According to the Joint United Nations Program on HIV/AIDS (UNAIDS) [2012] an estimated 35.3 (32.2–38.8) million people were living with HIV infection by the end of 2012 [Global report, 2013]. The overall national prevalence of HIV in most Asian countries remains low. However, the large size of the respective populations means that this low prevalence may still translate into a large number of Grant sponsor: Natural Science Foundation of China; Grant number: 81260248, 81360247, 81460509.; Grant sponsor: National Science and Technology Support Program of China; Grant number: 2014BAI01B01 .; Grant sponsor: Key and new product development project of Yunnan province; Grant number: 2013BC009. Yajuan Wang, Yaobo Liang, and Yue Feng contributed equally to this work.
Correspondence to: Xueshan Xia, Faculty of Life Science and Technology, Kunming University of Science and Technology, Kunming, Yunnan 650500, China. E-mail: oliverxia2000@aliyun. com Accepted 3 March 2015 DOI 10.1002/jmv.24202 Published online in Wiley Online Library (wileyonlinelibrary.com).

2

people living with HIV infection. In 2012, an estimated 4.9 (3.7–6.3) million people were living with HIV in Asia and the Pacific region, and about 350,000 individuals were newly infected [UNAIDS, 2012]. In 1989, the first case of HIV-1 local infection was identified in the Dehong prefecture of Yunnan, China [Lu et al., 2008]. Since then, the HIV infection epidemic has become more visible in China. The number of reported cases has increased annually, and HIV infection has spread throughout the country [Zhang and Ma, 2002]. According to official statistics, the number of people living with HIV in China was 780,000 at the end of 2011 [Ministry of Health of the People’s Republic of China, 2012]. HIV-1 infection in Vietnam was first reported in late 1990 in Ho Chi Minh City [Lindan et al., 1997]. After a period of HIV-1 slowly spreading among highrisk populations such as female commercial sex workers, the HIV-1 epidemic broke out among injection drug users (IDUs) in Southern Vietnam [Subcommittee, T.V.N.H.A.S., 1998]. By the end of 2005, HIV-1 had spread nationwide [UNAIDS, 2006]. An extremely high genetic diversity, caused by the reverse transcriptase (RT) enzyme being highly errorprone, is one of the major characteristics of the HIV [Preston et al.,1988]. Phylogenetically, HIV-1 can be divided into 4 groups: M (major), O (outlier), N (nonM non-O) and P. The predominant M group can be further divided into 9 subtypes (A–D, F–H, J, and K) [Hemelaar et al., 2011]. During the replication cycle of lentiviruses such as HIV, frequently occurring genetic recombinations contribute to the emergence of multiple forms of recombinant virus types [Zhang et al., 2010]. HIV-1 inter-subtype recombination has been well documented, and at least 66 circulating recombinant forms (CRFs) (http://www.hiv.lanl.gov/ content/sequence/HIV/CRFs/CRFs.html) and a myriad of unique recombinant forms (URFs) have been identified. Globally, CRFs account for about 10–20% of all new HIV-1 infections, whereas URFs are responsible for >30% of infections in regions where 2 or more subtypes co-circulate [Keele et al., 2006; Tebit and Arts, 2011]. The global distribution of HIV-1 subtypes/CRFs is not uniform. A complex HIV-1 molecular epidemic can be seen in Asia. Currently, the most commonly circulating HIV-1 subtypes/recombinants are CRF01_AE, subtypes B and C, alongside with multiple CRFs and URFs that are derived from these. Historically, widely circulating HIV-1 strains in Asia included subtypes B, B’ (a Thailand variant of subtype B, also referred to as Thai-B) [Kalish et al., 1995; Ou et al., 1993], and subtype C [Weniger et al., 1994], as well as the CRFs of CRF01_AE [Luo et al., 1995], CRF07_BC, and CRF08_BC [Yang et al., 2002]. New CRFs such as CRF34_01B in Thailand [Tovanabutra et al., 2007], CFR52_01B in Malaysia [Kijak et al., 2007], and CRF61_BC in China [Li et al., 2013] have been identified in Asian countries. Moreover, many URFs have been detected in Asia, particularly in Myanmar J. Med. Virol. DOI 10.1002/jmv

Wang et al.

and the Western Yunnan province of China [Lu et al., 2008]. In Vietnam, CRF01_AE is the major circulating HIV-1 subtype. Sporadically, HIV-1 subtype B infections have been observed [Liao et al., 2009]. Yunnan, the most Southwestern province of China bordering the famous heroin-producing area named “Golden triangle” was once considered the HIV-1 epicenter in China. Yunnan currently has the highest number of reported HIV-1 infections. By the end of 2011, the number of reported HIV/AIDS cases in Yunnan was 95,296, accounting for 21.0% of the total national infection individuals [Chen et al., 2013]. In Yunnan, the most prevalent HIV-1 subtypes include subtypes B and C, CRF01_AE, CRF07_BC, and CRF08_BC. Of these, subtypes B, C, and CRF01AE are considered to have been introduced from Southeast Asian countries through illegal drug trafficking [Chen et al., 2013]. Their co-circulating has led to the occurrence of many HIV-1 recombinants, including CRF07_BC, CRF08_BC, the recently identified CRF65_BC (http://www.hiv.lanl.gov/components/ sequence/HIV/search/search.comp), and numerous URFs [Li et al., 2012]. Although HIV transmission from Southeastern Asian countries to China has been well documented, how HIV is spread across the border from Vietnam to China has remained unclear. HeKou is the most southern city in the Yunnan province and borders Lao Cai, the most northern city of Vietnam. Due to its special geographic location, the HeKou port is the major land port between Yunnan and Vietnam, and a large number of individuals exit and enter through the port every day for business. According to data released by the division of exit and entry administration in Yunnan, up to 3,029,347 travelers crossed the border at the HeKou port in 2013. It is therefore important to analyze HIV-1 prevalence and the distribution of HIV-1 subtypes and CRFs among this population. In this study, we monitored HIV-1 infection rates of entry travelers at the HeKou port from 2003 to 2012. Moreover, we analyzed the distribution of HIV-1 subtypes/recombinants among this population. MATERIALS AND METHODS Ethical Statement Oral consent was obtained from all participants in this study. The institutional ethical committee of the Kunming University of Science and Technology approved the study. Study Population and HIV-1 Detection Between 2003 and 2012, individuals entering China at the HeKou port were randomly recruited for monitoring of HIV infections. Serum samples were used to detect HIV-1 using preliminary dipstick screening (Alere Determine HIV-1/2, Alere Medical Co., Ltd.; Japan) at the local HIV testing outreach lab. HIV-1-positive samples

HIV-1 Prevalence Among Travelers Entering at the HeKou Port

3

TABLE I. PCR Primers Used in the Study Regiona

gag

gag-prot

Pro-RT a b

Name

Sequences (5’-3’)

Positionb

gag-L gag-E2 GUX GDX gag2WF gag2WR gag2NF gag2NR gag3WF gag3WR gag3NF gag2NR

TCGACGCAGGACTCGGCTTGC TCCAACAGCCCTTTTTCCTAGG AGGAGAGAGATGGGTGCGAGAGCGTC GGCTAGTTCCTCCTACTCCCTGACAT AARGAACCCTTYAGAGAYTATGTAGA TATGGATTTTCAGGCCCAATTTTTG GTAAAAAAYTGGATGACAGAMACCTTG ACTTTTGGKCCATCCATYCC GGAAACCAAAAATGATAGGRGGAATTGGAGG CTGTAYTTCTGCTAYYAAKTCTTTTGATGGG GTGGAAAMARRGCTATAGGTACAG TCTGCCARYTCTARYTCTGCTTC

686–707 2011–2032 781–806 1836–1861 1657–1682 2692–2716 1726–1752 2592–2611 2377–2407 3509–3539 2452–2475 3441–3462

Genomic regions amplified. Nucleotide positions with reference to the numbering of HIV HXB2 strain (Genbank accession number K03455).

TABLE II. Recruited Entry Travelers at Hekou Port in Last Decade and Annual HIV Infection Among Them

Recruited Travelers HIV positive cases Infection Rates(%)

2003

2004

2005

2006

2007

2008

2009

2010

2011

2012

2096 13 0.6

1899 11 0.58

2270 9 0.4

3125 29 0.9

2121 8 0.38

2323 22 0.95

1994 4 0.2

2595 29 1.1

2371 17 0.72

2005 19 0.95

were transported to the central lab in Kunming within 12 hr for screening for HIV antibodies with an enzyme-linked immunosorbent assay (Beijing BGIGBI Biotech Co., Ltd.; China). Positive samples were subsequently confirmed using western blot analysis (MP Diagnostics Co., Ltd.; Singapore). HIV-1positives samples were stored at 80˚C until subtype analysis was performed. HIV-1 RNA Extraction, Amplification, and Sequencing Viral RNA was extracted from 100 mL serum using the High Pure Viral RNA Kit (Roche; Los Angeles, California) according to the manufacturer’s instructions. The RNA was subjected to reverse transcription and nested polymerase chain reaction (RT-PCR) to amplify the fragments of HIV-1 gag (1,155 base pairs [bp]), gag-prot (885 bp), and partial RT genes (1,010 bp) with primers designed for this study (Table I). The first RT-PCR were conducted using the Takara One Step RNA PCR Kit (AMV) (Takara; Dalian, China) with the outer primers under the thermal condition consisted of initial reverse transcription at 50˚C for 30 min, and then 40 PCR cycles each including denaturation at 94˚C for 3 min, annealing at 50˚C for 30 s and elongation at 72˚C for 1.5 min, and a final elongation step at 72˚C for 7 min. The second PCR was conducted using Premix Taq (Takara, Dalian, China) with inner primers under the same PCR thermal condition. PCR products were authenticated by electrophoresis and purified using an agarose gel DNA extraction kit (Takara,

Dalian, China) for commercial sequencing (Invitrogen, Beijing, China). Phylogenetic and Recombination Analyses Sequences were assembled and edited using the integrated Clustal X 1.83 program [Aiyar, 2000] and BioEdit Ver 7.0.8 [Hall, 1999]. The reference sequences derived from the HIV Sequence Database (www. hiv.lanl.gov/content/sequence.html) included the major HIV-1 subtypes and CRFs, particularly the strains previously characterized in China and Southeast Asian countries. Phylogenetic analyses were performed using the neighbor-joining method based on the Kimura 2-parameter model with 1000 bootstrap replicates in MEGA version 5.0 [Tamura et?al., 2011]. Estimates of evolutionary rate and the time of the most recent common ancestor (tMRCA) were performed using the Bayesian Markov chain Monte Carlo (MCMC) inference under the relaxed log-normal molecular clock model in BEAST version 1.6.1 package. HIV-1 recombinant structure was screened using the Recombinant Identification Program available from the HIV database (http://www.hiv.lanl.gov/ content/sequence/RIP/RIP.html). The suspected novel recombinant strains were subjected to bootscanning and informative-site analysis using SimPlot version 3.5.1 with bootscan window sizes of 200 bases, a step size of 20 bases, and 100 replicates [Lole et al., 1999]. Sequences of HIV-1 gag-RT gene (2.6 kb) obtained in this study were submitted to GenBank get the accession numbers as KM395730 to KM395811, and KM405336. J. Med. Virol. DOI 10.1002/jmv

4

Wang et al.

RESULTS Traveler Demographic Characteristics and HIV1 Infection Rates Between 2003 and 2012, a total of 22,799 individuals entering China at the HeKou port were randomly recruited for HIV-1 detection. The number of individuals was monitored between 2,000 and 3,000 annually. A total of 161 travelers entering China were HIV-1-infected. This number accounted for 0.71% of the total prevalence rate of HIV-1 in these travelers crossing the border. No significant difference in HIV1 prevalence rates between the sampling years was found (Table II). Of the 161 HIV-1-infected travelers, 72 (44.7%) were men and 89 (55.3%) women (sex ratio 1:1.236). Regarding to nationality, 80 (49.7%) were Chinese and 81 (50.3%) Vietnamese. The majority of the population was