423
Rapid identification of toxigenic Clostridium difficile by polymerase chain reaction SIR,- The pathogenicity of Clostridium difficile is in part related to the production of toxin A (enterotoxin) and toxin B (cytotoxin). The diagnosis of C difficile associated disease depends on the isolation and identification of the organism from stool samples and the detection of toxin B by a cytopathic effect in tissue culture and its neutralisation by C sordellii antitoxin. Toxin A can be detected by ELISA. However, these procedures are time-consuming and it takes up to 5 days to isolate and identify C difficile and to differentiate between toxigenic and non-toxigenic strains. We report the application of the polymerase chain reaction (PCR) in the detection and identification of toxigenic C difficile strains within 5 hours. A 1947 bp fragment of the clone expressing the toxin A gene in Escherichia coli K121 was sequenced (EMBL accession no X17194). The sequence represented a continuous open reading frame, of which 1935 bp can be accounted for by four groups of repeating nucleotide units with 88 to 100% identity. The repeat sequence probably encodes for the receptor-binding portion of the toxin A gene.2 Two primers (BW 69 and BW 70) were synthesised. These primers amplified 63 bp tandemly arranged repeat DNA of sequence: 5’ GAAGCAGCTACTGGATGGCAAACTATTGATGGTAAAAAT 3’ BK 69 →
← BN 70
PCR with these primers yielded a characteristic profile of at least five bands of 63 bp or multiples of 63 bp in length when amplified samples were subjected to electrophoresis on 4% agarose gel. The method took only 5 hours from the boiled bacterial extract to visualisation of the DNA profile. The thirty cycle PCR consisted of a rapid two-step process of denaturation (94°C) for 30 s and annealing (46°C) for 30 s. All of the 62 toxigenic strains and none of the 23 non-toxigenic strains of C difficile gave positive profiles. Of the 24 other clostridia species tested only 3 C sordellii strains gave positive profiles; however, these profiles differed in possessing only three or four of the characteristic bands. C sordellii’s, a haemorrhagic toxin, crossreacts immunologically and shows DNA homology with toxin A.2,3 PCR amplification was successful when as few as 20 toxigenic colony producing bacteria were used and the method could detect this level of toxigenic C difficile even in mixed cultures on agar plates or in broth or in the presence of 108 non-toxigenic bacteria. This method, which does not require hybridisation technology or a radiolabel, should prove useful for the rapid identification of
C difficile from pure or mixed culture and, if adapted, it could be applied directly to clinical specimens. This work was supported by the Wellcome Trust. Some of the work given in this letter is the subject of British Patent Application No: 89292932. BRENDAN WREN
toxigenic
Department of Medical Microbiology, St Bartholomew’s Hospital Medical College, London EC1A 7BE, UK
CHRISTOPHER CLAYTON
SOAD TABAQCHALI
1. Wren BW, Clayton CL, Mullany PP, Tabaqchali S. Molecular cloning and expression of Clostridium difficile toxin A in Eschezzchza coil K12. FEBS 1987; 225: 82-86. 2. Price SB, Phelps CJ, Wilkins TD, Johnson JJ. Cloning of the carbohydrate-binding
portion of the toxin A gene of Clostridium difficile. Curr Microbiol 1987; 16: 5580. 3. Martinez RD, Wilkins TD. Purification and characterisation of Clostridium sordellii hemorrhagic toxin and cross-reactivity with Clostridium difficile toxin A (enterotoxin). Infect Immun 1988; 56: 1215-21.
Identification of Mycobacterium tuberculosis by polymerase chain reaction SIR,-Dr Brisson-Noel and co-workers (Nov 4, p 1069) described the use of the polymerase chain reaction (PCR) for the diagnosis of tuberculous infections. This application of PCR is especially relevant in developing countries, where tuberculosis is common and where anti-tuberculosis drugs are largely administered empirically since confirmation of the diagnosis by culture is a tedious process. In our PCR test for Mycobacterium tuberculosis we use a sequence which is specific for M tuberculosis, whereas Noel et al have used the 65 kD antigen coding sequence. We chose gene sequence coding for the MPB 64 protein since this seems to be specific for the M tuberculosis complex. A 240 base-pair region (nt 460-700) was amplified with the synthetic oligonucleotide primers 5’-TCCGCTGCCAGTCGTCTTCC-3’ and 5’-GTCCTCGCGAGTCTAGGCCA-3’. The Taq polymerase was from Perkin Elmer Cetus (Emeryville, California). After thirty cycles of amplification in a thermal cycler (Coy Lab Products, Ann Arbor, Michigan) the amplified products were run on a 2% agarose gel and confirmed by Southern hybridisation using an oligonucleotide probe from the mid-portion of the sequence used for amplification (5’-CTTCAACCCGGG-
GGAGT-3’). We have evaluated the specificity of the assay with a battery of DNA templates from eukaryotic and prokaryotic sources. These included DNAs from mycobacterial species belonging to different Runyon groups and commonly encountered contaminant myocbacteria. Amplification was seen only with M tuberculosis complex and not with any of the other DNA templates tested. This provides an advantage over the method described by Brisson-Noel et al in that diagnosis can be achieved simply by agarose gel electrophoresis without the need for confirmation by hybridisation. EVALUATION OF PCR IN CLINICAL SPECIMENS
*Not M tuberculosis.
So far we have tested 23 clinical specimens and the results are encouraging (table). Of 10 PCR positive specimens 8 were also positive by smear and culture; the other 2 were negative by smear and culture. In 2 urine specimens PCR was negative but acid-fast bacilli were found on smear examination; on identification after culture these 2 strains turned out to be mycobacteria other than M tuberculosis. These findings demonstrate the specificity and sensitivity of our assay in the detection of M tuberculosis.
PCR to identify toxigenic C difficile. Lanes 1-6= toxigenic C difficile strains B1, D1, E1, Wl, X1, and Z1. Lane7= DNAsizemarkerof base pairs of 67, 80,110,147,190, 242, 267, 404 and greater size (Bsh I and Msp I digests of pHC314)
Department of Microbiology, All India Institute of Medical Sciences, New Delhi 110029, India 1.
P. SHANKAR N. MANJUNATH R. LAKSHMI B. ADITI P. SETH SHRINIWAS
Yamaguchi R, Matsuo K, Yamazaki A, et al Cloning and characterization of the gene for immunogenic protein MPB 64 of Mycobacrerium bovis BCG. Infect Immun 1989; 57: 283-88
Rapid identification of toxigenic Clostridium difficile by polymerase chain reaction SIR,- The pathogenicity of Clostridium difficile is in part related to the production of toxin A (enterotoxin) and toxin B (cytotoxin). The diagnosis of C difficile associated disease depends on the isolation and identification of the organism from stool samples and the detection of toxin B by a cytopathic effect in tissue culture and its neutralisation by C sordellii antitoxin. Toxin A can be detected by ELISA. However, these procedures are time-consuming and it takes up to 5 days to isolate and identify C difficile and to differentiate between toxigenic and non-toxigenic strains. We report the application of the polymerase chain reaction (PCR) in the detection and identification of toxigenic C difficile strains within 5 hours. A 1947 bp fragment of the clone expressing the toxin A gene in Escherichia coli K121 was sequenced (EMBL accession no X17194). The sequence represented a continuous open reading frame, of which 1935 bp can be accounted for by four groups of repeating nucleotide units with 88 to 100% identity. The repeat sequence probably encodes for the receptor-binding portion of the toxin A gene.2 Two primers (BW 69 and BW 70) were synthesised. These primers amplified 63 bp tandemly arranged repeat DNA of sequence: 5’ GAAGCAGCTACTGGATGGCAAACTATTGATGGTAAAAAT 3’ BK 69 →
← BN 70
PCR with these primers yielded a characteristic profile of at least five bands of 63 bp or multiples of 63 bp in length when amplified samples were subjected to electrophoresis on 4% agarose gel. The method took only 5 hours from the boiled bacterial extract to visualisation of the DNA profile. The thirty cycle PCR consisted of a rapid two-step process of denaturation (94°C) for 30 s and annealing (46°C) for 30 s. All of the 62 toxigenic strains and none of the 23 non-toxigenic strains of C difficile gave positive profiles. Of the 24 other clostridia species tested only 3 C sordellii strains gave positive profiles; however, these profiles differed in possessing only three or four of the characteristic bands. C sordellii’s, a haemorrhagic toxin, crossreacts immunologically and shows DNA homology with toxin A.2,3 PCR amplification was successful when as few as 20 toxigenic colony producing bacteria were used and the method could detect this level of toxigenic C difficile even in mixed cultures on agar plates or in broth or in the presence of 108 non-toxigenic bacteria. This method, which does not require hybridisation technology or a radiolabel, should prove useful for the rapid identification of
C difficile from pure or mixed culture and, if adapted, it could be applied directly to clinical specimens. This work was supported by the Wellcome Trust. Some of the work given in this letter is the subject of British Patent Application No: 89292932. BRENDAN WREN
toxigenic
Department of Medical Microbiology, St Bartholomew’s Hospital Medical College, London EC1A 7BE, UK
CHRISTOPHER CLAYTON
SOAD TABAQCHALI
1. Wren BW, Clayton CL, Mullany PP, Tabaqchali S. Molecular cloning and expression of Clostridium difficile toxin A in Eschezzchza coil K12. FEBS 1987; 225: 82-86. 2. Price SB, Phelps CJ, Wilkins TD, Johnson JJ. Cloning of the carbohydrate-binding
portion of the toxin A gene of Clostridium difficile. Curr Microbiol 1987; 16: 5580. 3. Martinez RD, Wilkins TD. Purification and characterisation of Clostridium sordellii hemorrhagic toxin and cross-reactivity with Clostridium difficile toxin A (enterotoxin). Infect Immun 1988; 56: 1215-21.
Identification of Mycobacterium tuberculosis by polymerase chain reaction SIR,-Dr Brisson-Noel and co-workers (Nov 4, p 1069) described the use of the polymerase chain reaction (PCR) for the diagnosis of tuberculous infections. This application of PCR is especially relevant in developing countries, where tuberculosis is common and where anti-tuberculosis drugs are largely administered empirically since confirmation of the diagnosis by culture is a tedious process. In our PCR test for Mycobacterium tuberculosis we use a sequence which is specific for M tuberculosis, whereas Noel et al have used the 65 kD antigen coding sequence. We chose gene sequence coding for the MPB 64 protein since this seems to be specific for the M tuberculosis complex. A 240 base-pair region (nt 460-700) was amplified with the synthetic oligonucleotide primers 5’-TCCGCTGCCAGTCGTCTTCC-3’ and 5’-GTCCTCGCGAGTCTAGGCCA-3’. The Taq polymerase was from Perkin Elmer Cetus (Emeryville, California). After thirty cycles of amplification in a thermal cycler (Coy Lab Products, Ann Arbor, Michigan) the amplified products were run on a 2% agarose gel and confirmed by Southern hybridisation using an oligonucleotide probe from the mid-portion of the sequence used for amplification (5’-CTTCAACCCGGG-
GGAGT-3’). We have evaluated the specificity of the assay with a battery of DNA templates from eukaryotic and prokaryotic sources. These included DNAs from mycobacterial species belonging to different Runyon groups and commonly encountered contaminant myocbacteria. Amplification was seen only with M tuberculosis complex and not with any of the other DNA templates tested. This provides an advantage over the method described by Brisson-Noel et al in that diagnosis can be achieved simply by agarose gel electrophoresis without the need for confirmation by hybridisation. EVALUATION OF PCR IN CLINICAL SPECIMENS
*Not M tuberculosis.
So far we have tested 23 clinical specimens and the results are encouraging (table). Of 10 PCR positive specimens 8 were also positive by smear and culture; the other 2 were negative by smear and culture. In 2 urine specimens PCR was negative but acid-fast bacilli were found on smear examination; on identification after culture these 2 strains turned out to be mycobacteria other than M tuberculosis. These findings demonstrate the specificity and sensitivity of our assay in the detection of M tuberculosis.
PCR to identify toxigenic C difficile. Lanes 1-6= toxigenic C difficile strains B1, D1, E1, Wl, X1, and Z1. Lane7= DNAsizemarkerof base pairs of 67, 80,110,147,190, 242, 267, 404 and greater size (Bsh I and Msp I digests of pHC314)
Department of Microbiology, All India Institute of Medical Sciences, New Delhi 110029, India 1.
P. SHANKAR N. MANJUNATH R. LAKSHMI B. ADITI P. SETH SHRINIWAS
Yamaguchi R, Matsuo K, Yamazaki A, et al Cloning and characterization of the gene for immunogenic protein MPB 64 of Mycobacrerium bovis BCG. Infect Immun 1989; 57: 283-88
