Clinical Pediatrics http://cpj.sagepub.com/
Rapid Diagnosis and Discrimination of Bacterial Meningitis in Children Using Gram Probe Real-Time Polymerase Chain Reaction Dong Ao, Li Wei, Gao Hui-Hui, Tao Ran, Shang Shi-Qiang and Rao Yue-Li CLIN PEDIATR published online 1 May 2014 DOI: 10.1177/0009922814532309 The online version of this article can be found at: http://cpj.sagepub.com/content/early/2014/04/30/0009922814532309
Published by: http://www.sagepublications.com
Additional services and information for Clinical Pediatrics can be found at: Email Alerts: http://cpj.sagepub.com/cgi/alerts Subscriptions: http://cpj.sagepub.com/subscriptions Reprints: http://www.sagepub.com/journalsReprints.nav Permissions: http://www.sagepub.com/journalsPermissions.nav
>> OnlineFirst Version of Record - May 1, 2014 What is This?
Downloaded from cpj.sagepub.com at UNIVERSITE LAVAL on June 10, 2014
532309
research-article2014
CPJXXX10.1177/0009922814532309Clinical PediatricsAo et al
Original Article
Rapid Diagnosis and Discrimination of Bacterial Meningitis in Children Using Gram Probe Real-Time Polymerase Chain Reaction
Clinical Pediatrics 1–6 © The Author(s) 2014 Reprints and permissions: sagepub.com/journalsPermissions.nav DOI: 10.1177/0009922814532309 cpj.sagepub.com
Dong Ao, MD1, Li Wei, MD1, Gao Hui-Hui, PhD1, Tao Ran, PhD1, Shang Shi-Qiang, MD1, and Rao Yue-Li, MD2
Abstract In this study, we developed a method of simultaneous detection and discrimination of bacteria in cerebrospinal fluid (CSF) with gram probe real-time polymerase chain reaction (PCR). Our results showed 25 clinical strains representing 13 gram-positive and 12 gram-negative bacterial species. They were identified correctly with the corresponding gram probe. The standard curve showed that the amplification efficiency of templates with different concentrations of bacteria was almost the same with a potential detection limit of 10 colony-forming units/mL. A total of 482 children who were clinically suspected of bacterial meningitis were included in this study. A total of 1.0 mL of CSF was collected from every child and was subjected to gram probe–based PCR (GP-PCR), CSF culture, and CSF routine analysis. The positive rate of the GP-PCR array was (32/482, 6.64%) significantly higher than that of CSF culture (23/482, 4.77%). GP-PCR was proved to be an excellent technique for rapid and accurate diagnosis and discrimination of bacterial meningitis, and hence its use as a diagnostic tool in future seems very promising. Keywords bacterial meningitis, gram probe real-time PCR, children
Introduction Bacterial meningitis (BM) is an acute inflammation that affects the central nervous system with high rate of morbidity and mortality.1,2 Patients with BM need immediate medical assessment and treatment. Its main pathogens are meningococcus, Haemophilus influenzae, Streptococcus pneumoniae, and so on, which belong to different genus and need different treatments.3-5 However, dilemmas exist in the treatment of these patients because of the delay in identification of causative organism and antibiotic administration.5 Previous etiologic diagnose mainly relied on cerebrospinal fluid (CSF) culture to identify the causative organism and then antibiotics were chosen by in vitro antibiotic susceptibility testing.6,7 Although cerebrospinal fluid (CSF) culture technique is the gold standard for BM confirmation in the clinical works, suspected samples still should be incubated for 5 days or even longer until they show continuous positive results.5-7 Moreover, the culture results may be false negative when fastidious or slowly growing bacteria are involved and when samples have been previously treated with antibiotics.8
Immunological techniques were also used for BM confirmation, but they present low sensitivity and may be cross-reactive. In these cases, previous diagnostic methods of BM may cause a delayed treatment.5 Therefore, a more rapid and sensitive detection method is required for early and effective treatment of BM. Recently, real-time polymerase chain reaction (RT-PCR) technique has showed the potential to provide a rapid, accurate, and sensitive diagnosis of bacteria and pathogens.9-12 The conserved region of the 16S rRNA gene has been used in RT-PCR technology to identify bacteria in clinical practice. This broad-range bacterial PCR technology can detect thousands of bacterial species but unable to distinguish between different species of bacterial pathogens.5,6,12 To overcome this defect, gram 1
Children’s Hospital of Zhejiang University School of Medicine, Hangzhou, People’s Republic of China 2 Hospital of PLA, Hangzhou, People’s Republic of China Corresponding Authors: Shang Shi-Qiang, Children’s Hospital of Zhejiang University School of Medicine, Hangzhou 310013, People’s Republic of China Email: [email protected]
Downloaded from cpj.sagepub.com at UNIVERSITE LAVAL on June 10, 2014
2
Clinical Pediatrics
Table 1. Clinical Bacteria Strains Detected by Gram Probe–Based Polymerase Chain Reaction (GP-PCR) Using a Pair of Specific Probes. Species Gram positive
Gram negative
Enterococcus faecium Staphylococcus epidermidis Streptococcus agalactiae Mlicrococcus scarlatinae Staphylococcus simulans Staphylococcus haemolyticus Staphylococcus aureus Staphylococcus capitis Staphylococcus hominis Enterococcus gallinarum Nocardia asteroides Bacillus subtilis Corynebacterium striatum Ochrobactrum anthropi Salmonella enteritidis Acinetobacter baumannii Escherichia coli Pseudomonas aeruginosa Haemophilus influenzae Klebsiella pneumoniae Enterobacter cloacae Burkholderia cepacia Achromobacter xylosoxidans Branhamella catarrhalis Neisseria meningitides
PCR Ct
Gram+ Probe
Gram− Probe
20.08 ± 0.24 18.82 ± 0.32 19.79 ± 0.38 19.49 ± 0.58 21.78 ± 0.19 19.36 ± 0.67 20.05 ± 0.52 20.03 ± 0.43 21.70 ± 1.02 20.04 ± 0.22 20.84 ± 0.15 21.19 ± 0.69 19.11 ± 0.34 21.79 ± 0.46 20.22 ± 0.35 21.66 ± 0.24 22.73 ± 0.31 21.00 ± 0.12 21.21 ± 0.36 19.55 ± 0.68 20.63 ± 0.52 20.97 ± 0.33 19.79 ± 0.54 18.08 ± 0.23 20.20 ± 0.77
G+ G+ G+ G+ G+ G+ G+ G+ G+ G+ G+ G+ G+
G− G− G− G− G− G− G− G− G− G− G− G−
probe–based RT-PCR (GP-PCR) system involving the 16S rRNA gene was established, which was only used in diagnosis of bacterial neonatal sepsis in the previous study and showed high specificity and sensitivity.13 In this study, we used this GP-PCR system to detect the clinical bacteria in CSF samples and discriminate them into grampositive and gram-negative. A total of 482 CSF specimens from children with suspected bacterial infections were evaluated. This system would provide a new early guidance for clinical treatment in children with BM.
Materials and Methods Bacterial Strains The clinical bacterial strains used in this study are listed in Table 1. Bacteria were obtained in the form of frozen cell pellets, reaks, or lyophilized cells. Prior to DNA extraction, each strain was streaked on chocolate or blood agar and examined for the proper colony morphology. The total human genome, cytomegalovirus (CMV), hepatitis B virus (HBV), and Epstein–Barr virus (EBV) were used as negative controls.
Clinical Cerebrospinal Fluid Samples and Patients From January 2010 to January 2013, a total of 482 different CSF specimens were collected from patients in the neonatal ward and the neonatal intensive care unit of Children’s Hospital, Zhejiang University, Hangzhou, People’s Republic of China. The criteria for patients enrolled in this study were that they were suspected to be BM patients with fever, headache, vomiting, irritability, lethargy, or seizures. The ages of the 482 patients (215 female and 267 male) ranged from 1 day to 10 years. All these samples were detected by both CSF culture method and GP-PCR technique. The study was approved by the Medical Ethics Committee of the Medical College, and informed consent was obtained.
Primers and Gram Probes The primers and probes were designed on the basis of identity within the 16S rRNA gene following the alignment of sequences of the group’s clinical bacterial pathogens outlined in Table 2. The gram-positive probe
Downloaded from cpj.sagepub.com at UNIVERSITE LAVAL on June 10, 2014
3
Ao et al Table 2. Primers and Probes Used in This Study.
Statistical Analysis
Primer/Probe
The results were analyzed using SPSS software (version 11.5). Quantitative data were presented as the mean ± standard deviation. Mc Nemar’s test with the continuity correction was performed to analyze the relationship between GP-PCR and blood culture methods. Twotailed P value of less than .05 was considered to be statistically significant.
Forward primer Reverse primer Gram+ probe Gram− probe
Sequence (5′to 3′) GCAACGCGAAGAACCTTACC CGCTCGTTGCGGGACTTA FAM-TGACGACAACCATGCACCACCTBHQ1 HEX-ACGACAGCCATGCAGCACCTBHQ1
was the reverse complement of nucleotides from the Staphylococcus aureus 16S rRNA gene. The gram-negative probe was the reverse complement of nucleotides from the Escherichia coli 16S rRNA gene. The genes amplified by primers and probes were identified using the BLAST tool database. The primers and probes were synthesized by Takara Company.
DNA Extraction DNA was extracted with the QIAamp DNA blood mini kit (Qiagen, Valencia, CA). The assay was performed according to the manufacturer’s instructions. DNA was extracted from 200 µL CSF. Twenty microliters of Qiagen proteinase K (20 mg/mL) was added for every 200 µL of CSF processed, along with an equal volume (200 µL) of buffer AL, and the sample was incubated for 30 minutes at 56°C. After incubation, an equal volume (200 µL) of 100% ethanol was added, and the resulting lysate was loaded onto the QIAamp DNA mini kit column (Qiagen) and washed with 500 µL of buffers AW1 and AW2, successively. Finally, the purified nucleic acids were eluted with 100 µL of Qiagen buffer AE. A 0.2-µm filter was used to filter the following reagents before use: proteinase K, ethanol, AW1, AW2, and Qiagen buffer AE.
Real-Time PCR The RT-PCR amplification was performed in a total volume of 50 µL with the ABI7500 Detection System. The reaction mixtures consisted of 400 nM (each) forward and reverse primers, 100 nM (each) gram-positive and gram-negative, respectively, fluorescence-labeled specific probes, 1U of Taq DNA polymerase (TAKARA, Otsu, Shiga, Japan), 5 µL of template DNA, and water was added to the final volume of 50 µL for each sample. The PCR mixture was filtered with a 0.22-µm filter device (Millipore Corp, Billerica, MA). Positive and negative controls were included throughout the procedure. “No-template” controls with water instead of template DNA were incorporated in each run under the following conditions: 94°C for 2 minutes and 40 cycles of 94°C for 15 seconds and 60°C for 45 seconds.
Results Specificity of GP-PCR Twenty five clinical standard bacterial strains (13 grampositive and 12 gram-negative bacterial species) were detected with GP-PCR. All the gram-positive bacteria were detected with fluorescence signals with the Ct values ranging from 18.82 to 21.78. Fluorescence was not found in the gram-negative bacteria with the gram-positive probe. When tested with the gram-negative probe, DNAs from all of the gram-negative species were positive, with a range of Ct values from 18.08 to 22.73 (Table 1). Fluorescence was not found in the gram-positive bacteria with the gram-negative probe. No fluorescence was detected and no cross-reaction was found to DNAs extracted from the human genome, CMV, HBV, and EBV in this test.
Sensitivities of GP-PCR To determine the detection range, Staph aureus (grampositive bacteria) and E coli (gram-negative bacteria) were used as control for standard curve analysis, each in triplicate. We prepared a 10-fold dilution series from 107 colony-forming units/mL (CFU/mL) to 101 CFU/mL. Our serial dilutions of the bacteria revealed that the detection range of the RT-PCR method was at least from 101 to 107 CFU/mL (Figure 1). Data were then subjected to log-linear analysis to generate a standard curve for calculation of unknowns. The standard curves regularly exhibited high R2 values (>0.99).
Results of GP-PCR and CSF Culture A total of 484 CSF samples were analyzed by both CSF culture and GP-PCR. The result showed that 32 samples were positive (32/482, 6.64%) with GP-PCR and 23 were positive (23/482, 4.77%) with CSF culture (Table 3). The positive rate of GP-PCR was significantly higher than that of CSF culture (P < .001). In comparison with the bacterial culture, 23 of the 32 qRT-PCR positive samples were identified successfully in CSF culture (23/32, 71.9%).
Downloaded from cpj.sagepub.com at UNIVERSITE LAVAL on June 10, 2014
4
Clinical Pediatrics
Figure 1. Standard curves of the gram stain–specific probes from serial dilutions of bacteria.
Table 3. Overall Results Obtained by GP-PCR Compared With CSF Culture. CSF Culture Result PCR Result Positive Negative Total
Positive
Negative
Total
23 0 23
9 436 459
32 450 482
Abbreviations: GP-PCR, gram probe–based polymerase chain reaction; CSF, cerebrospinal fluid.
Table 4. Comparison of CSF Culture, CSF Routine Analysis, and GP-PCR Results From 32 Patients. No. of Samples 9 2 1 1 4 4 2 2 1 1 5
CSF Culture
CSF Routine Analysis
Gram+/ Gram−
Escherichia coli Klebsiella pneumoniae Flavobacterium meningosepticum Enterobacter cloacae — Streptococcus pneumoniae Streptococcus agalactiae Staphylococcus epidermindis Staphylococcus aureus Listeria monocytogenes —
Abnormal Abnormal Abnormal Abnormal Abnormal Abnormal Abnormal Abnormal Abnormal Abnormal Abnormal
G− G− G− G− G− G+ G+ G+ G+ G+ G+
Abbreviations: CSF, cerebrospinal fluid; GP-PCR, gram probe–based polymerase chain reaction.
As shown in Table 4, CSF routine analysis was performed on all 32 samples. The data showed that 23 CSF culture-positive and GP-PCR positive samples were all abnormal in CSF routine analysis. For 9 samples CSF culture-negative and GP-PCR-positive samples, CSF
routine analysis result was abnormal with increase in WBC (white blood cell) and decrease in glucose, which indicated that GP-PCR result is accurate in diagnosis of bacterial meningitis.
Discussion Pathogen examination plays an extremely critical role in the diagnosis and treatment of bacterial meningitis with antibiotics. Because of the high mortality of infection in the central nervous system1-5, the early detection and rapid differentiation of bacteria and rapid treatment, play an important role in the reduction of infant mortality resulting from BM.6,7 Currently, CSF culture and CSF routine analysis are usually used as standard methods for diagnosis of clinical samples suspected to be BM.5 However, such methods cannot provide a rapid, sensitive, and specific diagnosis result. The parameters in CSF routine analysis usually involved cell counts, total protein concentration, and glucose concentration varying over a wide range. There are no conspicuous microbiological and chemical abnormalities in CSF routine analysis and CSF culture in some patients whose clinical manifestation of BM are obvious. CSF culture may also lead to false-negative results when fastidious or slowly growing bacteria are involved or when samples are obtained after antimicrobial therapy has been started. Moreover, CSF culture method requires at least 48 hours to 72 hours for bacterial incubation, which affects the early treatment of BM patients.5,6,13 RT-PCR is a promising tool for the detection of bacterial DNA from biological fluid samples.9-11 In our previous research, we used fluorogenic quantitative (FQ)-PCR, which targeted the conserved region of 16S rRNA gene to detect bacterial DNA in children with
Downloaded from cpj.sagepub.com at UNIVERSITE LAVAL on June 10, 2014
5
Ao et al BM.5 This method showed high specificity and sensitivity in the identification of bacterial strains. In this study, we described a gram-specific probe RT-PCR method, which targeted the conserved region of 16S rRNA gene in CSF samples. This method could simultaneously detect and discriminate the clinically relevant gram-positive and gram-negative bacteria from CSF samples directly. At the same time, DNA extracted from the human genome, CMV, HBV, or EBV was also detected as negative control. No fluorescence was detected, and no cross-reaction was found in these negative controls. In 482 patients, a total of 32 patients were tested positive for bacteria. Among these 32 patients, 17 patients were detected to be G−, and 15 patients were G+. On the basis of the subtypes provided by GP-PCR method, different clinical treatments were taken, and the clinical outcomes supported bacterial subtypes. So GP-PCR method showed high specificity in detection and identification of bacterial strains. The GP-PCR system was not only more specific for the bacteria detection than CSF culture but also more sensitive than CSF culture. Our study showed that the detection range of the RT-PCR method was at least from 101 to 107 copies/mL. More important, antibiotic treatment for CSF samples detection does not interfere with this method, and it eliminates the possibility of false-negative results because of antibiotic treatment. Both dead and viable microorganisms could be detected using PCR technique5. In these 482 patients, a total of 32 patients were tested positive for bacteria in both CSF routine analysis and GP-PCR. Among these 32 patients tested positive for bacteria, 23 patients were detected to be positive by both GP-PCR and CSF culture; 9 patients were detected to be positive by GP-PCR and negative by CSF culture. All GP-PCR products from 32 samples were then further delivered to sequencing, and the results revealed that all the 32 samples were bacteria positive. The possible reasons for low sensitivity of CSF culture method may be because of (a) low bacteria DNA copies in these 9 patients or because of (b) the antibiotics therapy that had been taken by these patients prior to lumbar puncture. All these results suggested that GP-PCR method has a higher sensitivity. Finally, GP-PCR had a great advantage of time saving, as it took only about 2 to 3 hours in total. This advantage could avoid contamination with other bacteria compared with CSF culture and reduce the rate of the false positive. In conclusion, although bacterial culture of CSF remains the cornerstone in the diagnosis of bacterial meningitis, the 16S rRNA-based GP-PCR proved to be a more rapid, sensitive, and specific method compared
with CSF culture, and it should have promising usage in the diagnosis of bacterial meningitis. More important, it could help greatly in the gram discrimination of bacteria in bacterial meningitis, and it has a promising perspective in clinical practice. So the 16S rRNA gene GP-PCR method would be a valuable supplementary test in clinical practice. Authors’ Note Authors Dong Ao and Li Wei contributed equally to this work.
Declaration of Conflicting Interests The author(s) declared no potential conflicts of interest with respect to the research, authorship, and/or publication of this article.
Funding The author(s) disclosed receipt of the following financial support for the research, authorship, and/or publication of this article: This work was supported by the National Natural Science Foundation of China (81200486) and Key Projects in the National Science & Technology Pillar Program (2012BAI04B05)
References 1. Mahmoudi S, Zandi H, Pourakbari B, Ashtiani MT, Mamishi S. Acute bacterial meningitis among children admitted into an Iranian referral children’s hospital. Jpn J Infect Dis. 2013;66:503-506. 2. Chen Z, Wang Y, Zeng A, et al. The clinical diagnostic significance of cerebrospinal fluid d-lactate for bacterial meningitis. Clin Chim Acta. 2012;413:1512-1515. 3. Ben RJ, Kung S, Chang FY, Lu JJ, Feng NH, Hsieh YD. Rapid diagnosis of bacterial meningitis using a microarray. J Formos Med Assoc. 2008;107:448-453. 4. Chen LH, Duan QJ, Cai MT, Wu YD, Shang SQ. Rapid diagnosis of sepsis and bacterial meningitis in children with real-time fluorescent quantitative polymerase chain reaction amplification in the bacterial 16S rRNA gene. Clin Pediatr (Phila). 2009;48:641-647. 5. Duan QJ, Shang SQ, Wu YD. Rapid diagnosis of bacterial meningitis in children with fluorescence quantitative polymerase chain reaction amplification in the bacterial 16S rRNA gene. Eur J Pediatr. 2009;168: 211-216. 6. Taha MK, Fox A. Quality assessed nonculture techniques for detection and typing of meningococci. FEMS Microbiol Rev. 2007;31:37-42. 7. Janner DL, Probert WS, McClure CD. Ribosomal DNA assay of culture-negative Streptococcus pneumoniae meningitis. Pediatr Neurol. 2007;37:55-58. 8. Pandit L, Kumar S, Karunasagar I, Karunasagar I. Diagnosis of partially treated culture-negative bacterial meningitis using 16S rRNA universal primers and restriction endonuclease digestion. J Med Microbiol. 2005;54(pt 6): 539-542.
Downloaded from cpj.sagepub.com at UNIVERSITE LAVAL on June 10, 2014
6
Clinical Pediatrics
9. Møller JK. Detection of Neisseria meningitidis in cerebrospinal fluid using a multiplex PCR and the Luminex detection technology. Methods Mol Biol. 2012;799:37-53. 10. Zhu H, Wang Q, Wen L, et al. Development of a multiplex PCR assay for detection and genogrouping of Neisseria meningitidis. J Clin Microbiol. 2012;50:46-51. 11. Deutch S, Møller JK, Ostergaard L. Combined assay for two-hour identification of Streptococcus pneumoniae and Neisseria meningitidis and concomitant detection of 16S
ribosomal DNA in cerebrospinal fluid by real-time PCR. Scand J Infect Dis. 2008;40:607-614. 12. Picazo JJ, Contreras JR, Ríos E, et al. Rapid diagnosis of invasive pneumococcal disease in pediatric population. J Microbiol Methods. 2013;93:116-120. 13. Wu YD, Chen LH, Wu XJ, et al. Gram stain-specificprobe-based real-time PCR for diagnosis and discrimination of bacterial neonatal sepsis. J Clin Microbiol. 2008;46:2613-2619.
Downloaded from cpj.sagepub.com at UNIVERSITE LAVAL on June 10, 2014
Rapid Diagnosis and Discrimination of Bacterial Meningitis in Children Using Gram Probe Real-Time Polymerase Chain Reaction Dong Ao, Li Wei, Gao Hui-Hui, Tao Ran, Shang Shi-Qiang and Rao Yue-Li CLIN PEDIATR published online 1 May 2014 DOI: 10.1177/0009922814532309 The online version of this article can be found at: http://cpj.sagepub.com/content/early/2014/04/30/0009922814532309
Published by: http://www.sagepublications.com
Additional services and information for Clinical Pediatrics can be found at: Email Alerts: http://cpj.sagepub.com/cgi/alerts Subscriptions: http://cpj.sagepub.com/subscriptions Reprints: http://www.sagepub.com/journalsReprints.nav Permissions: http://www.sagepub.com/journalsPermissions.nav
>> OnlineFirst Version of Record - May 1, 2014 What is This?
Downloaded from cpj.sagepub.com at UNIVERSITE LAVAL on June 10, 2014
532309
research-article2014
CPJXXX10.1177/0009922814532309Clinical PediatricsAo et al
Original Article
Rapid Diagnosis and Discrimination of Bacterial Meningitis in Children Using Gram Probe Real-Time Polymerase Chain Reaction
Clinical Pediatrics 1–6 © The Author(s) 2014 Reprints and permissions: sagepub.com/journalsPermissions.nav DOI: 10.1177/0009922814532309 cpj.sagepub.com
Dong Ao, MD1, Li Wei, MD1, Gao Hui-Hui, PhD1, Tao Ran, PhD1, Shang Shi-Qiang, MD1, and Rao Yue-Li, MD2
Abstract In this study, we developed a method of simultaneous detection and discrimination of bacteria in cerebrospinal fluid (CSF) with gram probe real-time polymerase chain reaction (PCR). Our results showed 25 clinical strains representing 13 gram-positive and 12 gram-negative bacterial species. They were identified correctly with the corresponding gram probe. The standard curve showed that the amplification efficiency of templates with different concentrations of bacteria was almost the same with a potential detection limit of 10 colony-forming units/mL. A total of 482 children who were clinically suspected of bacterial meningitis were included in this study. A total of 1.0 mL of CSF was collected from every child and was subjected to gram probe–based PCR (GP-PCR), CSF culture, and CSF routine analysis. The positive rate of the GP-PCR array was (32/482, 6.64%) significantly higher than that of CSF culture (23/482, 4.77%). GP-PCR was proved to be an excellent technique for rapid and accurate diagnosis and discrimination of bacterial meningitis, and hence its use as a diagnostic tool in future seems very promising. Keywords bacterial meningitis, gram probe real-time PCR, children
Introduction Bacterial meningitis (BM) is an acute inflammation that affects the central nervous system with high rate of morbidity and mortality.1,2 Patients with BM need immediate medical assessment and treatment. Its main pathogens are meningococcus, Haemophilus influenzae, Streptococcus pneumoniae, and so on, which belong to different genus and need different treatments.3-5 However, dilemmas exist in the treatment of these patients because of the delay in identification of causative organism and antibiotic administration.5 Previous etiologic diagnose mainly relied on cerebrospinal fluid (CSF) culture to identify the causative organism and then antibiotics were chosen by in vitro antibiotic susceptibility testing.6,7 Although cerebrospinal fluid (CSF) culture technique is the gold standard for BM confirmation in the clinical works, suspected samples still should be incubated for 5 days or even longer until they show continuous positive results.5-7 Moreover, the culture results may be false negative when fastidious or slowly growing bacteria are involved and when samples have been previously treated with antibiotics.8
Immunological techniques were also used for BM confirmation, but they present low sensitivity and may be cross-reactive. In these cases, previous diagnostic methods of BM may cause a delayed treatment.5 Therefore, a more rapid and sensitive detection method is required for early and effective treatment of BM. Recently, real-time polymerase chain reaction (RT-PCR) technique has showed the potential to provide a rapid, accurate, and sensitive diagnosis of bacteria and pathogens.9-12 The conserved region of the 16S rRNA gene has been used in RT-PCR technology to identify bacteria in clinical practice. This broad-range bacterial PCR technology can detect thousands of bacterial species but unable to distinguish between different species of bacterial pathogens.5,6,12 To overcome this defect, gram 1
Children’s Hospital of Zhejiang University School of Medicine, Hangzhou, People’s Republic of China 2 Hospital of PLA, Hangzhou, People’s Republic of China Corresponding Authors: Shang Shi-Qiang, Children’s Hospital of Zhejiang University School of Medicine, Hangzhou 310013, People’s Republic of China Email: [email protected]
Downloaded from cpj.sagepub.com at UNIVERSITE LAVAL on June 10, 2014
2
Clinical Pediatrics
Table 1. Clinical Bacteria Strains Detected by Gram Probe–Based Polymerase Chain Reaction (GP-PCR) Using a Pair of Specific Probes. Species Gram positive
Gram negative
Enterococcus faecium Staphylococcus epidermidis Streptococcus agalactiae Mlicrococcus scarlatinae Staphylococcus simulans Staphylococcus haemolyticus Staphylococcus aureus Staphylococcus capitis Staphylococcus hominis Enterococcus gallinarum Nocardia asteroides Bacillus subtilis Corynebacterium striatum Ochrobactrum anthropi Salmonella enteritidis Acinetobacter baumannii Escherichia coli Pseudomonas aeruginosa Haemophilus influenzae Klebsiella pneumoniae Enterobacter cloacae Burkholderia cepacia Achromobacter xylosoxidans Branhamella catarrhalis Neisseria meningitides
PCR Ct
Gram+ Probe
Gram− Probe
20.08 ± 0.24 18.82 ± 0.32 19.79 ± 0.38 19.49 ± 0.58 21.78 ± 0.19 19.36 ± 0.67 20.05 ± 0.52 20.03 ± 0.43 21.70 ± 1.02 20.04 ± 0.22 20.84 ± 0.15 21.19 ± 0.69 19.11 ± 0.34 21.79 ± 0.46 20.22 ± 0.35 21.66 ± 0.24 22.73 ± 0.31 21.00 ± 0.12 21.21 ± 0.36 19.55 ± 0.68 20.63 ± 0.52 20.97 ± 0.33 19.79 ± 0.54 18.08 ± 0.23 20.20 ± 0.77
G+ G+ G+ G+ G+ G+ G+ G+ G+ G+ G+ G+ G+
G− G− G− G− G− G− G− G− G− G− G− G−
probe–based RT-PCR (GP-PCR) system involving the 16S rRNA gene was established, which was only used in diagnosis of bacterial neonatal sepsis in the previous study and showed high specificity and sensitivity.13 In this study, we used this GP-PCR system to detect the clinical bacteria in CSF samples and discriminate them into grampositive and gram-negative. A total of 482 CSF specimens from children with suspected bacterial infections were evaluated. This system would provide a new early guidance for clinical treatment in children with BM.
Materials and Methods Bacterial Strains The clinical bacterial strains used in this study are listed in Table 1. Bacteria were obtained in the form of frozen cell pellets, reaks, or lyophilized cells. Prior to DNA extraction, each strain was streaked on chocolate or blood agar and examined for the proper colony morphology. The total human genome, cytomegalovirus (CMV), hepatitis B virus (HBV), and Epstein–Barr virus (EBV) were used as negative controls.
Clinical Cerebrospinal Fluid Samples and Patients From January 2010 to January 2013, a total of 482 different CSF specimens were collected from patients in the neonatal ward and the neonatal intensive care unit of Children’s Hospital, Zhejiang University, Hangzhou, People’s Republic of China. The criteria for patients enrolled in this study were that they were suspected to be BM patients with fever, headache, vomiting, irritability, lethargy, or seizures. The ages of the 482 patients (215 female and 267 male) ranged from 1 day to 10 years. All these samples were detected by both CSF culture method and GP-PCR technique. The study was approved by the Medical Ethics Committee of the Medical College, and informed consent was obtained.
Primers and Gram Probes The primers and probes were designed on the basis of identity within the 16S rRNA gene following the alignment of sequences of the group’s clinical bacterial pathogens outlined in Table 2. The gram-positive probe
Downloaded from cpj.sagepub.com at UNIVERSITE LAVAL on June 10, 2014
3
Ao et al Table 2. Primers and Probes Used in This Study.
Statistical Analysis
Primer/Probe
The results were analyzed using SPSS software (version 11.5). Quantitative data were presented as the mean ± standard deviation. Mc Nemar’s test with the continuity correction was performed to analyze the relationship between GP-PCR and blood culture methods. Twotailed P value of less than .05 was considered to be statistically significant.
Forward primer Reverse primer Gram+ probe Gram− probe
Sequence (5′to 3′) GCAACGCGAAGAACCTTACC CGCTCGTTGCGGGACTTA FAM-TGACGACAACCATGCACCACCTBHQ1 HEX-ACGACAGCCATGCAGCACCTBHQ1
was the reverse complement of nucleotides from the Staphylococcus aureus 16S rRNA gene. The gram-negative probe was the reverse complement of nucleotides from the Escherichia coli 16S rRNA gene. The genes amplified by primers and probes were identified using the BLAST tool database. The primers and probes were synthesized by Takara Company.
DNA Extraction DNA was extracted with the QIAamp DNA blood mini kit (Qiagen, Valencia, CA). The assay was performed according to the manufacturer’s instructions. DNA was extracted from 200 µL CSF. Twenty microliters of Qiagen proteinase K (20 mg/mL) was added for every 200 µL of CSF processed, along with an equal volume (200 µL) of buffer AL, and the sample was incubated for 30 minutes at 56°C. After incubation, an equal volume (200 µL) of 100% ethanol was added, and the resulting lysate was loaded onto the QIAamp DNA mini kit column (Qiagen) and washed with 500 µL of buffers AW1 and AW2, successively. Finally, the purified nucleic acids were eluted with 100 µL of Qiagen buffer AE. A 0.2-µm filter was used to filter the following reagents before use: proteinase K, ethanol, AW1, AW2, and Qiagen buffer AE.
Real-Time PCR The RT-PCR amplification was performed in a total volume of 50 µL with the ABI7500 Detection System. The reaction mixtures consisted of 400 nM (each) forward and reverse primers, 100 nM (each) gram-positive and gram-negative, respectively, fluorescence-labeled specific probes, 1U of Taq DNA polymerase (TAKARA, Otsu, Shiga, Japan), 5 µL of template DNA, and water was added to the final volume of 50 µL for each sample. The PCR mixture was filtered with a 0.22-µm filter device (Millipore Corp, Billerica, MA). Positive and negative controls were included throughout the procedure. “No-template” controls with water instead of template DNA were incorporated in each run under the following conditions: 94°C for 2 minutes and 40 cycles of 94°C for 15 seconds and 60°C for 45 seconds.
Results Specificity of GP-PCR Twenty five clinical standard bacterial strains (13 grampositive and 12 gram-negative bacterial species) were detected with GP-PCR. All the gram-positive bacteria were detected with fluorescence signals with the Ct values ranging from 18.82 to 21.78. Fluorescence was not found in the gram-negative bacteria with the gram-positive probe. When tested with the gram-negative probe, DNAs from all of the gram-negative species were positive, with a range of Ct values from 18.08 to 22.73 (Table 1). Fluorescence was not found in the gram-positive bacteria with the gram-negative probe. No fluorescence was detected and no cross-reaction was found to DNAs extracted from the human genome, CMV, HBV, and EBV in this test.
Sensitivities of GP-PCR To determine the detection range, Staph aureus (grampositive bacteria) and E coli (gram-negative bacteria) were used as control for standard curve analysis, each in triplicate. We prepared a 10-fold dilution series from 107 colony-forming units/mL (CFU/mL) to 101 CFU/mL. Our serial dilutions of the bacteria revealed that the detection range of the RT-PCR method was at least from 101 to 107 CFU/mL (Figure 1). Data were then subjected to log-linear analysis to generate a standard curve for calculation of unknowns. The standard curves regularly exhibited high R2 values (>0.99).
Results of GP-PCR and CSF Culture A total of 484 CSF samples were analyzed by both CSF culture and GP-PCR. The result showed that 32 samples were positive (32/482, 6.64%) with GP-PCR and 23 were positive (23/482, 4.77%) with CSF culture (Table 3). The positive rate of GP-PCR was significantly higher than that of CSF culture (P < .001). In comparison with the bacterial culture, 23 of the 32 qRT-PCR positive samples were identified successfully in CSF culture (23/32, 71.9%).
Downloaded from cpj.sagepub.com at UNIVERSITE LAVAL on June 10, 2014
4
Clinical Pediatrics
Figure 1. Standard curves of the gram stain–specific probes from serial dilutions of bacteria.
Table 3. Overall Results Obtained by GP-PCR Compared With CSF Culture. CSF Culture Result PCR Result Positive Negative Total
Positive
Negative
Total
23 0 23
9 436 459
32 450 482
Abbreviations: GP-PCR, gram probe–based polymerase chain reaction; CSF, cerebrospinal fluid.
Table 4. Comparison of CSF Culture, CSF Routine Analysis, and GP-PCR Results From 32 Patients. No. of Samples 9 2 1 1 4 4 2 2 1 1 5
CSF Culture
CSF Routine Analysis
Gram+/ Gram−
Escherichia coli Klebsiella pneumoniae Flavobacterium meningosepticum Enterobacter cloacae — Streptococcus pneumoniae Streptococcus agalactiae Staphylococcus epidermindis Staphylococcus aureus Listeria monocytogenes —
Abnormal Abnormal Abnormal Abnormal Abnormal Abnormal Abnormal Abnormal Abnormal Abnormal Abnormal
G− G− G− G− G− G+ G+ G+ G+ G+ G+
Abbreviations: CSF, cerebrospinal fluid; GP-PCR, gram probe–based polymerase chain reaction.
As shown in Table 4, CSF routine analysis was performed on all 32 samples. The data showed that 23 CSF culture-positive and GP-PCR positive samples were all abnormal in CSF routine analysis. For 9 samples CSF culture-negative and GP-PCR-positive samples, CSF
routine analysis result was abnormal with increase in WBC (white blood cell) and decrease in glucose, which indicated that GP-PCR result is accurate in diagnosis of bacterial meningitis.
Discussion Pathogen examination plays an extremely critical role in the diagnosis and treatment of bacterial meningitis with antibiotics. Because of the high mortality of infection in the central nervous system1-5, the early detection and rapid differentiation of bacteria and rapid treatment, play an important role in the reduction of infant mortality resulting from BM.6,7 Currently, CSF culture and CSF routine analysis are usually used as standard methods for diagnosis of clinical samples suspected to be BM.5 However, such methods cannot provide a rapid, sensitive, and specific diagnosis result. The parameters in CSF routine analysis usually involved cell counts, total protein concentration, and glucose concentration varying over a wide range. There are no conspicuous microbiological and chemical abnormalities in CSF routine analysis and CSF culture in some patients whose clinical manifestation of BM are obvious. CSF culture may also lead to false-negative results when fastidious or slowly growing bacteria are involved or when samples are obtained after antimicrobial therapy has been started. Moreover, CSF culture method requires at least 48 hours to 72 hours for bacterial incubation, which affects the early treatment of BM patients.5,6,13 RT-PCR is a promising tool for the detection of bacterial DNA from biological fluid samples.9-11 In our previous research, we used fluorogenic quantitative (FQ)-PCR, which targeted the conserved region of 16S rRNA gene to detect bacterial DNA in children with
Downloaded from cpj.sagepub.com at UNIVERSITE LAVAL on June 10, 2014
5
Ao et al BM.5 This method showed high specificity and sensitivity in the identification of bacterial strains. In this study, we described a gram-specific probe RT-PCR method, which targeted the conserved region of 16S rRNA gene in CSF samples. This method could simultaneously detect and discriminate the clinically relevant gram-positive and gram-negative bacteria from CSF samples directly. At the same time, DNA extracted from the human genome, CMV, HBV, or EBV was also detected as negative control. No fluorescence was detected, and no cross-reaction was found in these negative controls. In 482 patients, a total of 32 patients were tested positive for bacteria. Among these 32 patients, 17 patients were detected to be G−, and 15 patients were G+. On the basis of the subtypes provided by GP-PCR method, different clinical treatments were taken, and the clinical outcomes supported bacterial subtypes. So GP-PCR method showed high specificity in detection and identification of bacterial strains. The GP-PCR system was not only more specific for the bacteria detection than CSF culture but also more sensitive than CSF culture. Our study showed that the detection range of the RT-PCR method was at least from 101 to 107 copies/mL. More important, antibiotic treatment for CSF samples detection does not interfere with this method, and it eliminates the possibility of false-negative results because of antibiotic treatment. Both dead and viable microorganisms could be detected using PCR technique5. In these 482 patients, a total of 32 patients were tested positive for bacteria in both CSF routine analysis and GP-PCR. Among these 32 patients tested positive for bacteria, 23 patients were detected to be positive by both GP-PCR and CSF culture; 9 patients were detected to be positive by GP-PCR and negative by CSF culture. All GP-PCR products from 32 samples were then further delivered to sequencing, and the results revealed that all the 32 samples were bacteria positive. The possible reasons for low sensitivity of CSF culture method may be because of (a) low bacteria DNA copies in these 9 patients or because of (b) the antibiotics therapy that had been taken by these patients prior to lumbar puncture. All these results suggested that GP-PCR method has a higher sensitivity. Finally, GP-PCR had a great advantage of time saving, as it took only about 2 to 3 hours in total. This advantage could avoid contamination with other bacteria compared with CSF culture and reduce the rate of the false positive. In conclusion, although bacterial culture of CSF remains the cornerstone in the diagnosis of bacterial meningitis, the 16S rRNA-based GP-PCR proved to be a more rapid, sensitive, and specific method compared
with CSF culture, and it should have promising usage in the diagnosis of bacterial meningitis. More important, it could help greatly in the gram discrimination of bacteria in bacterial meningitis, and it has a promising perspective in clinical practice. So the 16S rRNA gene GP-PCR method would be a valuable supplementary test in clinical practice. Authors’ Note Authors Dong Ao and Li Wei contributed equally to this work.
Declaration of Conflicting Interests The author(s) declared no potential conflicts of interest with respect to the research, authorship, and/or publication of this article.
Funding The author(s) disclosed receipt of the following financial support for the research, authorship, and/or publication of this article: This work was supported by the National Natural Science Foundation of China (81200486) and Key Projects in the National Science & Technology Pillar Program (2012BAI04B05)
References 1. Mahmoudi S, Zandi H, Pourakbari B, Ashtiani MT, Mamishi S. Acute bacterial meningitis among children admitted into an Iranian referral children’s hospital. Jpn J Infect Dis. 2013;66:503-506. 2. Chen Z, Wang Y, Zeng A, et al. The clinical diagnostic significance of cerebrospinal fluid d-lactate for bacterial meningitis. Clin Chim Acta. 2012;413:1512-1515. 3. Ben RJ, Kung S, Chang FY, Lu JJ, Feng NH, Hsieh YD. Rapid diagnosis of bacterial meningitis using a microarray. J Formos Med Assoc. 2008;107:448-453. 4. Chen LH, Duan QJ, Cai MT, Wu YD, Shang SQ. Rapid diagnosis of sepsis and bacterial meningitis in children with real-time fluorescent quantitative polymerase chain reaction amplification in the bacterial 16S rRNA gene. Clin Pediatr (Phila). 2009;48:641-647. 5. Duan QJ, Shang SQ, Wu YD. Rapid diagnosis of bacterial meningitis in children with fluorescence quantitative polymerase chain reaction amplification in the bacterial 16S rRNA gene. Eur J Pediatr. 2009;168: 211-216. 6. Taha MK, Fox A. Quality assessed nonculture techniques for detection and typing of meningococci. FEMS Microbiol Rev. 2007;31:37-42. 7. Janner DL, Probert WS, McClure CD. Ribosomal DNA assay of culture-negative Streptococcus pneumoniae meningitis. Pediatr Neurol. 2007;37:55-58. 8. Pandit L, Kumar S, Karunasagar I, Karunasagar I. Diagnosis of partially treated culture-negative bacterial meningitis using 16S rRNA universal primers and restriction endonuclease digestion. J Med Microbiol. 2005;54(pt 6): 539-542.
Downloaded from cpj.sagepub.com at UNIVERSITE LAVAL on June 10, 2014
6
Clinical Pediatrics
9. Møller JK. Detection of Neisseria meningitidis in cerebrospinal fluid using a multiplex PCR and the Luminex detection technology. Methods Mol Biol. 2012;799:37-53. 10. Zhu H, Wang Q, Wen L, et al. Development of a multiplex PCR assay for detection and genogrouping of Neisseria meningitidis. J Clin Microbiol. 2012;50:46-51. 11. Deutch S, Møller JK, Ostergaard L. Combined assay for two-hour identification of Streptococcus pneumoniae and Neisseria meningitidis and concomitant detection of 16S
ribosomal DNA in cerebrospinal fluid by real-time PCR. Scand J Infect Dis. 2008;40:607-614. 12. Picazo JJ, Contreras JR, Ríos E, et al. Rapid diagnosis of invasive pneumococcal disease in pediatric population. J Microbiol Methods. 2013;93:116-120. 13. Wu YD, Chen LH, Wu XJ, et al. Gram stain-specificprobe-based real-time PCR for diagnosis and discrimination of bacterial neonatal sepsis. J Clin Microbiol. 2008;46:2613-2619.
Downloaded from cpj.sagepub.com at UNIVERSITE LAVAL on June 10, 2014
