RADIATION RESEARCH

183, 000–000 (2015)

0033-7587/15 $15.00 Ó2015 by Radiation Research Society. All rights of reproduction in any form reserved. DOI: 10.1667/RR13909.1

Radiation-Induced Epigenetic Bystander Effects Demonstrated in Arabidopsis Thaliana Wei Xu,1 Ting Wang,1 Shuyan Xu, Shaoxin Xu, Lijun Wu, Yuejin Wu and Po Bian2 Key Laboratory of Ion Beam Bio-engineering, Hefei Institutes of Physical Science, Chinese Academy of Sciences and Anhui Province, Hefei, Anhui 230031, P.R. China

INTRODUCTION Xu, W., Wang, T., Xu, S., Xu, S., Wu, L., Wu, Y. and Bian, P. Radiation-Induced Epigenetic Bystander Effects Demonstrated in Arabidopsis Thaliana. Radiat. Res. 183, 000–000 (2015).

Radiation-induced bystander effect (RIBE) represents a paradigm shift in our understanding of radiobiological effects of ionizing radiation with radiation-induced biological changes occuring in unirradiated cells within an irradiated cell population (1). Bystander effects have been well demonstrated using a variety of biological end points including single-cell culture models (2–5), multi-cellular tissue models (6–11) and whole organisms (12–18). In these studies, most of the focus was directed toward detecting evidence of genetic DNA damage. Recently, using singlecell culture models in vitro and animal models in vivo, some epigenetic changes mediated by bystander effects have been reported, including DNA methylation (19, 20), histone modification (14, 21–24) and RNA-mediated modification (15). However, there has been no clear evidence to date regarding the radiation-induced epigenetic bystander changes in higher plants, although radiation-induced bystander effects have been well demonstrated in Arabidopsis thaliana (A. thaliana) with various developmental and genetic end points (25–30). Epigenetics is the study of heritable changes in gene activity that are not caused by changes in DNA sequences (31, 32). DNA methylation is one such epigenetic change and refers to the addition of a methyl group to the cytosine bases of DNA to form 5-methylcytosine (33). As one of the most common covalent modifications in living cells, DNA methylation can influence gene expression, chromatin inactivation, cell differentiation, embryo growth and carcinogenesis (34, 35). In mammals, DNA methylation is mainly restricted to the symmetric CG context, except for non-CG methylation in embryonic stem cells. In contrast, the DNA methylation in plants can occur in the contexts of CG, CHG and CHH (H ¼ A, C or T) (36, 37). Three DNA methyltransferases in plants have been characterized: MET1, CMT3 and DRM2 (38–40). MET1 is responsible for maintenance of symmetric CG methylation (41). CMT3 is a plant-specific DNA methyltransferase that is required for the maintenance of DNA methylation at CHG sites (39). DRM2 is responsible for de novo DNA methylation at all sequence contexts, especially for CHH methylation (42, 43).

Radiation-induced bystander effects (RIBE) in vivo in the higher plant Arabidopsis thaliana (A. thaliana) have been well demonstrated in terms of effects on development and genetics. However, there is not yet robust evidence regarding RIBE-mediated epigenetic changes in plants. To address this, in the current work the roots of A. thaliana seedlings were locally irradiated with 10 Gy of a particles, after which DNA methylation in bystander aerial plants were detected using the methylation-sensitive amplification polymorphism (MSAP) and bisulfite sequencing PCR (BSP). Results showed that irradiation of the roots led to long-distance changes in DNA methylation patterns at some CCGG sites over the whole genome, specifically from hemi-methylation to nonmethylation, and the methylation ratios, mainly at CG sites, strongly indicating the existence of RIBE-mediated epigenetic changes in higher plants. Irradiating of the root also influenced expressions of DNA methylation-related MET1, DRM2 and SUVH4 genes and demethylation-related DML3 gene in bystander aerial plants, suggesting a modulation of RIBE to the methylation machinery in plants. In addition, the multicopy P35S:GUS in A. thaliana line L5-1, which is silenced epigenetically by DNA methylation and histone modification, was transcriptionally activated through the RIBE. The transcriptional activation could be significantly inhibited by the treatment with reactive oxygen species (ROS) scavenger dimethyl sulfoxide (DMSO), indicative of a pivotal role of ROS in RIBE-mediated epigenetic changes. Time course analyses showed that the bystander signaling molecule(s) for transcriptional activation of multicopy P35S:GUS, although of unknown chemical nature, were generated in the root cells within 24 h postirradiation. Ó 2015 by Radiation Research Society

Editor’s note. The online version of this article (DOI: 10.1667/ RR13909.1) contains supplementary information that is available to all authorized users. 1 These authors contributed equally to this work. 2 Address for correspondence: P.O. Box 1138, Hefei, Anhui 230031, P.R. China; e-mail: [email protected]. 0

0

XU ET AL.

In addition, SUVH4, a histone H3 lysine 9 (H3 K9) methyltransferase, is involved in maintenance of methylation at particular genomic regions (44). DNA demethylation depends on four bifunctional 5-methylcytosine glycosylases: repressor of silencing 1 (ROS1); demeter (DME), DME-like2 (DML2) and DME-like3 (DML3), which remove methylated bases and cleave the DNA backbone at abasic sites. The resulting gap is filled by a DNA polymerase and a DNA ligase (45–47). DNA methylation frequently occurs in endogenous repeated sequences like transposable elements and microsatellite sequences (48, 49). Locally repeated sequences can also be targeted for DNA methylation when they are transformed into plants (50–53). The high DNA methylation, together with inactive chromatin marks and chromatin compaction, can suppress the expression of repeats through transcriptional gene silencing (TGS) (54). These epigenetically silenced repetitive elements can be activated upon developmental reprogramming during pollen and seed development (55) or by the lack of epigenetic regulators under stress conditions (56). Some repetitive transgenic markers in A. thaliana, like L5-1 line carrying a single insert of multicopy P35S:GUS gene silenced by TGS, have been developed as indicators to score interference with epigenetic regulation under stress conditions (57–59). In the current work, we investigated radiation-induced epigenetic bystander effects in A. thaliana seedlings. We found that when the roots of the seedlings were locally irradiated with 10 Gy of alpha particles, we detected epigenetic events in the unirradiated bystander aerial plants, including changes in DNA methylation patterns, DNA methylation ratios, expressions of methylation-related genes and transcriptional activation of repetitive sequences. Finally, we also investigated the primary time course of bystander signaling for the epigenetic changes, and the role of reactive oxygen species (ROS) in observed RIBEmediated epigenetic effects. MATERIALS AND METHODS A. Thaliana Lines and Plant Growth The A. thaliana line N1092 (Columbia ecotype, wild-type) was obtained from the NASC (Nottingham Arabidopsis Stock Center, Sutton-Bonington, UK). Line L5-1 was a gift from Dr. Ortrun Mittelsten Scheid (Gregor Mendel Institute of Molecular Plant Biology, Austrian Academy of Sciences, Vienna, Austria) (57). A. thaliana seeds were soaked in water and kept in darkness at 48C for 2 days, after which the seeds were sown on growth media [13 Murashige and Skoog (MS) mineral salts, agar at 0.8% (w/v) and sucrose at 1% (w/v)] in square petri dishes, and placed in a growth chamber in a vertical orientation. The temperature in the growth chamber was 228C and the illumination was approximately 100 lM m2 s1 with a 16:8 h light-dark cycle. Alpha-Particle Irradiation of the Roots Alpha-particle irradiation was performed with a Rotate-Adjustable a-particle Source Facility as described previously (27) and shown schematically in Fig. 1A. In this study, alpha-particle average energy

was 3.3 MeV at the seedlings, and the dose rate of alpha particles was 1.51 cGy/s1. Six-day-old seedlings were transferred from the MS media into a specially designed round dish (/ ¼ 45 mm) with a 3.5 lm thick Mylart film bottom and were positioned so that their roots were aligned with each other and the primary roots were in a horizontal and parallel orientation, as shown in Fig. 1B. A piece of moistened filter paper was laid over the seedlings to prevent water loss during irradiation. The alpha-particle irradiation was performed by placing the sample dish over the radiation window for 11 min, i.e., the absorbed doses were 10 Gy. The length of primary root exposed to alpha particles was about 0.7 cm and a 100 lm thick aluminum slice was used to shield other parts of the seedlings, as shown in Fig. 1B. After irradiation, 10 ml of water was added into the sample dish to aid in removing the seedlings from the Mylar film. The irradiated seedlings were again transferred onto MS media. In all experiments the mock controls were placed 30 cm away from the radiation window, where no alpha particle was detected. DNA Extraction The total genomic DNA of aerial parts of A. thaliana line N1092 for methylation-sensitive amplification polymorphism (MSAP) and bisulfite sequencing PCR (BSP) analysis was extracted using an improved CTAB method as describe previously (60). Methylation-Sensitive Amplification Polymorphism Analysis The MSAP analysis was performed according to the published protocol (61) with slight modifications, in which the restriction enzymes HpaII and MspI were used to detect methylation polymorphism. The adapters and primers are listed in Table 1. In this assay, two sets of successive restriction and ligation were undertaken. In the first reaction (HpaII/EcoRI digestion), 2 ll 103 NEB smart-buffer (New England Biolabst Inc., Ipswich, MA), 0.5 ll HpaII (10 U) and 10 ll genome DNA (200 ng) were added into 7.5 ll ddH2O. The reaction liquid was incubated for 6 h at 378C to digest completely. The reaction was stopped by incubating for 20 min at 808C. For EcoRI digestion, 3 ll 103 NEB smart buffer, 1 ll EcoRI (10 U), 20 ll HpaII digestion system and 6 ll ddH2O were mixed, incubated for 2 h at 378C and then incubated for 20 min at 658C to stop the reaction. In the ligation reaction, 4 ll 103 ligation buffer, 1 ll 5 lM EcoRI adapter, 1 ll 5 lM HpaII/MspI adapter, 30 ll HpaII/ EcoRI digestion product and 0.5 ll T4 DNA ligase (20 U; Takara Biotechnology, Liaoning, China) were added into 3.9 ll ddH2O and incubated for 12 h at 168C. The reaction was then stopped by incubating for 20 min at 658C. The second restriction and ligation set was performed in the same way, except that MspI was used in place of HpaII. Both the products of HpaII/EcoRI and MspI/ EcoRI reactions were subjected to pre-selective and selective PCR amplification. The preselective amplification was performed using a mixture of 14.3 ll ddH2O, 2 ll 103 Ex Taqe buffer, 1.6 ll dNTP, 0.5 ll 5 lM EcoRI primer (primer E), 0.5 ll 5 lM HpaII/MspI primer (primer HM), 1 ll ligation product and 0.1 ll Ex Taq (0.5 U; Takara Biotechnology). These PCR reactions were performed as follows: 1. 3 min at 948C; 2. 20 cycles of 30 s denaturing at 948C, 1 min annealing at 608C and 1 min extension at 728C; and 3. 10 min at 728C for template extension. Selective amplification of the ligation products was performed using 12 primer combinations, which were obtained by combining 11 EcoRI primers with 6 HpaII/MspI primers with two or three selective bases (Table 1). Selective PCR reactions were performed using a mixture of 14.3 ll ddH2O, 2 ll 103 Ex Taq buffer, 1.6 ll dNTP, 0.5 ll 5 lM primer Ex, 0.5 ll 5 lM primer HMx, 1 ll pre-amplification product and 0.1 ll Ex Taq (0.5 U; Takara Biotechnology). Selective PCR reactions were performed as follows: 1. 5 min at 948C; 2. 36 cycles of 30 s denaturing at 948C, 30 s annealing at 56–658C and 1.0–1.4 min extension at 728C; and 3. 10 min at 728C for template extension.

RADIATION-INDUCED EPIGENETIC BYSTANDER EFFECTS IN PLANTS

0

FIG. 1. Localized root irradiation of A. thaliana seedlings with alpha particles. Panel A: Schematics of root irradiation of seedlings. Panel B: Location of A. thaliana seedlings in radiation dish with a 100 lm thick aluminum shielding the aerial plants from alpha radiation. Panel C: Histochemical staining of L5-1 plant transgenetic for multicopy P35S:GUS. Annealing was initiated at a temperature of 658C, which was then reduced by 0.78C for the next 12 cycles and maintained at 568C for the subsequent 23 cycles. The extension time was increased by 1 s for the last 24 cycles. The MSAP products were mixed with an equal volume of tracking dye (98% formamide, 10 mM EDTA pH 8.0, 0.1% bromophenol blue and 0.1% xylene cyanol) denatured at 958C for 3 min and cooled on ice immediately. Aliquots (2.5 ll) of each reaction were electrophoresed on 6% denaturing polyacrylamide gel containing 8 M urea and 13 TBE. The gels were prerun at 450 V for 20 min before 2.5 ll of the mixture was loaded. Gels were run at 600 V for 3 h. Gels were washed twice with distilled water and then fixed and stained in 0.089% AgNO3 (containing 1.05% ethanol and 0.5% acetic acid) for 20 min. Gels were then washed twice with distilled water. These steps were performed with slow agitation on a shaker. Image development was performed by transferring the gels to 2% NaOH (containing 0.5% formaldehyde). To stop development and fix the gels, 10% acetic acid was added directly to the developing solution. The gels were then rinsed twice with distilled water. Electrophoresis patterns were documented by the gel imaging system. DNA methylation levels were estimated based on polymorphisms observed in the gels. A full DNA methylation event is detected when bands present from the EcoRI/MspI restriction/ligation (M) are absent from the EcoRI/HpaII restriction/ligation (H). Such a finding

indicates that both copies of the internal cytosine were methylated (5 0 -CmCGG-3 0 ). The reverse situation, when a band is present in H but absent in M, indicates that the external cytosine of one DNA strand is methylated (5 0 -mCCGG-3 0 ) (i.e. the hemi-methylated state). The presence of a band in both H and M indicates a non-methylated state. Recovery and Sequencing of MSAP Bands The differentially amplified fragments were excised from the gel and incubated for 8 h at 378C for further investigation. The supernatant was recovered by centrifugation and used for the re-amplification. The re-amplified DNA fragments were purified and cloned with the pEASYt-T5 Zero Cloning Kit (TransGen, Beijing, China) and sequenced by Sangon Biological Engineering Technology and Service Co., Ltd. (Shanghai, China). The final sequences obtained were analyzed by the Basic Local Alignment Search Tool program (BLASTt; which can be accessed through the webpage: www.ncbi. nlm.nih.gov). Sodium Bisulfite Genomic DNA Sequencing PCR DNA was sodium bisulfite modified using an EZ DNA Methylation-Golde kit (Zymo Research, Orange, CA) according to the

0

XU ET AL.

TABLE 1 MSAP Primers and Adapters Primers/adapters EcoRI adapter HpaII/MspI adapter Primer E (EcoRI primer) Primer E þ 2 (EcoRI selective primers)

Primer HM (HpaII/MspI primer) Primer HM þ 2 (HpaII/MspI selective primer)

manufacturer’s instructions. For each bisulfite modification, approximately 300 ng of DNA was used. PCR was performed using Takara Ex Taq Hot Start Version DNA polymerase (Takara Biotechnology) and specific primers were designed using MethPrimer web software (http://www.urogene.org/methprimer/). The primers used in this study are listed in Supplementary Table S1 (http://dx.doi.org/10.1667/ RR13909.1.S1). The PCR reaction was performed as follows: 1. 4 min at 958C; 2. 40 cycles of 30 s denaturing at 958C, 30 s annealing at 568C and 30 s extension at 728C; 3. 5 min at 728C for template extension. The fragments were separated on a 1.5% agarose gel and then recovered using a SanPrep Column DNA Gel Extraction Kit (Sangon). These purified DNA fragments were cloned into pEASY-T5 Zero Cloning Kit (TransGen) and sequenced by Sangon Biological Engineering Technology and Service Co., Ltd. Real-Time RT-PCR Analysis The total RNA of aerial plants was extracted 24 or 48 h after the roots were irradiated, using the RNAiso reagent (Takara). The first strand cDNA synthesis and the qRT-PCR were conducted using the TransScriptt All-in-One First-Strand cDNA Synthesis SuperMix for qPCR (one-step gDNA removal) and the TransStartt Top Green qPCR SuperMix (both from TransGen Biotech CO., LTD., Shangha, China), respectively. The qRT-PCR was conducted in the ABI PRISMt 7500 sequence detection system (Applied Biosystemst, Carlsbad, CA) according to the manufacturer’s instructions. Each PCR reaction (20 ll) contained 10 ll of 23 realtime PCR Mix, 0.2 lM of each primer and cDNA at appropriate dilutions. The thermal cycling conditions were 958C for 1 min, followed by 40 cycles of 5 s at 958C, 30 s at 608C and 30 s at 728C. All reactions were performed in triplicate. The primers used in this study are listed in Supplementary Table S2 (http://dx.doi.org/10. 1667/RR13909.1.S1). Quantitative and Histochemical Analysis of GUS Activity The aerial leafy parts of L5-1 seedlings, excluding the hypocotyls, were sampled at day 3 and 8 after the roots were irradiated,

Name

Sequence

A1 A2 HM1 HM2 E0 E1 E2 E3 E4 E5 E6 E7 E8 E9 E10 E11 H0 H1 H2 H3 H4 H5 H6

CTCGTAGACTGCGTACC AATTGGTACGCAGTC GATCATGAGTCCTGCT CGAGCAGGACTCATGA GACTGCGTACCAATTCA GACTGCGTACCAATTCAAC GACTGCGTACCAATTCAAG GACTGCGTACCAATTCACT GACTGCGTACCAATTCATC GACTGCGTACCAATTCACC GACTGCGTACCAATTCACG GACTGCGTACCAATTCAGG GACTGCGTACCAATTCAGA GACTGCGTACCAATTCAGT GACTGCGTACCAATTCAGC GACTGCGTACCAATTCACA ATCATGAGTCCTGCTCGGT ATCATGAGTCCTGCTCGGTCG ATCATGAGTCCTGCTCGGTGC ATCATGAGTCCTGCTCGGTGA ATCATGAGTCCTGCTCGGTAG ATCATGAGTCCTGCTCGGTCT ATCATGAGTCCTGCTCGGTTC

respectively. Quantitative assay of GUS activity in aerial leafy parts of the plants was performed according to protocols described previously (62). For each experiment, a single sample (whole aerial plant without hypocotyl) was collected, and the incubation time in 4-MUG assay solution was 8 h. Final data are the average of at least 10 independent experiments. For detection of the distribution of GUS activity in L5-1 plants (Fig. 1C), the samples were collected on day 8 after the roots were irradiated and were then assayed by histochemical staining as described previously (63). Protocol for Root Cutting Irradiated L5-1 seedling roots were transferred onto a plate containing fresh MS media and spaced 1 cm apart, and the primary roots were removed at given time points applying a horizontal transverse cut through the primary roots about 4 mm below the root/ shoot junctions using a razor sharp blade, then the remaining parts were transferred onto a new plate and kept for GUS activity detection (29). The seedlings that were subjected to the same root cutting but were not irradiated were set as mock controls (M-CT). The naı¨ve and root-irradiated plants were used as negative controls (NCT) and positive controls (PCT), respectively. Treatment with Dimethyl Sulfoxide To examine the role of ROS in mediating the epigenetic bystander effects in plants, A. thaliana L5-1 seedlings were pretreated on the media with 0.4 and 1% dimethyl sulfoxide (DMSO) for 2 days before the root was irradiated, respectively. After the root was irradiated, the seedlings were transferred to the same DMSO media for 8 days. Statistical Analysis All results are presented as means 6 SEM. The statistical significance of the experiments was confirmed by performing Student’s t test. A P value of 0.05 or less was considered to be significant.

0

RADIATION-INDUCED EPIGENETIC BYSTANDER EFFECTS IN PLANTS

TABLE 2 MSAP-Based Cytosine Methylation Levels Type

Control

Irradiated

I II III IV Total sites Total amplified bands Total methylated bands MSAP (%)a Full-methylated bands Full-methylated ratio (%)b Hemi-methylated ratio (%)c Non-methylated ratio (%)d

192 8 41 7 248 241 56 22.58 48 19.35 3.23 77.42

197 7 44 0 248 248 51 20.56 44 17.74 2.82 79.44

a Methylation ratio (%) ¼ [(II þ III þ IV)/(I þ II þ III þ IV)] 3 100. b Full-methylated ratio (%) ¼ [(III þ IV)/(I þ II þ III þ IV)] 3 100. c Hemi-methylated ratio (%) ¼ [(II)/(I þ II þ III þ IV)] 3 100. d Non-methylated ratio (%) ¼ [(I)/(I þ II þ III þ IV)] 3 100.

FIG. 2. MSAP electrophoresis pattern of samples using the primer combination E-GC/MH-TC. The rows labeled H and M refer to digestion with EcoRI/HpaII and EcoRI/MspI, respectively. Samples are from the root-irradiated seedlings and control seedlings. The arrow indicates the locations of polymorphic bands.

RESULTS

The Change in DNA Methylation Level over the Global Genome Induced by Root Irradiation

It has been reported that systemic radiation exposure of plants to gamma rays can lead to changes in the level and pattern of DNA methylation (64). However, it is not clear whether the level and pattern of DNA methylation can also be changed through RIBE. In our previously reported study, we demonstrated the RIBE in A. thaliana seedlings exposed to 10 Gy alpha radiation (27). In the same way, 10 Gy alpha

radiation was used to locally irradiate the roots of 6-day-old A. thaliana seedlings, and DNA methylation over the whole genome in the aerial plants was detected with MSAP at day 3 and 8 after irradiation, respectively. In this experiment, 12 primer combinations were used to detect cytosine methylation at CCGG sequences (Table 1). However, in our pilot experiments, no significant change of bands between irradiated root plants and control plants was observed at the 3 day time point after the roots were irradiated. Therefore, in this study the MSAP was performed on day 8 after irradiation of the roots unless otherwise specified. Figure 2 and Table 2 shown that in the control and irradiated plants a total of 248 clear and reproducible fragments, ranging from 100–2,000 bp, were amplified. Different banding patterns between the control and irradiated plants reflect the status of DNA methylation of CCGG sites. Based on the presence or absence of a band, methylation patterns can be classified into four types: type I bands present for both enzyme combinations; type II bands present only for EcoRI/HpaII; type III bands present for EcoRI/MspI; and type IV bands absent from both enzyme combinations. Here, type II represents hemi-methylated bands, whereas type III and IV bands represent hemi- or full-methylation, respectively. The results showed that root irradiation led to a slight decrease in the proportion of methylated CCGG sites, from 22.58% in control plants to 20.56% in the plants that had irradiated roots (Table 2). Among these, full-methylation ratio (type III and type IV) dropped from 19.35% in control plants to 17.74% in plants with irradiated roots, hemi-methylated ratio from 3.23% to 2.82%, whereas the non-methylation ratio increased from 77.42% in control plants to 79.44% in plants with irradiated roots. In the current study, the DNA demethylation was mainly attributed to type IV fragments, suggesting that the DNA demethylation induced by root irradiation occurred primarily in fully methylated cytosine on both DNA strands.

0

XU ET AL.

The results preliminarily suggested an existence of radiation-induced epigenetic bystander effects in plants. The Change in DNA Methylation Pattern Induced by Root Irradiation

The resulting banding patterns were further divided into three classes in terms of status of DNA methylation (Fig. 3 and Table 3). Patterns A, B and C represent the monomorphic class, in which the methylation pattern remained unchanged after root irradiation. Patterns D, E, F, G, H and I represent cytosine demethylation patterns. And patterns J, K, L, M, N and O represent methylation pattern. As shown in Table 3, 94.76% of the CCGG sites were not changed by the RIBE. Of the CCGG sites, 4.43%, including 7 of full-methylated loci and 3 of hemimethylated loci, were demethylated after root irradiation and only 0.81% of CCGG sites, 2 of demethylated loci, were methylated. These results suggested that demethylation of CCGG sites in plants might be sensitive to RIBE. The Change in DNA Methylation in the MSAP Bands Induced by Root Irradiation

The above results of MSAP can only detect the status of methylation in the related enzyme-cutting sites. To obtain more information about the DNA methylation, the detailed change of DNA methylation in the sequences flanking these cutting sites was further analyzed using the BSP technology. Three DNA MSAP bands, marked as S1–S3, were recovered and sequenced (Table 4), and the BLAST program was used to searched for additional information on the databases at the NCBI website (http://blast.ncbi.nlm. nih.gov). The results indicated that all of the three bands resulted from EcoRI and HpaII/MspI heterodigestions. The S1–S3 bands showed significant similarity to the known nuclear genes, as shown in Table 4. The status of DNA methylation over these bands was measured in detail using sodium bisulfite genomic DNA sequencing, after which three segments (from AT1G10430, AT4G00520 and NC_001284.2) were amplified, covering the whole sequences of S1, S2 and S3 bands, respectively. The results showed that for the segment (AT4G00520), root irradiation led to significant demethylation at the 4th and 6th CG sites, from 100% and 93.8% in control plants to 64.3% and 71.4% in rootirradiated plants, respectively. No change or slight change was detected at the other six CG sites, as shown in Fig. 3A. The total DNA methylation ratio dropped from 69.5% to 62.5% after root irradiation, as shown in Fig. 4A. Relative to CG sites, CHG and CHH sites had a lower background level of methylation in this segment. Root irradiation led to a complete demethylation at CHG sites and slight decrease at CHH sites (Fig. 4A). For the NC_001284.2 segment, root irradiation caused an extensive demethylation at all the detected CG sites, and average methylation ratio of 12 CG sites dropped from 26.92% in control plants to 14.10%

in root-irradiated plants, as shown in Figs. 3B and 4B. Similarly, this segment exhibited lower methylation ratios at the CHG and CHH sites. Root irradiation also resulted in a decrease in methylation ratio at CHG sites, but almost no change at CHH sites, as shown in Fig. 4B. Since the AT1G10430 segment showed lower methylation backgrounds for all the CG, CHG and CHH sites (Supplementary Fig. S1A; http://dx.doi.org/10.1667/RR13909.1.S1), the effect of root irradiation on the segment was not further assessed. We also measured the changes in DNA methylation in other three published DNA segments (At4G03510, At2G25355 and AT5G02620), which cover all or most of three differential MSAP bands induced by seed irradiation with low-energy nitrogen and argon ions (65). It was shown that for the At4G03510 segment, after root irradiation, the average methylation ratio of all the 17 CG sites was enhanced from 40.72% in control plants to 51.13% in the root-irradiated plants, 8 of which exhibited the increased methylation ratios. The largest increase occurred at the first four CG sites, from 42.31% of methylation ratio in control plants to 65.38% in rootirradiated plants, as shown in Figs. 3C and 4C. Similarly, there was a decrease in methylation ratios at CHG and CHH sites after root irradiation, although with lower background levels, as shown in Fig. 4C. The effects of root irradiation on the methylation ratios in the At2G25355 and AT5G02620 segments were not further assessed due to their lower methylation levels at all the CG, CHG and CHH sites, as shown in Supplementary Fig. S1B and C (http://dx.doi.org/10.1667/RR13909.1.S1). The Change in the Expressions of Methylation-Related Genes after Root Irradiation

It is well known that status of DNA methylation can be regulated jointly by the DNA methyltransferases and bifunctional 5-methylcytosine glycosylases (38–40, 45– 47). Therefore, this current study, after root irradiation we investigated the expressions of methylation-related SUVH4, DRM2 and MET1 genes and demethylation-related DML3 gene were detected using real-time quantitative PCR and qPCR primer pairs and our results are shown in Table S2 (http://dx.doi.org/10.1667/RR13909.1.S1). The results demonstrate that the expressions of SUVH4 and DRM2 genes were significantly downregulated at 24 h after root irradiation (P , 0.05) and slightly dropped at 48 h after root irradiation (P . 0.05) (Fig. 5A and B). However, the expression level of the MET1 gene was significantly upregulated at 24 h after root irradiation (P , 0.05) and dropped to baseline level at 48 h after root irradiation (Fig. 5C). The expression level of demethylation-related DML3 gene was not changed at 24 h after root irradiation (P . 0.05) but was upregulated at 48 h after root irradiation (Fig. 5D). These results suggested that the epigenetic machinery may indeed be modulated by the RIBE.

RADIATION-INDUCED EPIGENETIC BYSTANDER EFFECTS IN PLANTS

FIG. 3. The changes in DNA methylation at CG sites by root irradiation. The tested segments are from partial sequences of AT4G00520 (panel A), NC_001284.2 (panel B) and AT4G03510 (panel C). The open circles represent the status of non-methylation at CG sites and filled circles are methylated CG sites.

0

0

XU ET AL.

TABLE 3 Changes in DNA Methylation Patterns in A. Thaliana Seedlings after Root Irradiation Banding pattern Control

Irradiated

Description of pattern

Class

H

M

H

M

No change

A B C Total Ratio D E F G H I Total Ratio J K L M N O Total Ratio

1 1 0

1 0 1

1 1 0

1 0 1

1 0 0 0 0 0

0 1 0 1 0 0

1 1 1 1 1 0

1 1 1 0 0 1

1 1 1 1 1 0

1 1 0 1 0 1

1 0 0 0 0 0

0 1 1 0 0 0

Demethylation

Methylation

190 5 40 235 94.76% 3 1 3 0 1 3 11 4.43% 1 1 0 0 0 0 2 0.81%

Notes. Columns H and M represent the pattern after digestion with EcoRI/HpaII and EcoRI/MspI, respectively. The number 1 represents the presence of bands and 0 represents the absence of bands.

Transcriptional Activation of GUS of A. thaliana Line L5-1 after Root Irradiation

Time Course of Bystander Signaling for the RIBE-Mediated Activation of Multicopy P35S:GUS

To further confirm that the epigenetic machinery was involved in the RIBE, the A. thaliana line L5-1 carrying a single insert of a multicopy P35S:GUS gene, which is usually silenced by TGS, was used for studying epigenetic regulation of repetitive elements (57–59). In this study, the 6-day-old seedlings of L5-1 were subjected to root irradiation, and GUS activities of the aerial plants were quantitatively measured at day 3 and 8 after root irradiation. No significant change in GUS activity was observed at day 3 after root irradiation compared to control plants (P . 0.05), whereas a significant increase in GUS activities was observed at day 8 after root irradiation compared to the control plants (P , 0.01) (Fig. 6A). Histochemical staining of L5-1 seedlings also showed that the distribution of GUS activity in leaves was not changed at day 3 after root irradiation, but was enlarged at day 8 after root irradiation (Fig. 6B). Those results suggest that epigenetic regulation on repetitive elements can be changed through RIBE.

We further investigated the time course of bystander signaling for the transcriptional activation of multicopy P35S:GUS. The irradiated distal primary roots were removed at various time points after irradiation, and the GUS activities in aerial plants were assayed by day 8 after root irradiation. As shown in Fig. 6C, relative to the intact control plants (NCT), root cutting itself (M-CT) did not change the expression level of the GUS gene in L5-1 plants (P . 0.05). The irradiated roots removed from the plants at 6 or 12 h after exposure showed basal expression levels of the GUS gene compared to NCT (in both cases, P . 0.05), whereas the irradiated roots removed from plants at 24 h exhibited significant increases in GUS activity over NCT (P , 0.05). This data suggests that the bystander signaling molecule(s) for the epigenetic changes is being generated in root cells at the early stage after root irradiation.

TABLE 4 BLAST Results of Polymorphic Methylated DNA Fragments MSAP fragment Name S1 S2 S3

Primer (E/HM)

Size (bp)

Locus

Sequence homology

E value

3/3 6/6 10/6

220 219 275

AT1G10430 AT4G00520 NC_001284.2

Protein phosphatase 2A-2 Acyl-CoA thioesterase family protein NADH dehydrogenase subunit 1

1.00E-109 2.00E-107 7.00E-134

RADIATION-INDUCED EPIGENETIC BYSTANDER EFFECTS IN PLANTS

0

days. After root irradiation, the seedlings were transferred to MS media containing the same concentration of DMSO, until their GUS activities were detected at day 8 after root irradiation. The 0.4 and 1% DMSO treatments did not significantly change GUS activity in L5-1seedlings compared to the control plants (in both cases, P . 0.05) (Fig. 7). However, both 0.4 and 1% DMSO treatment exhibited significant repressive effects on the transcriptional activation of multicopy P35S:GUS by RIBE compared to their root irradiation controls (in both cases, P , 0.01) (Fig. 7), suggesting that ROS may indeed play a critical role in RIBE-mediated epigenetic effects. DISCUSSION

FIG. 4. RIBE-mediated changes in methylation ratios at CG, CHG and CHH sites in segments of AT4G00520 (panel A), NC_001284.2 (panel B) and AT4G03510 (panel C).

The Role of ROS in RIBE-Mediated Epigenetic Changes

Our previous studies have shown that ROS take part in mediating radiation-induced bystander effects in plants (27). In the current study, we wanted to further investigate whether ROS was also involved in RIBE-mediated epigenetic changes. For this purpose, L5-1 seedlings were first pretreated on the media with 0.4 and 1% DMSO for 2

It is well known that ionizing radiation can change the status of DNA methylation in plants (66, 67). The work by Yu et al. showed that low-energy nitrogen and argon-ion irradiation (100 KeV) of dormant seeds of A. thaliana can lead to some changes in DNA methylation in the seedlings 3 weeks after irradiation (65). Due to their lower penetrating potential, these ions were theoretically considered not to reach the SAM and RAM cells inside the seeds. Therefore, the authors hypothesized that the change in DNA methylation in seedlings by low-energy ions was caused by RIBE. However, considering the heterogeneous characteristics and channels of biological tissues, it was at least possible that low-energy ions or their excited secondary rays might directly transverse the SAM and RAM cells inside seeds (68). Therefore, more robust evidence was necessary to test whether radiation-induced epigenetic bystander effects could be induced in plants. To our knowledge, this current study, using a unique experimental method to test RIBE in A. thaliana, is the first to show unambiguous evidence for RIBE-mediated epigenetic changes in higher plants. This finding also provides some novel insight into the mechanisms underlying bystander effects in plants, although with a much higher radiation dose than would be received from environmental radiation. In this study, the extent and pattern of DNA methylation over the global genome was first measured with MSAP at day 8 after root irradiation. In the tested sites, the DNA methylation status of 94.76% CCGG sites was not changed, demethylation occurred at 4.43% CCGG sites and methylation only at 0.81% CCGG sites. In general, root irradiation led to a trend of demethylation over the whole genome, in agreement with a previously reported study in mammal models in vivo (69). Among these sites, all type IV sites (full-methylation) underwent demethylation, transforming into three type I sites (non-methylation), one type II site (hemi-methylation) and three type III sites (internal CGmethylation), respectively, suggesting that the type IV sites might be sensitive to RIBE. In this work, the changes in the extent and pattern of DNA methylation could be detected at day 8 after root irradiation, rather than day 3, indicating that the RIBE-mediated change in DNA methylation might be a

0

XU ET AL.

FIG. 5. Radiation-induced changes in roots in the transcriptional levels of methylation-related SUVH4 (panel A), MET1 (panel B) and DRM2 (panel C) genes and demethylation-related DML3 gene (panel D). Results are means 6 SD (n . 3; t test; *P , 0.05 and **P , 0.01, compared to the control).

long-term process. It has been reported that DNA damage repair can lead to DNA demethylation in plants (70, 71). Our previous work showed that root irradiation increased DNA strand breaks and upregulated the expression of DNA damage repair genes in bystander aerial plants (27). Therefore, one possible reason is that the RIBE-mediated DNA damage and the subsequent repair might lead to some changes in DNA methylation. Alternatively, the DNA strand breaks and their repair induced by RIBE occurred mainly at the early stage after exposure (within 4 days after root irradiation), whereas we could not detect the changes in DNA methylation with MSAP and transcriptional activity of multicopy P35S:GUS at day 3 after root irradiation (Fig. 6A and B). However, in our previous study, we reported that the induction of homologous recombination by RIBE is persistent, indicating the existence of low-level induction of DNA damage at a later stage of RIBE, probably from radiation-induced genomic instability (27). Therefore, the repair of persistent DNA damage might be a possible explanation for the delayed DNA demethylation in RIBE. We then measured the detailed status of DNA methylation in some specific DNA segments from MSAP bands. The changes in DNA methylation by RIBE occurred mainly at the symmetric CG sites, and had an obvious divergence in

different DNA segments, exhibiting decrease in methylation ratios in the NC_001284.2 and AT4G00520 segments and increase in At4G03510 segment, and no change in the remaining three segments (Fig. 4A, B, C and Supplementary Fig. S1; http://dx.doi.org/10.1667/RR13909.1.S1). Even for CG sites within the single segment, they also exhibited varying degrees of change in DNA methylation after root irradiation. In this study, we also reported that DNA methylation machinery could be modulated by RIBE, which we demonstrated by the altered expression of methylation- and demethylation-related genes (Fig. 5). Considering the divergent changes of DNA methylation, the regulation pattern of methylation by RIBE appears to be cell or tissue specific, even varying at different DNA locations within single cells. Indeed, investigators have shown the status of DNA methylation on the genome within various cells is regulated by developmental clues (72). It has been reported that the RIBE can affect the development in the bystander parts of A. thaliana plants (25, 26). Therefore, it is more likely that root irradiation directly modulates the development program of aerial leafy parts of the plants, and then leads to changes in DNA methylation. In addition, genotoxic stress-induced bystander effects are mediated in part through small RNAs (73) and DNA methylation can

RADIATION-INDUCED EPIGENETIC BYSTANDER EFFECTS IN PLANTS

0

FIG. 7. The repressive effect of DMSO on the RIBE-mediated transcriptional activation of multicopy P35S:GUS in L5-1 plants. Results are means 6 SD (n . 10; t test; *P , 0.05 and **P , 0.01, compared to the control).

FIG. 6. The RIBE-mediated transcriptional activation of multicopy P35S:GUS in L5-1 line. Panel A: The GUS activity in aerial plants of L5-1 at day 3 and 8 after root irradiation. Panel B: The distribution of GUS activity in aerial plants of L5-1 at day 3 and 8 after root irradiation. Panel C: The time course for the generation and translocation of bystander signaling molecule(s), the irradiated distal roots were removed at indicated time points. Results are means 6 SD (n . 10; t test; **P , 0.01, compared to the control in panel A and to NCT in panel C).

also be regulated by small RNAs (74). Therefore, it is also likely that the status of DNA methylation might be changed by RIBE through RNA-directed DNA methylation. The A. thaliana-line L5-1 offered a convenient and rapid method to study epigenetic regulation of repetitive elements (57–59). Using L5-1 line, we showed the RIBE-mediated epigenetic regulation on the repetitive elements, the role of ROS in this process and the time course of bystander signaling for epigenetic changes. However, the transcriptional activation of multicopy P35S:GUS in line L5-1 can be induced by either the DNA demethylation or the alteration in chromatin structure or other factors. It has been reported that the transcriptional activation of multicopy P35S:GUS in line L5-1 by heat stress can occur without loss of DNA methylation and with only minor changes to histone modifications, whereas significant loss of nucleosomes and heterochromatin decondensation were observed (57). Therefore, although the transcriptional activation of multicopy P35S:GUS in line L5-1 after root irradiation indicated evidence of RIBE-mediated epigenetic changes in plants, it remains necessary for us to further clarify the mechanism underlying epigenetic regulation of repetitive sequences in RIBE in our future studies. In general, this current study shows unambiguous evidence regarding the radiation-induced epigenetic bystander effects in plants, with DNA methylation changes and transcriptional activity of multicopy P35S:GUS as biological end points. Considering the diversity of epigenetic regulation, other aspects of epigenetics, including the RNA-mediated modification, histone modification and chromosome remodeling will also be part of our future

0

XU ET AL.

investigations of RIBE in A. thaliana, which we propose is an ideal system for epigenetic research. A. thaliana not only has epigenetic mechanisms as sophisticated as mammals, but can also tolerate null mutations in many epigenetic regulators that are lethal in mammals, which should greatly facilitate further genetic dissection of the molecular mechanisms underlying radiation-induced bystander epigenetic effects.

12.

13.

14.

SUPPLEMENTARY INFORMATION

Table S1. BSP primers used in this study. Table S2. qPCR primers used in this study. Fig. S1. Changes in methylation ratios at CG, CHG and CHH sites in segments of AT1G10430 (panel A), AT2G25355 (panel B) and AT5G02620 (panel C). ACKNOWLEDGMENTS We thank Dr. Ortrun Mittelsten Scheid and NASC for their generous provision of the various A. thaliana seeds. The authors also thank Dr. Zhengyan Wu for his valuable discussion and careful revision. This work was supported by the National Science Fund of China (11105173, 11275230).

15.

16.

17.

18.

19.

Received: September 12, 2014; accepted: January 20, 2015; published online: 00 00, 00

REFERENCES 1. Hei TK. Cyclooxygenase-2 as a signaling molecule in radiationinduced bystander effect. Mol Carcinog 2006; 45:455–60. 2. Morgan WF. Non-targeted and delayed effects of exposure to ionizing radiation: I. Radiation induced genomic instability and bystander effects in vitro. Radiat Res 2003; 159:567–80. 3. Little JB. Genomic instability and bystander effects: a historical perspective. Oncogene 2003; 22:6978–87. 4. Mothersill C, Seymour CB. Radiation-induced bystander effects— implications for cancer. Nat Rev Cancer 2004; 4:158–64. 5. Hamada N, Matsumoto H, Hara T, Kobayashi Y. Intercellular and intracellular signaling pathways mediating ionizing radiationinduced bystander effects. Radiat Res 2007; 48:87–95. 6. Belyakov OV, Folkard M, Mothersill C, Prise KM, Michael BD. Bystander-induced apoptosis and premature differentiation in primary urothelial explants after charged particle microbeam irradiation. Radiat Prot Dosimetry 2002; 99:249–51. 7. Belyakov OV, Folkard M, Mothersill C, Prise KM, Michael BD. A proliferation-dependent bystander effect in primary porcine and human urothelial explants in response to targeted irradiation. Br J Cancer 2003; 88:767–74. 8. Belyakov OV, Mitchell SA, Parikh D, Randers-Pehrson G, Marino SA, Amundson SA, et al. Biological effects in unirradiated human tissue induced by radiation damage up to 1 mm away. Proc Natl Acad Sci USA. 2005; 102:14203–8. 9. Persaud R, Zhou H, Baker SE, Hei TK, Hall EJ. Assessment of low linear energy transfer radiation-induced bystander mutagenesis in a three-dimensional culture model. Cancer Res 2005; 65:9876– 82. 10. Belyakov OV, Folkard M, Mothersill C, Prise KM, Michael BD. Bystander induced differentiation: a major response to targeted irradiation of a urothelial explant model. Mutat Res 2006; 597:43– 9. 11. Sedelnikova OA, Nakamural A, Kovalchuk O, Koturbash I, Mitchell SA, Marino SA, et al. DNA double-strand breaks form in

20.

21.

22.

23.

24.

25.

26.

27.

28.

29.

bystander cells after microbeam irradiation of three-dimensional human tissue models. Cancer Res 2007; 67:4295–302. Watson GE, Lorimore SA, Macdonald DA, Wright EG. Chromosomal instability in unirradiated cells induced in vivo by a bystander effect of ionizing radiation. Cancer Res 2000; 60:5608– 11. Xue LY, Butler NJ, Makrigiorgos GM, Adelstein SJ, Kassis AI. Bystander effect produced by radiolabeled tumor cells in vivo. Proc Natl Acad Sci U S A 2002; 99:13765–70. Koturbash I, Rugo RE, Hendricks CA, Loree J, Thibault B, Kutanzi K, et al. Irradiation induces DNA damage and modulates epigenetic effectors in distant bystander tissue in vivo. Oncogene 2006; 25:4267–75. Koturbash I, Boyko A, Rodriquez-Juarez R, McDonald RJ, Tryndyak VP, Kovalchuk I, et al. Role of epigenetic effectors in maintenance of the long-term persistent bystander effect in spleen in vivo. Carcinogenesis 2007; 28:1831–8. Koturbash I, Kutanzi K, Hendrickson K, Rodriquez-Juarez R, Kogosov D, Kovalchuk O. Radiation-induced bystander effects in vivo are sex specific. Mutat Res 2008; 642:28–36. Mancuso M, Pasquali E, Leonardi S, Tanori M, Rebessi S, Di Majo V, et al. Oncogenic bystander radiation effects in Patched heterozygous mouse cerebellum. Proc Natl Acad Sci U S A 2008; 105:12445–50. Bertucci A, Pocock RD, Randers-Peherson G, Brenner DJ. Microbeam irradiation of the C. elegans nematode. Radiat Res 2009; 50:A49–A54. Kaup S, Grandjean V, Mukherjee R, Kapoor A, Keyes E, Seymour CB, et al. Radiation-induced genomic instability is associated with DNA methylation changes in cultured human keratinocytes. Mutat Res 2006; 597:87–97. Sedelnikova OA, Nakamura A, Kovalchuk O, Koturbash I, Mitchell SA, Marino SA, et al. DNA double-strand breaks form in bystander cells after microbeam irradiation of three-dimensional human tissue models. Cancer Res 2007; 67:4295–302. Sokolov MV, Smilenov LB, Hall EJ, Panyutin IG, Bonner WM, Sedelnikova OA. Ionizing radiation induces DNA double-strand breaks in bystander primary human fibroblasts. Oncogene 2005; 24:7257–65. Smilenov LB, Hall EJ, Bonner WM, Sedelnikova OA. A microbeam study of DNA double-strand breaks in bystander primary human fibroblasts. Radiat Prot Dosimetry 2006; 122:256– 9. Burdak-Rothkamm S, Short SC, Folkard M, Rothkamm K, Prise KM. ATR-dependent radiation-induced gamma H2AX foci in bystander primary human astrocytes and glioma cells. Oncogene 2007; 26:993–1002. Yang H, Anzenberg V, Held KD. The time dependence of bystander responses induced by iron-ion radiation in normal human skin fibroblasts. Radiat Res 2007; 168:292–8. Yang G, Wu L, Chen L, Pei B, Wang Y, Zhan F, et al. Targeted irradiation of shoot apical meristem of Arabidopsis embryos induces long-distance bystander/abscopal effects. Radiat Res 2007; 167:298–305. Yang G, Mei T, Yuan H, Zhang WM, Chen LY, Xue JM, et al. Bystander/abscopal effects induced by low-energy ion irradiation on intact Arabidopsis seeds. Radiat Res 2008; 170:372–80. Li F, Liu P, Wang T, Bian P, Wu Y, Wu L, et al. The induction of bystander mutagenic effects in vivo by a-irradiation in whole Arabidopsis thaliana plants. Radiat Res 2010; 174:228–37. Li F, Wang T, Xu SY, Yuan H, Bian P, Wu YJ, et al. Abscopal mutagenic effect of low-energy-ions in Arabidopsis thaliana seeds. Int J Radiat Biol 2011; 87:1–10. Wang T, Li F, Xu S, Bian P, Wu Y, Wu L, et al. The time course of long-distance signaling in radiation-induced bystander effect in vivo in Arabidopsis thaliana demonstrated using root micrografting. Radiat Res 2011; 176:234–43.

RADIATION-INDUCED EPIGENETIC BYSTANDER EFFECTS IN PLANTS

30. Wang T, Li F, Xu W, Bian P, Wu Y, Wu L. Novel features of radiation-induced bystander signaling in Arabidopsis thaliana demonstrated using root micro-grafting. Plant Signal Behav 2012; 7:1566–72. 31. Richards EJ. Inherited epigenetic variation-revisiting soft inheritance. Nat Rev Genet 2006; 7:395–401. 32. Bird A. Perceptions of epigenetics. Nature 2007; 447:396–98. 33. Martienssen RA, Colot V. DNA methylation and epigenetic inheritance in plants and filamentous fungi. Science 2001; 293:1070–4. 34. Courtier B, Heard E, Avner P. Xce haplotypes show modified methylation in a region of the active X chromosome lying 3 0 to Xist. Proc Natl Acad Sci U S A 1995; 92:3531–5. 35. Gonzalgo ML, Jones PA. Mutagenic and epigenetic effects of DNA methylation. Mutat Res 1997; 386:107–18. 36. Ramsahoye B, Biniszkiewicz D, Lyko F, Clark V, Bird AP, Jaenisch R. Non-CG methylation is prevalent in embryonic stem cells and may be mediated by DNA methyltransferase 3a. Proc Natl Acad Sci U S A 2000; 97:5237–42. 37. Lister R, Pelizzola M, Dowen RH, Hawkins RD, Hon G, TontiFilippini J, et al. Human DNA methylomes at base resolution show widespread epigenomic differences. Nature 2009; 462:315–22. 38. Ronemus MJ, Galbiati M, Ticknor C, Chen J, Dellaporta SL. Demethylation-induced developmental pleiotropy in Arabidopsis. Science 1996; 273:654–7. 39. Lindroth AM, Cao X, Jackson JP, Zilberman D, McCallum CM, Henikoff S, et al. Requirement of chromomethylase3 for maintenance of CpXpG methylation. Science 2001; 292:2077–80. 40. Cao X, Jacobsen SE. Locus-specific control of asymmetric and CpNpG methylation by the DRM and CMT3 methyltransferase genes. Proc Natl Acad Sci U S A 2002; 99:16491–8. 41. Jones L, Ratcliff F, Baulcombe DC. RNA-directed transcriptional gene silencing in plants can be inherited independently of the RNA trigger and requires Met1 for maintenance. Curr Biol 2001; 11:747–57. 42. Cao X, Aufsatz W, Zilberman D, Mette MF, Huang MS, Matzke M, et al. Role of the DRM and CMT3 methyltransferases in RNAdirected DNA methylation. Curr Biol 2003; 13:2212–7. 43. Pontes O, Li CF, Nunes PC, Haag J, Ream T, Vitins A, et al. The Arabidopsis chromatin-modifying nuclear siRNA pathway involves a nucleolar RNA processing center. Cell 2006; 126:79–92. 44. Malagnac F, Bartee L, Bender J. An Arabidopsis SET domain protein required for maintenance but not establishment of DNA methylation. EMBO J 2002; 21:6842–52. 45. Agius F, Kapoor A, Zhu JK. Role of the Arabidopsis DNA glycosylase/lyase ROS1 in active DNA demethylation. Proc Natl Acad Sci U S A 2006; 103:11796–801. 46. Morales-Ruiz T, Ortega-Galisteo AP, Ponferrada-Marı´n MI, Martı´nez-Macı´as MI, Ariza RR, Rolda´n-Arjona T. Demeter and repressor of silencing 1 encode 5-methylcytosine DNA glycosylases. Proc Natl Acad Sci U S A 2006; 103:6853–8. 47. Gehring M, Huh JH, Hsieh TF, Penterman J, Choi Y, Harada JJ, et al. Demeter DNA glycosylase establishes MEDEA polycomb gene self-imprinting by allele-specific demethylation. Cell 2006; 124:495–506. 48. Rabinowicz PD, Schutz K, Dedhia N, Yordan C, Parnell LD, Stein L, et al. Differential methylation of genes and retrotransposons facilitates shotgun sequencing of the maize genome. Nat Genet 1999; 23:305–8. 49. Colot V, Rossignol JL. Eukaryotic DNA methylation as an evolutionary device. Bioessays 1999; 21:402–11. 50. Chan S W L, Zilberman D, Xie Z, Johansen LK, Carrington JC, Jacobsen SE. RNA silencing genes control de novo DNA methylation. Science 2004; 303:1336–6. 51. Zilberman D, Cao X, Johansen LK, Xie Z, Carrington JC, Jacobsen SE. Role of Arabidopsis argonaute4 in RNA-directed

52.

53.

54.

55.

56.

57.

58.

59.

60.

61.

62.

63.

64.

65.

66.

67.

68. 69.

70.

0

DNA methylation triggered by inverted repeats. Curr Biol 2004; 14:1214–20. Mette M F, Aufsatz W, Van der Winden J, Matzke MA, Matzke AJM. Transcriptional silencing and promoter methylation triggered by double-stranded RNA. EMBO J 2000; 19:5194–201. Soppe WJ, Jacobsen SE, Alonso-Blanco C, Jackson JP, Kakutani T, Koornneef M. The late flowering phenotype of fwa mutants is caused by gain-of-function epigenetic alleles of a homeodomain gene. Mol Cell 2000; 6:791–802. Soppe WJJ, Jasencakova Z, Houben A, Kakutani T, Meister A, Huang MS, et al. DNA methylation controls histone H3 lysine 9 methylation and heterochromatin assembly in Arabidopsis. EMBO J 2002; 21:6549–59. Mosher RA, Melnyk CW, Kelly KA, Dunn RM, Studholme DJ, Baulcombe DC. Uniparental expression of PolIV-dependent siRNAs in developing endosperm of Arabidopsis. Nature 2009; 460:283–6. Lippman Z, May B, Yordan C, Singer T, Martienssen R. Distinct mechanisms determine transposon inheritance and methylation via small interfering RNA and histone modification. PloS Biol 2003; 1:420–8. Pecinka A, Dinh HQ, Baubec T, Rosa M, Lettner N, Mittelsten Scheid O. Epigenetic regulation of repetitive elements is attenuated by prolonged heat stress in Arabidopsis. Plant Cell 2010; 22:3118– 29. Elmayan T, Proux F, Vaucheret H. Arabidopsis RPA2: a genetic link among transcriptional gene silencing, DNA repair, and DNA replication. Curr Biol 2005; 15:1919–25. Lang-Mladek C, Popova O, Kiok K, Berlinger M, Rakic B, Aufsatz W, et al. Transgenerational inheritance and resetting of stress-induced loss of epigenetic gene silencing in Arabidopsis. Mol Plant 2010; 3:594–602. Rogers SO, Bendich AJ. Extraction of DNA from milligram amounts of fresh, herbarium and mummified plant tissues. Plant Mol Biol 1985; 5:69–76. Xiong LZ, Xu CG, Saghai Maroof M A, Zhang Q. Patterns of cytosine methylation in an elite rice hybrid and its parental lines, detected by a methylation-sensitive amplification polymorphism technique. Mol Gen Genet 1999; 261:439–46. 62. Kirsten Bomblies MB. Quantitative GUS activity assay. In: Weigel D, Glazebrook J, editors. Arabidopsis—A laboratory manual. New York: Cold Spring Harbor; 2002. p. 249–52. Li LL, Santerre-Ayotte S, Boivin EB, Jean M, Belzile F. A novel reporter for intrachromosomal homoeologous recombination in Arabidopsis thaliana. Plant J 2004; 40:1007–15. Walbot V. Reactivation of the Mutator transposable element system following gamma irradiation of seed. Mol Gen Genet 1988; 212:259–64. Yu H, Zhao J, Xu J, Li X, Zhang F, Wang Y, et al. Detection of changes in DNA methylation induced by low-energy ion implantation in Arabidopsis thaliana. Radiat Res 2011; 175:599– 609. Kovalchuk O, Burke P, Arkhipov A, Kuchmab N, Jamesc SJ, Kovalchuk I, et al. Genome hypermethylation in Pinus silvestris of Chernobyl–a mechanism for radiation adaptation? Mutat Res 2003; 529:13–20. Kovalchuk I, Abramov V, Pogribny I, Kovalchuk O. Molecular aspects of plant adaptation to life in the Chernobyl zone. Plant Physiol 2004; 135:357–63. Yu ZL. Introduction to ion beam biotechnology. New York: Springer; 2006. Koturbash I, Pogribny I, Kovalchuk O. Stable loss of global DNA methylation in the radiation-target tissue–a possible mechanism contributing to radiation carcinogenesis? Biochem Biophys Res Commun 2005; 337:526–33. Choi Y, Gehring M, Johnson L, Hannon M, Harada JJ, Goldberg RB, et al. Demeter, a DNA glycosylase domain protein, is required

0

XU ET AL.

for endosperm gene imprinting and seed viability in Arabidopsis. Cell 2002; 110:33–42. 71. Gong Z, Morales-Ruiz T, Ariza RR, Rolda´n-Arjona T, David L, Zhu JK. ROS1, a repressor of transcriptional gene silencing in Arabidopsis, encodes a DNA glycosylase/lyase. Cell 2002; 111:803–14. 72. Richards EJ. DNA methylation and plant development. Trends Genet 1997; 13:319–23.

73. Dickey JS, Zemp FJ, Martin OA, Kovalchuk O. The role of miRNA in the direct and indirect effects of ionizing radiation. Radiat Environ Biophys 2011; 50:491–9. 74. He XJ, Hsu YF, Zhu S, Wierzbicki AT, Pontes O, Pikaard CS, et al. An effector of RNA-directed DNA methylation in Arabidopsis is an argonaute 4- and RNA-binding protein. Cell 2009; 137:498– 508.