International Journal of Pediatric Otorhinolaryngology 78 (2014) 1461–1466
Contents lists available at ScienceDirect
International Journal of Pediatric Otorhinolaryngology journal homepage: www.elsevier.com/locate/ijporl
R75Q de novo dominant mutation of GJB2 in a Chinese family with hearing loss and palmoplantar keratoderma Shu-juan Jiang a , Zheng-hong Di b , Dan Huang a , Jiu-bin Zhang c , Yuan-yuan Zhang a , Shu-qin Li d, Rong He a, * a
Clinical Genetics Department, The Affiliated Shengjing Hospital, China Medical University, 110004 Shenyang, Liaoning, PR China Dermatological Department, The Affiliated Shengjing Hospital, China Medical University, 110004 Shenyang, Liaoning, PR China Orthopedics Department, The First Affiliated Hospital, China Medical University, 110001 Shenyang, Liaoning, PR China d Virus Laboratory, The Affiliated Shengjing Hospital, China Medical University, 110004 Shenyang, Liaoning, PR China b c
A R T I C L E I N F O
A B S T R A C T
Article history: Received 19 February 2014 Received in revised form 1 June 2014 Accepted 5 June 2014 Available online 16 June 2014
Objectives: Mutations in the GJB2 gene encoding connexin 26 (Cx26) are major causes of hereditary deafness. This study aimed to characterize the mutation profiles of the GJB2 gene in a Chinese family with sensorineural hearing loss. Methods: A Chinese family that included three individuals with sensorineural hearing loss and palmoplantar keratoderma underwent complete physical examinations, audiological examinations including pure tone audiometry and auditory brainstem response, skin pathological examination, and temporal CT scans. The entire coding region of GJB2, GJB3, GJB6, and the coding exons (exon7 + 8 and 19) of SLC26A4, mitochondrial 12SrRNA, and tRNA Ser (UCN) were sequenced. Structural analysis was performed to detect the effects of mutation on the tertiary structure of Cx26. Results: A dominant GJB2 mutation, c.224G>A (p.Arg75Gln, p.R75Q), was detected in the family. No other mutation was identified in GJB2, GJB3, GJB6, or the coding exons (exon7 + 8 and 19) of SLC26A4, mitochondrial 12SrRNA, and tRNA Ser (UCN). Structural analysis revealed that the p.R75Q mutation likely affects the structural stability and permeation properties of the Cx26 gap junction channel. Conclusion: Our findings provide further evidence of a correlation between the p.R75Q mutation in Cx26 and a syndromic hearing impairment with palmoplantar keratoderma. ã 2014 Elsevier Ireland Ltd. All rights reserved.
Keywords: De novo mutation GJB2 gene China Hearing impairment Palmoplantar keratoderma Structural analysis
1. Introduction Hearing loss (HL) is a common sensory disorder, with a prevalence of one to three cases per 1000 newborns and about half of the cases due to genetic causes [1,2]. Genetic causes of hearing impairment are very heterogeneous, showing different patterns of inheritance and involving a multitude of different genes. Several forms of HL are associated with mutations in connexins, particularly connexin 26 (Cx26) coded by the GJB2 gene. Mutations in the GJB2 gene account for up to 50% of nonsyndromic autosomal recessive HL [3].
Abbreviations: Cx26, connexin26; HL, hearing loss; KID, keratitis–ichthyosis– deafness; PPK, palmoplantar keratoderma; HGVS, human genome variation society; PTA, pure tone audiometry; ABR, auditory brainstem response; CT, temporal computerized tomography; CL, cytoplasmic domain; EC, extracellular domain; TM, transmembrane domains; Gj, gap-junctional conductance. * Corresponding author at: Sanhao Street No.36, Heping District, Shenyang City 110004, Liaoning, PR China. Tel.: +86 24 96615 75311; fax: +86 24 23892617. E-mail address: [email protected] (R. He). http://dx.doi.org/10.1016/j.ijporl.2014.06.008 0165-5876/ ã 2014 Elsevier Ireland Ltd. All rights reserved.
In most areas of China, GJB2 gene mutations account for about 18.31% of patients with HL [4]. On the other hand, Dai et al. [5] reported that the frequency of GJB2 mutations was 4.0–30.4% in Chinese patients with nonsyndromic deafness. So far, about 100 different mutations have been identified in the GJB2 gene, the majority of which are autosomal recessive. About 10 mutations are autosomal dominant, and most are associated with various skin diseases, such as keratitis–ichthyosis–deafness (KID) syndrome, Vohwinkel syndrome, and palmoplantar keratoderma (PPK), along with deafness [3]. Deafness with PPK (OMIM 148350), first described by Sharland et al. [6] in 1992, is caused by mutations in GJB2 located on chromosome 13q12.11. To date, the following mutations (annotated according to the Human Genome Variation Society (HGVS) guidelines, version 2.130708) in GJB2 (NM_004004.5) have been identified in this kind of syndromic hearing loss: p.E42del [7], p. N54H [8], p.G59A [9], p.G59S [10], p.H73R [11], p.R75W [12,13], p. R75Q [14,15], p.G130V [16] and p.S183F [17]. Furthermore, the point mutation m.A7445G located in mitochondrial tRNA Ser (UCN) precursor (NC_012920.1) is responsible for deafness with PPK [18].
1462
S.- Jiang et al. / International Journal of Pediatric Otorhinolaryngology 78 (2014) 1461–1466
However, de novo and dominant mutations are rare and only a few studies have described these in Chinese populations. In the present study, we reported a Chinese family presenting with autosomal dominant HL and PPK. The identified p.R75Q mutation in Cx26 provides further evidence for the correlation between the conserved R75 in Cx26 and syndromic hearing impairment with PPK. Furthermore, our study is the first to report a relationship between GJB2 p.R75Q mutation and PPK with deafness in mainland China. 2. Materials and methods 2.1. Clinical evaluation Hearing impairment was defined by audiological examination, including pure tone audiometry (PTA) and auditory brainstem response (ABR). Temporal computerized tomography (CT) scan was performed for the proband to exclude individuals with inner ear malformations. Palmoplantar keratoderma was confirmed by skin pathological examination. A detailed history was obtained to exclude other causes of hearing impairment such as neonatal complications, meningitis or other infections, use of ototoxic medication, and head trauma. 2.2. Mutation analysis Genomic DNA was extracted from peripheral blood using a DNA extraction kit (Watson Biotechnologies Inc., Shanghai, China) after obtaining informed consent. The entire coding region of GJB2 was amplified by PCR using the primers F50 ATGCTTGCTTACCCAGACTCA30 and R50 GGCCTACAGGGGTTTCAAAT30 . PCR amplification was performed in 50-mL reaction volumes containing 100 ng genomic DNA, 1 PCR buffer, 1 mM of each dNTP, 1.5 mM MgCl2, and 1 U Taq DNA polymerase (Takara, Dalian, China). After an initial denaturation at 94 C for 5 min, the reactions were amplified for 32 cycles with denaturation at 94 C for 45 s, annealing at 61 C for 45 s, and extension at 72 C for 1 min, followed by a final extension at 72 C for 10 min. DNA fragments were purified, sequenced, and analyzed by the ABI PRISM 3730 DNA sequencer (Applied Biosystems by Life Technologies, Carlsbad, California, USA). To examine whether other genetic defects were involved in the subjects, the coding region of GJB3, GJB6, and the coding exons (exon 7 + 8 and 19) of SLC26A4, mitochondrial 12SrRNA (m.A1555G and m.C1494T mutations), and tRNA Ser (UCN) (m.A7445G) were also sequenced. Primers and PCR amplification have been described previously [19,20]. Seven family members, including three affected individuals, were detected to have HL. GJB2 from 100 patients with sensorineural HL and 30 individuals with normal hearing were sequenced in this study to confirm the absence of the de novo mutations in the general Chinese population. The sequence data were aligned with the reference sequences in NCBI (NG_008358.1 for GJB2, NG_008309.1 for GJB3, NG_008323.1 for GJB6, NG_008489.1 for SLC26A4 and NC_012920.1 for mtDNA 12SrRNA and tRNA Ser (UCN)) using the DNAStar 5.0 and BioEdit software. Mutations or polymorphisms were identified according to the reference sequences. 2.3. Structural analysis The missense mutation in the human Cx26 protein has been structurally analyzed (PDB code 2ZW3) [21]. The homology model for the mutant form of Cx26 was generated by Swiss-PdbViewer 4.1.0 (http://spdbv.vital-it.ch/) using the wild-type Cx26 as a template. All the structural analyses were carried out using PyMOL
(The PyMOL Molecular Graphics System, DeLano Scientific, Palo Alto, CA, USA; http://www.pymol.org). 3. Results 3.1. Pedigree and Clinical manifestation We ascertained a three-generation Chinese family of Han ethnicity with autosomal dominant inherited HL and PPK. The proband (III-1) was a young man (age 29 years) from Shenyang of Liaoning Province in northeast China. According to the pedigree chart (Fig. 1A), the hearing impairment and PPK is presumably originally inherited from his grandmother because his 54-year-old mother and 52-year-old uncle also had hearing impairment and PPK. The audiological evaluation (Fig. 1B) showed that all of the affected family members had bilateral severe-to-profound sensorineural HL (100–110 dB nHL in the proband at age 27 years, 70–80 dB nHL in his mother at age 52 years, and 80–90 dB nHL in his uncle at age 50 years). None of the patients in this family had a history of aminoglycoside use. Temporal CT scan of the proband showed no obvious abnormalities in the inner ear. Dermatological examination of the affected family members showed diffuse PPK extending to the wrist and the dorsal surfaces of the feet (Fig. 1C). No other cutaneous or clinical abnormalities were observed. Skin biopsies from the thenar region of palm demonstrated histopathological evidence of PPK in the proband and his mother (Fig. 1D). Other clinical risk factors, including aminoglycoside exposure, hyperbilirubinemia, and meningitis, were negative, and no other clinical abnormalities were present in the other members of the family. 3.2. Mutation in the GJB2 gene Sequencing of GJB2 in the three cases showed a heterozygous c.224G>A (p.R75Q) mutation (Fig. 2), resulting in substitution of arginine (Arg, R) by glutamine (Gln, Q) at position 75. Paternity was further confirmed by genotype analysis. The p.R75Q mutation was not found in other family members. Additionally, no other mutation in GJB2 was identified in either of the families, and no sequence aberration or deletion of GJB3, GJB6, or the coding exons (exon7 + 8 and 19) of SLC26A4 were found. Furthermore, sequence analysis of the mitochondrial 12SrRNA and tRNA Ser (UCN) gene failed to detect deafness-associated m.A1555G, m.C1494 T, or m. A7445G mutations in these subjects. No p.R75Q mutation was identified in the 100 patients with sensorineural HL or the 30 individuals with normal hearing. 3.3. Structural analysis Structural analysis showed that the Arg75 of subunit B was located at the edge of subunit B and adjacent to subunit A (Fig. 3A), and that the spatial location of Glu47 and Ser72 in subunit B and the Glu187 in subunit A may interact with Arg75. Further structural analysis revealed that in the wild type Cx26, Arg75 interacted with Glu47 and the main-chain amide Ser72 in the intra-subunit, as well as Glu187 in adjacent subunit, through hydrogen bonding. However, the spatial conformation was greatly changed when Arg75 was substituted with Gln75 in the mutant Cx26, meaning that Gln75 could not form hydrogen bonds with Glu47. Additionally, the interaction between Ser72 and Gln75 was likely also attenuated due to having one fewer hydrogen bond and a greater distance between the two residues. Although Gln75 could still form a hydrogen bond with Glu187 in the adjacent subunit, the combining ability is likely reduced because of the change in spatial location between the residues and the distance between Gln75 and Glu187 is greater (2.89 Å) than the distance between Arg75 and Glu187 (2.61 Å) (Fig. 3B). In addition, the change from a positively
S.- Jiang et al. / International Journal of Pediatric Otorhinolaryngology 78 (2014) 1461–1466
1463
Fig. 1. Chinese pedigree with hearing loss and PKK. (A) Pedigree. Hearing impairment and PKK indicated by solid-filled shapes. Arrow indicates the proband. (B) Audiograms for the proband (III-1), his parents (II-2: mother; II-1: father) and his uncle with hearing loss (II-4: uncle). The horizontal axis of the audiogram shows tone frequency (Hz) and the vertical axis displays hearing level (dBHL). (C) Skin pictures of the proband and his mother. III-1: show the thickening and/or peeling of the skin at palm (a) and dorsum (b) side of the proband's hand and lateral sides (c) of his feet. II-2: show the hand (d, e) and feet (f) of proband's mother with the same skin problem. Arrows indicate the thenar region of the palm in skin biopsies of the proband and his mother. (D) Skin biopsies from thenar region of palm for the proband (III-1) and his mother (II-2) show compact hyperkeratosis and acanthosis with a well-formed granular layer, consistent with the palmoplantar keratosis. (haematoxylin and eosin; original magnification 40).
charged Arg to a neutral Gln may affect the regional environment, which could subsequently impair permeation properties of the Cx26. 4. Discussion
Fig. 2. Identification of GJB2 mutation: partial sequence chromatograms of GJB2 for mutant (III-1) and wild type (II-1) GJB2. Arrows indicates the position of the c.224G>A (p.R75Q) mutation.
Mutations in GJB2 are the most common cause of nonsyndromic autosomal recessive sensorineural hearing loss. A few mutations in GJB2 have been reported to cause dominant nonsyndromic or syndromic hearing loss, but only a few dominant mutations have been described in Chinese populations. The p.R75W mutation causes HL and palmoplantar keratoderma in a Chinese pedigree [12], and p.R143Q and p.R184Q mutations cause nonsyndromic HL in Chinese families [22,23]. The p.R75Q mutation causes autosomal dominant HL and PPK in a Turkish family [14], and has been reported to cause dominant HL with or without PPK in France [15], Italy [24,25], Germany[26], and Taiwan [27]. The present study was the first to report the GJB2 p.R75Q mutation related to deafness and PPK in mainland China. Cx26 is expressed in supporting cells surrounding the sensory hair cells of the cochlea and in epidermis cells, mainly in the skin of the palms and soles [28]. Connexins appear to be important to the function of these tissues, as connexin mutations cause varied levels of deafness and hereditary hyperproliferative skin disorders in
1464
S.- Jiang et al. / International Journal of Pediatric Otorhinolaryngology 78 (2014) 1461–1466
Fig. 3. Structural analysis of the GJB2 p.R75Q mutation. The figure was generated as described in the text. (A) The connexin 26 (Cx26) gap junction channel is formed by end-to-end docking of two connexons, each composed of six Cx26 subunits. This figure shows the location of Arg75 and the residues it interacts with in one of the two connexons. Other subunits in the lateral and foreground of the connexon have been omitted for clarity. (B) The local spatial structure of the residues Arg75 (Gln75), Ser72, Glu47 in subunit B and Glu187 in subunit A. Hydrogen bonds are indicated as dotted lines.
humans [3]. In this study, we found three cases of de novo p.R75Qdominant mutation of GJB2 in a Chinese family. Family history and audiological examinations revealed a progressive type of sensorineural HL in the affected family members. The hearing phenotype caused by the p.R75Q mutation showed severe-to-profound bilateral sensorineural hearing impairment in our patients (100– 110 dB nHL in the proband, 70–80 dB nHL in his mother and 80– 90 dB nHL in his uncle). Interestingly, the higher hearing frequencies were more severely affected in all tested individuals and were independent of the overall severity of hearing impairment. The age of onset and progression of HL also varied among the affected family members. The proband had congenital bilateral profound prelingual HL at the age of one year whereas his mother and uncle presented with hearing impairments at the
approximate age of 20 years that got progressively worse. The variations in the onset age and the severity of HL within the same family may be due to a different degree of explicit influence. The HL caused by p.R75Q all appears to be moderate to profound bilateral sensorineural hearing impairment. Interestingly for this mutation, a PPK phenotype does not consistently occur with hearing loss [15]. In this study, skin biopsies from the thenar region of the palm in the proband and his mother showed compact hyperkeratosis and acanthosis with a well-formed granular layer, which are consistent with PPK. In addition, immunohistochemistry showed that Cx26 accumulated in the upper layers of the wide rete ridge in the patient's palmar epidermis. This may contribute to the phenotype of PPK, as the Cx26 expression in the thenar region of the palm in the proband was greater than his mother, as was his PPK severity. In a previous report, the p.R75Q mutation is shown to cause HL and congenital diffuse palmoplantar hyperkeratosis [14]. In present study, none of the affected individuals had apparent cutaneous abnormalities during infancy, but similar to the work by Feldmann et al. [15], the palmoplantar hyperkeratosis progressed during the later years. This p.R75Q mutation has also been reported to cause nonsyndromic HL [15,24,26,27]. Therefore, the presence of the skin phenotype associated with the GJB2 p.R75Q mutation may be due to different explicit or environmental factors. In addition to the mutation p.R75Q, mutations p.delE42 [7], p. N54H [8], p.G59A [9], p.G59S [10], p.H73R [11], p.R75W [12,13], p. G130V [16], and p.S183F [17] have also been shown to cause deafness with PPK, as they scatter distribution in the GJB2 structure. The phenotype and severity of PPK for these mutations is diverse and may be associated with the mutation location in GJB2 structure. Mutations (p.N54H, p.G59A, p.G59S, p.H73R and p. S183F) located in the extracellular domain have a similar phenotype (except for PPK, the patients also showed symptoms of knuckle pads), whereas the mutations p.R75W and p.R75Q located at the junction between the extracellular and transmembrane domain, as well as the p.G130V located in the transmembrane domain, are less severe and do not show knuckle pad symptoms. The mechanisms behind the different mutations contributing to variations in cutaneous phenotypes and why the PPK-deafness phenotypes differ from one another are not completely understood, and further studies will help clarify the underlying mechanisms. Gap junctions maintain tissue homeostasis by enabling exchange of ions, second messengers, and metabolites [29,30]. A gap junction channel is formed by end-to-end docking of two hemichannels, also referred to as connexons, each composed of six connexin subunits. Connexin proteins contain one cytoplasmic domain (CL), two extracellular domains (EC1–2), and four transmembrane (TM1–4) domains [31]. The p.R75Q mutation is located at the junction between the first extracellular loop (EC1) and the second transmembrane domain (TM2) of Cx26. This amino acid Arg75 is invariably present and evolutionarily preserved in all Cx26 proteins of various species such as Homo sapiens, orangutans, sheep, rat, mouse, and Xenopus laevis [12]. Because both EC1 and TM2 domains are critical for the voltage gating of the intercellular channel [32], the replacement of the highly positively charged Arg residue with neutrally charged Gln may alter the channel activity of Cx26. Piazza et al. [24] reported that the p.R75Q mutation does not affect the protein targeting to the adjoining plasma membranes (which is supported by our results, as Cx26 is distributed in the cytoplasm and cell membrane of skin epidermis cells as shown in Supplementary Fig. 1), but reduces channel activities when transfected with the p. R75Q mutant. A similar loss of channel permeability has been observed in other R75 mutations (p.R75W, p.R75A and p.R75D) and has been attributed to the structural instability of the mutated connexons [33]. When coexpressed with WT Cx26, p.R75W has a dominant-negative effect, reducing both the gap-junctional
S.- Jiang et al. / International Journal of Pediatric Otorhinolaryngology 78 (2014) 1461–1466
conductance (Gj) and the intercellular transfer of Lucifer yellow (LY) [34,35]. The findings of Yum et al. [36] and Zhang et al. [37] provide further evidence that dominant Cx26 mutants affect hearing by influencing the function of Cx26 and/or Cx30. In this study, structure analysis of the Cx26 helped us elucidate the pathological effects of the mutation. We found that the Arg75 of subunit B is located at the edge of subunit B and adjacent to subunit A in the wild type form. Additionally, the Arg75 of the wild type Cx26 could interact with Glu47 and the main-chain amide Ser72 in the intra-subunit, as well as with the Glu187 in the adjacent subunit, through hydrogen bonding. In the mutant Cx26, the spatial conformation was greatly changed when Arg75, which has a large side chain and no oxygen atom, was substituted by Gln75, which has a small side chain. This conformational change was because Gln75 could not form hydrogen bonds with Glu47 and could not interact effectively with Ser72 because the residues were farther apart and had one fewer hydrogen bond between them. These changes may further reduce the stability of the intrasubunit. Moreover, Arg75 is one of the residues that form the core of inter-subunit interactions. In the mutated form, Gln75 could still form a hydrogen bond with Glu187 in the adjacent subunit, but the combining ability may be reduced because the distance between Gln75 and Glu187 was greater (2.89 Å) than the distance between Arg75 (2.61 Å). Furthermore, the change in spatial location may interfere with the proper folding and/or oligomerization of connexins, resulting in defective channels. In addition, Lys41, a positively charged residue at the TM1/EC1 boundary that creates a narrowed part of the gap junction channel, is unique to Cx26 because it generates a more positively charged environment between the funnel and the following negatively charged part of the solute pathway. Considering the pore diameter and the charge character, this region also probably contributes to the size restriction and the charge selectivity [21]. Some positively charged residues (such as His73 and Arg75 at the EC1/TM1 boundary and Arg184 and Lys188 at the EC2/TM4 boundary) generate a positively charged environment at the outside of the same plane of Lys41. These residues may also contribute to the positively charged environment generated by Lys41 and subsequently influence the permeation properties of the Cx26 gap junction channel. In the p.R75Q mutation, the change in electrical charge from a positively charged Arg to a neutrally charged Glu may affect positively charged regional environment generated by Lys41, which could subsequently impair permeation properties of Cx26. Based on the above analysis, the mutation p.R75Q in the GJB2 gene likely reduces the stability of the intra-subunit and its affinity to the adjacent subunit, which probably destabilizes the intersubunit assembly. Along with the Cx26 channel permeability impairment, the p.R75Q mutation led to severe-profound deafness and PPK in the Chinese family in our study. The availability of crystal structures of the Cx26 makes it possible to determine the effects of mutations. Therefore DNA sequencing analysis, combined with structure analysis of the Cx26, will help elucidate the pathological effects of the mutations. Our investigations document is an additional evidence for the correlation between the cited mutations in the GJB2 gene and a syndromic hearing impairment with PPK. Conflict of interest The authors have no potential conflicts of interest. Acknowledgments We would like to thank the members of the family for their kind cooperation in this study. This study was supported by the National Natural Science Fund of China (30700916).
1465
Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at http://dx.doi.org/10.1016/j. ijporl.2014.06.008. References [1] S. Babac, D. Djeri c, Z. Ivankovi c, Newborn hearing screening, Srp. Arh. Celok. Lek. 135 (2007) 264–268. [2] M. Bitner-Glindzicz, Hereditary deafness and phenotyping in humans, Br. Med. Bull. 63 (2002) 73–94. [3] J. Xu, B.J. Nicholson, The role of connexins in ear and skin physiology – functional insights from disease-associated mutations, Biochim. Biophys. Acta 1828 (2013) 167–178. [4] Y. Yuan, Y. You, D. Huang, J. Cui, Y. Wang, Q. Wang, et al., Comprehensive molecular etiology analysis of nonsyndromic hearing impairment from typical areas in China, J. Transl. Med. 7 (2009) 79. [5] P. Dai, F. Yu, B. Han, X. Liu, G. Wang, Q. Li, et al., GJB2 mutation spectrum in 2063 Chinese patients with nonsyndromic hearing impairment, J. Transl Med. 7 (2009) 1–12. [6] M. Sharland, N.R. Bleach, P.D. Goberdhan, M.A. Patton, Autosomal dominant palmoplantar hyperkeratosis and sensorineural deafness in three generations, J. Med. Genet. 29 (1992) 50–52. [7] F. Rouan, T.W. White, N. Brown, A.M. Taylor, T.W. Lucke, D.L. Paul, et al., Transdominant inhibition of connexin-43 by mutant connexin-26: implications for dominant connexin disorders affecting epidermal differentiation, J. Cell Sci. 114 (2001) 2013–2105. [8] M. Akiyama, K. Sakai, K. Arita, Y. Nomura, K. Ito, K. Kodama, et al., A novel GJB2 mutation p.Asn54His in a patient with palmoplantar keratoderma, sensorineural hearing loss and knuckle pads, J. Invest. Dermatol. 127 (2007) 1540– 1543. [9] K. Heathcote, P. Syrris, N.D. Carter, M.A. Patton, A connexin 26 mutation causes a syndrome of sensorineural hearing loss and palmoplantar hyperkeratosis (MIM 148350), J. Med. Genet. 37 (2000) 50–51. [10] N.J. Leonard, A.L. Krol, S. Bleoo, M.J. Somerville, Sensorineural hearing loss, striate palmoplantar hyperkeratosis, and knuckle pads in a patient with a novel connexin 26 (GJB2) mutation, J. Med. Genet. 42 (2005) e2. [11] E.A. de Zwart-Storm, H. Hamm, J. Stoevesandt, P.M. Steijlen, P.E. Martin, M. van Geel, et al., A novel missense mutation in GJB2 disturbs gap junction protein transport and causes focal palmoplantar keratoderma with deafness, J. Med. Genet. 45 (2008) 161–166. [12] Y. Yuan, D. Huang, F. Yu, X. Zhu, D. Kang, H. Yuan, et al., A de novo GJB2 (connexin 26) mutation, R75W, in a Chinese pedigree with hearing loss and palmoplantar keratoderma, Am. J. Med. Genet. A 149A (2009) 689–692. [13] J.Y. Lee, S.I. In, H.J. Kim, S.Y. Jeong, Y.H. Choung, Y.C. Kim, Hereditary palmoplantar keratoderma and deafness resulting from genetic mutation of connexin 26, J. Korean Med. Sci. 25 (2010) 1539–1542. [14] O. Uyguner, T. Tukel, C. Baykal, H. Eris, M. Emiroglu, G. Hafiz, A. Ghanbari, et al., The novel R75Q mutation in the GJB2 gene causes autosomal dominant hearing loss and palmoplantar keratoderma in a Turkish family, Clin. Genet. 62 (2002) 306–309. [15] D. Feldmann, F. Denoyelle, H. Blons, S. Lyonnet, N. Loundon, I. Rouillon, et al., The GJB2 mutation R75Q can cause nonsyndromic hearing loss DFNA3 or hereditary palmoplantar keratoderma with deafness, Am. J. Med. Genet. A 137 (2005) 225–227. [16] S. Iossa, V. Chinetti, G. Auletta, C. Laria, M. Luca. De, M. Rienzo, et al., New evidence for the correlation of the p.G130V mutation in the GJB2 gene and syndromic hearing loss with palmoplantar keratoderma, Am. J. Med. Genet. A 149A (2009) 685–688. [17] E.A. de Zwart-Storm, M. van Geel, P.A. van Neer, P.M. Steijlen, P.E. Martin, M.A. van Steensel, A novel missense mutation in the second extracellular domain of GJB2, p.Ser183Phe, causes a syndrome of focal palmoplantar keratoderma with deafness, Am. J. Pathol. 173 (2008) 1113–1119. [18] H. Caria, T. Matos, R. Oliveira-Soares, A.R. Santos, I. Galhardo, L. SoaresAlmeida, et al., A7445G mtDNA mutation present in a Portuguese family exhibiting hereditary deafness and palmoplantar keratoderma, J. Eur. Acad. Dermatol. Venereol. 19 (2005) 455–458. [19] P. Chen, H. Chen, S. Fu, G. Chen, J. Dong, Prevalence of GJB6 mutations in Chinese patients with non-syndromic hearing loss, Int. J. Pediatr. Otorhinolaryngol. 76 (2012) 265–267. [20] Y.F. Bu, X.G. Lv, Y. Wang, Y.J. Lu, Z.B. Chen, Q.J. Wei, Analysis of gene mutation in 22 cases of non-syndromic hearing loss, Acta Univ. Med. Nanjing 30 (2010) 390–393. [21] S. Maeda, S. Nakagawa, M. Suga, E. Yamashita, A. Oshima, Y. Fujiyoshi, et al., Structure of the connexin 26 gap junction channel at 3.5 Å resolution, Nature 458 (2009) 597–602. [22] S. Huang, Y. Yuan, J. Liu, D. Han, D. Kang, X. Zhang, et al., De novo dominant mutation of GJB2 in two Chinese families with nonsyndromic hearing loss, Int. J. Pediatr. Otorhinolaryngol. 75 (2011) 1333–1336. [23] S. Huang, G. Wang, Y. Xu, Y. Yuan, D. Han, P. Dai, Identification of a p.R143Q dominant mutation in the gap junction beta-2 gene in three Chinese patients with different hearing phenotypes, Acta Otolaryngol. 133 (2013) 55–58.
1466
S.- Jiang et al. / International Journal of Pediatric Otorhinolaryngology 78 (2014) 1461–1466
[24] V. Piazza, M. Beltramello, M. Menniti, E. Colao, P. Malatesta, R. Argento, et al., Functional analysis of R75Q mutation in the gene coding for connexin 26 identified in a family with nonsyndromic hearing loss, Clin. Genet. 68 (2005) 161–166. [25] S. Iossa, V. Chinetti, V. Corvino, E. Marciano, A. Franzè, R75Q dominant mutation in GJB2 gene silenced by the in Cis recessive mutation c.35delG, Am. J. Med. Genet. A 152A (2010) 2658–2660. [26] R. Birkenhäger, N. Lüblinghoff, E. Prera, C. Schild, A. Aschendorff, S. Arndt, Autosomal dominant prelingual hearing loss with palmoplantar keratoderma syndrome: variability in clinical expression from mutations of R75W and R75Q in the GJB2 gene, Am. J. Med. Genet. A 152A (2010) 1798–1802. [27] C. Wu, Y. Lin, Y. Lu, P. Chen, W. Yang, et al., Application of massively parallel sequencing to genetic diagnosis in multiplex families with idiopathic sensorineural hearing impairment, PLoS One 8 (2013) e57369. [28] T. Lucke, R. Choudhry, R. Thom, I.S. Selmer, A.D. Burden, M.B. Hodgins, Upregulation of connexin 26 is a feature of keratinocyte differentiation in hyperproliferative epidermis, vaginal epithelium, and buccal epithelium, J. Invest. Dermatol. 112 (1999) 354–361. [29] M.C. Fiori, V. Figueroa, M.E. Zoghbi, J.C. Saéz, L. Reuss, G.A. Altenberg, Permeation of calcium through purified connexin 26 hemichannels, J. Biol. Chem. 287 (2012) 40826–40834. [30] F. Zonta, F. Mammano, M. Torsello, N. Fortunati, L. Orian, A. Polimeno, Role of gamma carboxylated Glu47 in connexin 26 hemichannel regulation by
[31] [32] [33]
[34]
[35]
[36]
[37]
extracellular Ca2+: insight from a local quantum chemistry study, Biochem. Biophys. Res. Commun. 445 (2014) 10–15. D.A. Goodenough, D.L. Paul, Beyond the gap: functions of unpaired connexon channels, Nat. Rev. Mol. Cell Biol. 4 (2003) 285–294. R. Bruzzone, T.W. White, D.L. Paul, Connections with connexins: the molecular basis of direct intercellular signaling, Eur. J. Biochem. 238 (1996) 1–27. A. Oshima, T. Doi, K. Mitsuoka, S. Maeda, Y. Fujiyoshi, Roles of Met-34, Cys-64, and Arg-75 in the assembly of human connexin 26. Implication for key amino acid residues for channel formation and function, J. Biol. Chem. 278 (2003) 1807–1816. Y. Deng, Y. Chen, L. Reuss, G.A. Altenberg, Mutations of connexin 26 at position 75 and dominant deafness: essential role of arginine for the generation of functional gap-junctional channels, Hear. Res. 220 (2006) 87–94. N.K. Marziano, S.O. Casalotti, A.E. Portelli, D.L. Becker, A. Forge, Mutations in the gene for connexin 26 (GJB2) that cause hearing loss have a dominant negative effect on connexin 30, Hum. Mol. Genet. 12 (2003) 805–812. S.W. Yum, J. Zhang, S.S. Scherer, Dominant connexin26 mutants associated with human hearing loss have trans-dominant effects on connexin30, Neurobiol. Dis. 38 (2010) 226–236. J. Zhang, S.S. Scherer, S.W. Yum, Dominant Cx26 mutants associated with hearing loss have dominant-negative effects on wild type Cx26, Mol. Cell. Neurosci. 47 (2011) 71–78.
Contents lists available at ScienceDirect
International Journal of Pediatric Otorhinolaryngology journal homepage: www.elsevier.com/locate/ijporl
R75Q de novo dominant mutation of GJB2 in a Chinese family with hearing loss and palmoplantar keratoderma Shu-juan Jiang a , Zheng-hong Di b , Dan Huang a , Jiu-bin Zhang c , Yuan-yuan Zhang a , Shu-qin Li d, Rong He a, * a
Clinical Genetics Department, The Affiliated Shengjing Hospital, China Medical University, 110004 Shenyang, Liaoning, PR China Dermatological Department, The Affiliated Shengjing Hospital, China Medical University, 110004 Shenyang, Liaoning, PR China Orthopedics Department, The First Affiliated Hospital, China Medical University, 110001 Shenyang, Liaoning, PR China d Virus Laboratory, The Affiliated Shengjing Hospital, China Medical University, 110004 Shenyang, Liaoning, PR China b c
A R T I C L E I N F O
A B S T R A C T
Article history: Received 19 February 2014 Received in revised form 1 June 2014 Accepted 5 June 2014 Available online 16 June 2014
Objectives: Mutations in the GJB2 gene encoding connexin 26 (Cx26) are major causes of hereditary deafness. This study aimed to characterize the mutation profiles of the GJB2 gene in a Chinese family with sensorineural hearing loss. Methods: A Chinese family that included three individuals with sensorineural hearing loss and palmoplantar keratoderma underwent complete physical examinations, audiological examinations including pure tone audiometry and auditory brainstem response, skin pathological examination, and temporal CT scans. The entire coding region of GJB2, GJB3, GJB6, and the coding exons (exon7 + 8 and 19) of SLC26A4, mitochondrial 12SrRNA, and tRNA Ser (UCN) were sequenced. Structural analysis was performed to detect the effects of mutation on the tertiary structure of Cx26. Results: A dominant GJB2 mutation, c.224G>A (p.Arg75Gln, p.R75Q), was detected in the family. No other mutation was identified in GJB2, GJB3, GJB6, or the coding exons (exon7 + 8 and 19) of SLC26A4, mitochondrial 12SrRNA, and tRNA Ser (UCN). Structural analysis revealed that the p.R75Q mutation likely affects the structural stability and permeation properties of the Cx26 gap junction channel. Conclusion: Our findings provide further evidence of a correlation between the p.R75Q mutation in Cx26 and a syndromic hearing impairment with palmoplantar keratoderma. ã 2014 Elsevier Ireland Ltd. All rights reserved.
Keywords: De novo mutation GJB2 gene China Hearing impairment Palmoplantar keratoderma Structural analysis
1. Introduction Hearing loss (HL) is a common sensory disorder, with a prevalence of one to three cases per 1000 newborns and about half of the cases due to genetic causes [1,2]. Genetic causes of hearing impairment are very heterogeneous, showing different patterns of inheritance and involving a multitude of different genes. Several forms of HL are associated with mutations in connexins, particularly connexin 26 (Cx26) coded by the GJB2 gene. Mutations in the GJB2 gene account for up to 50% of nonsyndromic autosomal recessive HL [3].
Abbreviations: Cx26, connexin26; HL, hearing loss; KID, keratitis–ichthyosis– deafness; PPK, palmoplantar keratoderma; HGVS, human genome variation society; PTA, pure tone audiometry; ABR, auditory brainstem response; CT, temporal computerized tomography; CL, cytoplasmic domain; EC, extracellular domain; TM, transmembrane domains; Gj, gap-junctional conductance. * Corresponding author at: Sanhao Street No.36, Heping District, Shenyang City 110004, Liaoning, PR China. Tel.: +86 24 96615 75311; fax: +86 24 23892617. E-mail address: [email protected] (R. He). http://dx.doi.org/10.1016/j.ijporl.2014.06.008 0165-5876/ ã 2014 Elsevier Ireland Ltd. All rights reserved.
In most areas of China, GJB2 gene mutations account for about 18.31% of patients with HL [4]. On the other hand, Dai et al. [5] reported that the frequency of GJB2 mutations was 4.0–30.4% in Chinese patients with nonsyndromic deafness. So far, about 100 different mutations have been identified in the GJB2 gene, the majority of which are autosomal recessive. About 10 mutations are autosomal dominant, and most are associated with various skin diseases, such as keratitis–ichthyosis–deafness (KID) syndrome, Vohwinkel syndrome, and palmoplantar keratoderma (PPK), along with deafness [3]. Deafness with PPK (OMIM 148350), first described by Sharland et al. [6] in 1992, is caused by mutations in GJB2 located on chromosome 13q12.11. To date, the following mutations (annotated according to the Human Genome Variation Society (HGVS) guidelines, version 2.130708) in GJB2 (NM_004004.5) have been identified in this kind of syndromic hearing loss: p.E42del [7], p. N54H [8], p.G59A [9], p.G59S [10], p.H73R [11], p.R75W [12,13], p. R75Q [14,15], p.G130V [16] and p.S183F [17]. Furthermore, the point mutation m.A7445G located in mitochondrial tRNA Ser (UCN) precursor (NC_012920.1) is responsible for deafness with PPK [18].
1462
S.- Jiang et al. / International Journal of Pediatric Otorhinolaryngology 78 (2014) 1461–1466
However, de novo and dominant mutations are rare and only a few studies have described these in Chinese populations. In the present study, we reported a Chinese family presenting with autosomal dominant HL and PPK. The identified p.R75Q mutation in Cx26 provides further evidence for the correlation between the conserved R75 in Cx26 and syndromic hearing impairment with PPK. Furthermore, our study is the first to report a relationship between GJB2 p.R75Q mutation and PPK with deafness in mainland China. 2. Materials and methods 2.1. Clinical evaluation Hearing impairment was defined by audiological examination, including pure tone audiometry (PTA) and auditory brainstem response (ABR). Temporal computerized tomography (CT) scan was performed for the proband to exclude individuals with inner ear malformations. Palmoplantar keratoderma was confirmed by skin pathological examination. A detailed history was obtained to exclude other causes of hearing impairment such as neonatal complications, meningitis or other infections, use of ototoxic medication, and head trauma. 2.2. Mutation analysis Genomic DNA was extracted from peripheral blood using a DNA extraction kit (Watson Biotechnologies Inc., Shanghai, China) after obtaining informed consent. The entire coding region of GJB2 was amplified by PCR using the primers F50 ATGCTTGCTTACCCAGACTCA30 and R50 GGCCTACAGGGGTTTCAAAT30 . PCR amplification was performed in 50-mL reaction volumes containing 100 ng genomic DNA, 1 PCR buffer, 1 mM of each dNTP, 1.5 mM MgCl2, and 1 U Taq DNA polymerase (Takara, Dalian, China). After an initial denaturation at 94 C for 5 min, the reactions were amplified for 32 cycles with denaturation at 94 C for 45 s, annealing at 61 C for 45 s, and extension at 72 C for 1 min, followed by a final extension at 72 C for 10 min. DNA fragments were purified, sequenced, and analyzed by the ABI PRISM 3730 DNA sequencer (Applied Biosystems by Life Technologies, Carlsbad, California, USA). To examine whether other genetic defects were involved in the subjects, the coding region of GJB3, GJB6, and the coding exons (exon 7 + 8 and 19) of SLC26A4, mitochondrial 12SrRNA (m.A1555G and m.C1494T mutations), and tRNA Ser (UCN) (m.A7445G) were also sequenced. Primers and PCR amplification have been described previously [19,20]. Seven family members, including three affected individuals, were detected to have HL. GJB2 from 100 patients with sensorineural HL and 30 individuals with normal hearing were sequenced in this study to confirm the absence of the de novo mutations in the general Chinese population. The sequence data were aligned with the reference sequences in NCBI (NG_008358.1 for GJB2, NG_008309.1 for GJB3, NG_008323.1 for GJB6, NG_008489.1 for SLC26A4 and NC_012920.1 for mtDNA 12SrRNA and tRNA Ser (UCN)) using the DNAStar 5.0 and BioEdit software. Mutations or polymorphisms were identified according to the reference sequences. 2.3. Structural analysis The missense mutation in the human Cx26 protein has been structurally analyzed (PDB code 2ZW3) [21]. The homology model for the mutant form of Cx26 was generated by Swiss-PdbViewer 4.1.0 (http://spdbv.vital-it.ch/) using the wild-type Cx26 as a template. All the structural analyses were carried out using PyMOL
(The PyMOL Molecular Graphics System, DeLano Scientific, Palo Alto, CA, USA; http://www.pymol.org). 3. Results 3.1. Pedigree and Clinical manifestation We ascertained a three-generation Chinese family of Han ethnicity with autosomal dominant inherited HL and PPK. The proband (III-1) was a young man (age 29 years) from Shenyang of Liaoning Province in northeast China. According to the pedigree chart (Fig. 1A), the hearing impairment and PPK is presumably originally inherited from his grandmother because his 54-year-old mother and 52-year-old uncle also had hearing impairment and PPK. The audiological evaluation (Fig. 1B) showed that all of the affected family members had bilateral severe-to-profound sensorineural HL (100–110 dB nHL in the proband at age 27 years, 70–80 dB nHL in his mother at age 52 years, and 80–90 dB nHL in his uncle at age 50 years). None of the patients in this family had a history of aminoglycoside use. Temporal CT scan of the proband showed no obvious abnormalities in the inner ear. Dermatological examination of the affected family members showed diffuse PPK extending to the wrist and the dorsal surfaces of the feet (Fig. 1C). No other cutaneous or clinical abnormalities were observed. Skin biopsies from the thenar region of palm demonstrated histopathological evidence of PPK in the proband and his mother (Fig. 1D). Other clinical risk factors, including aminoglycoside exposure, hyperbilirubinemia, and meningitis, were negative, and no other clinical abnormalities were present in the other members of the family. 3.2. Mutation in the GJB2 gene Sequencing of GJB2 in the three cases showed a heterozygous c.224G>A (p.R75Q) mutation (Fig. 2), resulting in substitution of arginine (Arg, R) by glutamine (Gln, Q) at position 75. Paternity was further confirmed by genotype analysis. The p.R75Q mutation was not found in other family members. Additionally, no other mutation in GJB2 was identified in either of the families, and no sequence aberration or deletion of GJB3, GJB6, or the coding exons (exon7 + 8 and 19) of SLC26A4 were found. Furthermore, sequence analysis of the mitochondrial 12SrRNA and tRNA Ser (UCN) gene failed to detect deafness-associated m.A1555G, m.C1494 T, or m. A7445G mutations in these subjects. No p.R75Q mutation was identified in the 100 patients with sensorineural HL or the 30 individuals with normal hearing. 3.3. Structural analysis Structural analysis showed that the Arg75 of subunit B was located at the edge of subunit B and adjacent to subunit A (Fig. 3A), and that the spatial location of Glu47 and Ser72 in subunit B and the Glu187 in subunit A may interact with Arg75. Further structural analysis revealed that in the wild type Cx26, Arg75 interacted with Glu47 and the main-chain amide Ser72 in the intra-subunit, as well as Glu187 in adjacent subunit, through hydrogen bonding. However, the spatial conformation was greatly changed when Arg75 was substituted with Gln75 in the mutant Cx26, meaning that Gln75 could not form hydrogen bonds with Glu47. Additionally, the interaction between Ser72 and Gln75 was likely also attenuated due to having one fewer hydrogen bond and a greater distance between the two residues. Although Gln75 could still form a hydrogen bond with Glu187 in the adjacent subunit, the combining ability is likely reduced because of the change in spatial location between the residues and the distance between Gln75 and Glu187 is greater (2.89 Å) than the distance between Arg75 and Glu187 (2.61 Å) (Fig. 3B). In addition, the change from a positively
S.- Jiang et al. / International Journal of Pediatric Otorhinolaryngology 78 (2014) 1461–1466
1463
Fig. 1. Chinese pedigree with hearing loss and PKK. (A) Pedigree. Hearing impairment and PKK indicated by solid-filled shapes. Arrow indicates the proband. (B) Audiograms for the proband (III-1), his parents (II-2: mother; II-1: father) and his uncle with hearing loss (II-4: uncle). The horizontal axis of the audiogram shows tone frequency (Hz) and the vertical axis displays hearing level (dBHL). (C) Skin pictures of the proband and his mother. III-1: show the thickening and/or peeling of the skin at palm (a) and dorsum (b) side of the proband's hand and lateral sides (c) of his feet. II-2: show the hand (d, e) and feet (f) of proband's mother with the same skin problem. Arrows indicate the thenar region of the palm in skin biopsies of the proband and his mother. (D) Skin biopsies from thenar region of palm for the proband (III-1) and his mother (II-2) show compact hyperkeratosis and acanthosis with a well-formed granular layer, consistent with the palmoplantar keratosis. (haematoxylin and eosin; original magnification 40).
charged Arg to a neutral Gln may affect the regional environment, which could subsequently impair permeation properties of the Cx26. 4. Discussion
Fig. 2. Identification of GJB2 mutation: partial sequence chromatograms of GJB2 for mutant (III-1) and wild type (II-1) GJB2. Arrows indicates the position of the c.224G>A (p.R75Q) mutation.
Mutations in GJB2 are the most common cause of nonsyndromic autosomal recessive sensorineural hearing loss. A few mutations in GJB2 have been reported to cause dominant nonsyndromic or syndromic hearing loss, but only a few dominant mutations have been described in Chinese populations. The p.R75W mutation causes HL and palmoplantar keratoderma in a Chinese pedigree [12], and p.R143Q and p.R184Q mutations cause nonsyndromic HL in Chinese families [22,23]. The p.R75Q mutation causes autosomal dominant HL and PPK in a Turkish family [14], and has been reported to cause dominant HL with or without PPK in France [15], Italy [24,25], Germany[26], and Taiwan [27]. The present study was the first to report the GJB2 p.R75Q mutation related to deafness and PPK in mainland China. Cx26 is expressed in supporting cells surrounding the sensory hair cells of the cochlea and in epidermis cells, mainly in the skin of the palms and soles [28]. Connexins appear to be important to the function of these tissues, as connexin mutations cause varied levels of deafness and hereditary hyperproliferative skin disorders in
1464
S.- Jiang et al. / International Journal of Pediatric Otorhinolaryngology 78 (2014) 1461–1466
Fig. 3. Structural analysis of the GJB2 p.R75Q mutation. The figure was generated as described in the text. (A) The connexin 26 (Cx26) gap junction channel is formed by end-to-end docking of two connexons, each composed of six Cx26 subunits. This figure shows the location of Arg75 and the residues it interacts with in one of the two connexons. Other subunits in the lateral and foreground of the connexon have been omitted for clarity. (B) The local spatial structure of the residues Arg75 (Gln75), Ser72, Glu47 in subunit B and Glu187 in subunit A. Hydrogen bonds are indicated as dotted lines.
humans [3]. In this study, we found three cases of de novo p.R75Qdominant mutation of GJB2 in a Chinese family. Family history and audiological examinations revealed a progressive type of sensorineural HL in the affected family members. The hearing phenotype caused by the p.R75Q mutation showed severe-to-profound bilateral sensorineural hearing impairment in our patients (100– 110 dB nHL in the proband, 70–80 dB nHL in his mother and 80– 90 dB nHL in his uncle). Interestingly, the higher hearing frequencies were more severely affected in all tested individuals and were independent of the overall severity of hearing impairment. The age of onset and progression of HL also varied among the affected family members. The proband had congenital bilateral profound prelingual HL at the age of one year whereas his mother and uncle presented with hearing impairments at the
approximate age of 20 years that got progressively worse. The variations in the onset age and the severity of HL within the same family may be due to a different degree of explicit influence. The HL caused by p.R75Q all appears to be moderate to profound bilateral sensorineural hearing impairment. Interestingly for this mutation, a PPK phenotype does not consistently occur with hearing loss [15]. In this study, skin biopsies from the thenar region of the palm in the proband and his mother showed compact hyperkeratosis and acanthosis with a well-formed granular layer, which are consistent with PPK. In addition, immunohistochemistry showed that Cx26 accumulated in the upper layers of the wide rete ridge in the patient's palmar epidermis. This may contribute to the phenotype of PPK, as the Cx26 expression in the thenar region of the palm in the proband was greater than his mother, as was his PPK severity. In a previous report, the p.R75Q mutation is shown to cause HL and congenital diffuse palmoplantar hyperkeratosis [14]. In present study, none of the affected individuals had apparent cutaneous abnormalities during infancy, but similar to the work by Feldmann et al. [15], the palmoplantar hyperkeratosis progressed during the later years. This p.R75Q mutation has also been reported to cause nonsyndromic HL [15,24,26,27]. Therefore, the presence of the skin phenotype associated with the GJB2 p.R75Q mutation may be due to different explicit or environmental factors. In addition to the mutation p.R75Q, mutations p.delE42 [7], p. N54H [8], p.G59A [9], p.G59S [10], p.H73R [11], p.R75W [12,13], p. G130V [16], and p.S183F [17] have also been shown to cause deafness with PPK, as they scatter distribution in the GJB2 structure. The phenotype and severity of PPK for these mutations is diverse and may be associated with the mutation location in GJB2 structure. Mutations (p.N54H, p.G59A, p.G59S, p.H73R and p. S183F) located in the extracellular domain have a similar phenotype (except for PPK, the patients also showed symptoms of knuckle pads), whereas the mutations p.R75W and p.R75Q located at the junction between the extracellular and transmembrane domain, as well as the p.G130V located in the transmembrane domain, are less severe and do not show knuckle pad symptoms. The mechanisms behind the different mutations contributing to variations in cutaneous phenotypes and why the PPK-deafness phenotypes differ from one another are not completely understood, and further studies will help clarify the underlying mechanisms. Gap junctions maintain tissue homeostasis by enabling exchange of ions, second messengers, and metabolites [29,30]. A gap junction channel is formed by end-to-end docking of two hemichannels, also referred to as connexons, each composed of six connexin subunits. Connexin proteins contain one cytoplasmic domain (CL), two extracellular domains (EC1–2), and four transmembrane (TM1–4) domains [31]. The p.R75Q mutation is located at the junction between the first extracellular loop (EC1) and the second transmembrane domain (TM2) of Cx26. This amino acid Arg75 is invariably present and evolutionarily preserved in all Cx26 proteins of various species such as Homo sapiens, orangutans, sheep, rat, mouse, and Xenopus laevis [12]. Because both EC1 and TM2 domains are critical for the voltage gating of the intercellular channel [32], the replacement of the highly positively charged Arg residue with neutrally charged Gln may alter the channel activity of Cx26. Piazza et al. [24] reported that the p.R75Q mutation does not affect the protein targeting to the adjoining plasma membranes (which is supported by our results, as Cx26 is distributed in the cytoplasm and cell membrane of skin epidermis cells as shown in Supplementary Fig. 1), but reduces channel activities when transfected with the p. R75Q mutant. A similar loss of channel permeability has been observed in other R75 mutations (p.R75W, p.R75A and p.R75D) and has been attributed to the structural instability of the mutated connexons [33]. When coexpressed with WT Cx26, p.R75W has a dominant-negative effect, reducing both the gap-junctional
S.- Jiang et al. / International Journal of Pediatric Otorhinolaryngology 78 (2014) 1461–1466
conductance (Gj) and the intercellular transfer of Lucifer yellow (LY) [34,35]. The findings of Yum et al. [36] and Zhang et al. [37] provide further evidence that dominant Cx26 mutants affect hearing by influencing the function of Cx26 and/or Cx30. In this study, structure analysis of the Cx26 helped us elucidate the pathological effects of the mutation. We found that the Arg75 of subunit B is located at the edge of subunit B and adjacent to subunit A in the wild type form. Additionally, the Arg75 of the wild type Cx26 could interact with Glu47 and the main-chain amide Ser72 in the intra-subunit, as well as with the Glu187 in the adjacent subunit, through hydrogen bonding. In the mutant Cx26, the spatial conformation was greatly changed when Arg75, which has a large side chain and no oxygen atom, was substituted by Gln75, which has a small side chain. This conformational change was because Gln75 could not form hydrogen bonds with Glu47 and could not interact effectively with Ser72 because the residues were farther apart and had one fewer hydrogen bond between them. These changes may further reduce the stability of the intrasubunit. Moreover, Arg75 is one of the residues that form the core of inter-subunit interactions. In the mutated form, Gln75 could still form a hydrogen bond with Glu187 in the adjacent subunit, but the combining ability may be reduced because the distance between Gln75 and Glu187 was greater (2.89 Å) than the distance between Arg75 (2.61 Å). Furthermore, the change in spatial location may interfere with the proper folding and/or oligomerization of connexins, resulting in defective channels. In addition, Lys41, a positively charged residue at the TM1/EC1 boundary that creates a narrowed part of the gap junction channel, is unique to Cx26 because it generates a more positively charged environment between the funnel and the following negatively charged part of the solute pathway. Considering the pore diameter and the charge character, this region also probably contributes to the size restriction and the charge selectivity [21]. Some positively charged residues (such as His73 and Arg75 at the EC1/TM1 boundary and Arg184 and Lys188 at the EC2/TM4 boundary) generate a positively charged environment at the outside of the same plane of Lys41. These residues may also contribute to the positively charged environment generated by Lys41 and subsequently influence the permeation properties of the Cx26 gap junction channel. In the p.R75Q mutation, the change in electrical charge from a positively charged Arg to a neutrally charged Glu may affect positively charged regional environment generated by Lys41, which could subsequently impair permeation properties of Cx26. Based on the above analysis, the mutation p.R75Q in the GJB2 gene likely reduces the stability of the intra-subunit and its affinity to the adjacent subunit, which probably destabilizes the intersubunit assembly. Along with the Cx26 channel permeability impairment, the p.R75Q mutation led to severe-profound deafness and PPK in the Chinese family in our study. The availability of crystal structures of the Cx26 makes it possible to determine the effects of mutations. Therefore DNA sequencing analysis, combined with structure analysis of the Cx26, will help elucidate the pathological effects of the mutations. Our investigations document is an additional evidence for the correlation between the cited mutations in the GJB2 gene and a syndromic hearing impairment with PPK. Conflict of interest The authors have no potential conflicts of interest. Acknowledgments We would like to thank the members of the family for their kind cooperation in this study. This study was supported by the National Natural Science Fund of China (30700916).
1465
Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at http://dx.doi.org/10.1016/j. ijporl.2014.06.008. References [1] S. Babac, D. Djeri c, Z. Ivankovi c, Newborn hearing screening, Srp. Arh. Celok. Lek. 135 (2007) 264–268. [2] M. Bitner-Glindzicz, Hereditary deafness and phenotyping in humans, Br. Med. Bull. 63 (2002) 73–94. [3] J. Xu, B.J. Nicholson, The role of connexins in ear and skin physiology – functional insights from disease-associated mutations, Biochim. Biophys. Acta 1828 (2013) 167–178. [4] Y. Yuan, Y. You, D. Huang, J. Cui, Y. Wang, Q. Wang, et al., Comprehensive molecular etiology analysis of nonsyndromic hearing impairment from typical areas in China, J. Transl. Med. 7 (2009) 79. [5] P. Dai, F. Yu, B. Han, X. Liu, G. Wang, Q. Li, et al., GJB2 mutation spectrum in 2063 Chinese patients with nonsyndromic hearing impairment, J. Transl Med. 7 (2009) 1–12. [6] M. Sharland, N.R. Bleach, P.D. Goberdhan, M.A. Patton, Autosomal dominant palmoplantar hyperkeratosis and sensorineural deafness in three generations, J. Med. Genet. 29 (1992) 50–52. [7] F. Rouan, T.W. White, N. Brown, A.M. Taylor, T.W. Lucke, D.L. Paul, et al., Transdominant inhibition of connexin-43 by mutant connexin-26: implications for dominant connexin disorders affecting epidermal differentiation, J. Cell Sci. 114 (2001) 2013–2105. [8] M. Akiyama, K. Sakai, K. Arita, Y. Nomura, K. Ito, K. Kodama, et al., A novel GJB2 mutation p.Asn54His in a patient with palmoplantar keratoderma, sensorineural hearing loss and knuckle pads, J. Invest. Dermatol. 127 (2007) 1540– 1543. [9] K. Heathcote, P. Syrris, N.D. Carter, M.A. Patton, A connexin 26 mutation causes a syndrome of sensorineural hearing loss and palmoplantar hyperkeratosis (MIM 148350), J. Med. Genet. 37 (2000) 50–51. [10] N.J. Leonard, A.L. Krol, S. Bleoo, M.J. Somerville, Sensorineural hearing loss, striate palmoplantar hyperkeratosis, and knuckle pads in a patient with a novel connexin 26 (GJB2) mutation, J. Med. Genet. 42 (2005) e2. [11] E.A. de Zwart-Storm, H. Hamm, J. Stoevesandt, P.M. Steijlen, P.E. Martin, M. van Geel, et al., A novel missense mutation in GJB2 disturbs gap junction protein transport and causes focal palmoplantar keratoderma with deafness, J. Med. Genet. 45 (2008) 161–166. [12] Y. Yuan, D. Huang, F. Yu, X. Zhu, D. Kang, H. Yuan, et al., A de novo GJB2 (connexin 26) mutation, R75W, in a Chinese pedigree with hearing loss and palmoplantar keratoderma, Am. J. Med. Genet. A 149A (2009) 689–692. [13] J.Y. Lee, S.I. In, H.J. Kim, S.Y. Jeong, Y.H. Choung, Y.C. Kim, Hereditary palmoplantar keratoderma and deafness resulting from genetic mutation of connexin 26, J. Korean Med. Sci. 25 (2010) 1539–1542. [14] O. Uyguner, T. Tukel, C. Baykal, H. Eris, M. Emiroglu, G. Hafiz, A. Ghanbari, et al., The novel R75Q mutation in the GJB2 gene causes autosomal dominant hearing loss and palmoplantar keratoderma in a Turkish family, Clin. Genet. 62 (2002) 306–309. [15] D. Feldmann, F. Denoyelle, H. Blons, S. Lyonnet, N. Loundon, I. Rouillon, et al., The GJB2 mutation R75Q can cause nonsyndromic hearing loss DFNA3 or hereditary palmoplantar keratoderma with deafness, Am. J. Med. Genet. A 137 (2005) 225–227. [16] S. Iossa, V. Chinetti, G. Auletta, C. Laria, M. Luca. De, M. Rienzo, et al., New evidence for the correlation of the p.G130V mutation in the GJB2 gene and syndromic hearing loss with palmoplantar keratoderma, Am. J. Med. Genet. A 149A (2009) 685–688. [17] E.A. de Zwart-Storm, M. van Geel, P.A. van Neer, P.M. Steijlen, P.E. Martin, M.A. van Steensel, A novel missense mutation in the second extracellular domain of GJB2, p.Ser183Phe, causes a syndrome of focal palmoplantar keratoderma with deafness, Am. J. Pathol. 173 (2008) 1113–1119. [18] H. Caria, T. Matos, R. Oliveira-Soares, A.R. Santos, I. Galhardo, L. SoaresAlmeida, et al., A7445G mtDNA mutation present in a Portuguese family exhibiting hereditary deafness and palmoplantar keratoderma, J. Eur. Acad. Dermatol. Venereol. 19 (2005) 455–458. [19] P. Chen, H. Chen, S. Fu, G. Chen, J. Dong, Prevalence of GJB6 mutations in Chinese patients with non-syndromic hearing loss, Int. J. Pediatr. Otorhinolaryngol. 76 (2012) 265–267. [20] Y.F. Bu, X.G. Lv, Y. Wang, Y.J. Lu, Z.B. Chen, Q.J. Wei, Analysis of gene mutation in 22 cases of non-syndromic hearing loss, Acta Univ. Med. Nanjing 30 (2010) 390–393. [21] S. Maeda, S. Nakagawa, M. Suga, E. Yamashita, A. Oshima, Y. Fujiyoshi, et al., Structure of the connexin 26 gap junction channel at 3.5 Å resolution, Nature 458 (2009) 597–602. [22] S. Huang, Y. Yuan, J. Liu, D. Han, D. Kang, X. Zhang, et al., De novo dominant mutation of GJB2 in two Chinese families with nonsyndromic hearing loss, Int. J. Pediatr. Otorhinolaryngol. 75 (2011) 1333–1336. [23] S. Huang, G. Wang, Y. Xu, Y. Yuan, D. Han, P. Dai, Identification of a p.R143Q dominant mutation in the gap junction beta-2 gene in three Chinese patients with different hearing phenotypes, Acta Otolaryngol. 133 (2013) 55–58.
1466
S.- Jiang et al. / International Journal of Pediatric Otorhinolaryngology 78 (2014) 1461–1466
[24] V. Piazza, M. Beltramello, M. Menniti, E. Colao, P. Malatesta, R. Argento, et al., Functional analysis of R75Q mutation in the gene coding for connexin 26 identified in a family with nonsyndromic hearing loss, Clin. Genet. 68 (2005) 161–166. [25] S. Iossa, V. Chinetti, V. Corvino, E. Marciano, A. Franzè, R75Q dominant mutation in GJB2 gene silenced by the in Cis recessive mutation c.35delG, Am. J. Med. Genet. A 152A (2010) 2658–2660. [26] R. Birkenhäger, N. Lüblinghoff, E. Prera, C. Schild, A. Aschendorff, S. Arndt, Autosomal dominant prelingual hearing loss with palmoplantar keratoderma syndrome: variability in clinical expression from mutations of R75W and R75Q in the GJB2 gene, Am. J. Med. Genet. A 152A (2010) 1798–1802. [27] C. Wu, Y. Lin, Y. Lu, P. Chen, W. Yang, et al., Application of massively parallel sequencing to genetic diagnosis in multiplex families with idiopathic sensorineural hearing impairment, PLoS One 8 (2013) e57369. [28] T. Lucke, R. Choudhry, R. Thom, I.S. Selmer, A.D. Burden, M.B. Hodgins, Upregulation of connexin 26 is a feature of keratinocyte differentiation in hyperproliferative epidermis, vaginal epithelium, and buccal epithelium, J. Invest. Dermatol. 112 (1999) 354–361. [29] M.C. Fiori, V. Figueroa, M.E. Zoghbi, J.C. Saéz, L. Reuss, G.A. Altenberg, Permeation of calcium through purified connexin 26 hemichannels, J. Biol. Chem. 287 (2012) 40826–40834. [30] F. Zonta, F. Mammano, M. Torsello, N. Fortunati, L. Orian, A. Polimeno, Role of gamma carboxylated Glu47 in connexin 26 hemichannel regulation by
[31] [32] [33]
[34]
[35]
[36]
[37]
extracellular Ca2+: insight from a local quantum chemistry study, Biochem. Biophys. Res. Commun. 445 (2014) 10–15. D.A. Goodenough, D.L. Paul, Beyond the gap: functions of unpaired connexon channels, Nat. Rev. Mol. Cell Biol. 4 (2003) 285–294. R. Bruzzone, T.W. White, D.L. Paul, Connections with connexins: the molecular basis of direct intercellular signaling, Eur. J. Biochem. 238 (1996) 1–27. A. Oshima, T. Doi, K. Mitsuoka, S. Maeda, Y. Fujiyoshi, Roles of Met-34, Cys-64, and Arg-75 in the assembly of human connexin 26. Implication for key amino acid residues for channel formation and function, J. Biol. Chem. 278 (2003) 1807–1816. Y. Deng, Y. Chen, L. Reuss, G.A. Altenberg, Mutations of connexin 26 at position 75 and dominant deafness: essential role of arginine for the generation of functional gap-junctional channels, Hear. Res. 220 (2006) 87–94. N.K. Marziano, S.O. Casalotti, A.E. Portelli, D.L. Becker, A. Forge, Mutations in the gene for connexin 26 (GJB2) that cause hearing loss have a dominant negative effect on connexin 30, Hum. Mol. Genet. 12 (2003) 805–812. S.W. Yum, J. Zhang, S.S. Scherer, Dominant connexin26 mutants associated with human hearing loss have trans-dominant effects on connexin30, Neurobiol. Dis. 38 (2010) 226–236. J. Zhang, S.S. Scherer, S.W. Yum, Dominant Cx26 mutants associated with hearing loss have dominant-negative effects on wild type Cx26, Mol. Cell. Neurosci. 47 (2011) 71–78.
