Journal of Invertebrate Pathology 124 (2015) 70–72
Contents lists available at ScienceDirect
Journal of Invertebrate Pathology journal homepage: www.elsevier.com/locate/jip
Short Communication
Quantitative real-time PCR (qPCR) – Based tool for detection and quantification of Cordyceps militaris in soil Syaiful Amri Saragih a,⇑, S. Takemoto b, Y. Hisamoto c, M. Fujii d, H. Sato e, N. Kamata d a
Education and Research Center, The University of Tokyo Forests, Graduate School of Agricultural and Life Sciences, The University of Tokyo, Bunkyo, Tokyo 113-8657, Japan The University of Tokyo Tanashi Forest, The University of Tokyo Forests, Graduate School of Agricultural and Life Sciences, The University of Tokyo, Nishi-Tokyo, Tokyo 188-0002, Japan c The University of Tokyo Chiba Forest, The University of Tokyo Forests, Graduate School of Agricultural and Life Sciences, The University of Tokyo, Kamogawa, Chiba 299-5503, Japan d The University of Tokyo Chichibu Forest, The University of Tokyo Forests, Graduate School of Agricultural and Life Sciences, The University of Tokyo, Chichibu, Saitama 368-0034, Japan e Department of Forest Entomology, Forestry and Forest Products Research Institute, Tsukuba, Ibaraki 305-8687, Japan b
a r t i c l e
i n f o
Article history: Received 20 May 2014 Accepted 6 November 2014 Available online 15 November 2014 Keywords: Entomopathogenic fungus Culture-independent method Genomic DNA Soil DNA Amplification efficiency
a b s t r a c t A quantitative real-time PCR using a primer pair CM2946F/CM3160R was developed for specific detection and quantification of Cordyceps militaris from soil. Standard curves were obtained for genomic DNA and DNA extracts from autoclaved soil with a certain dose of C. militaris suspension. C. militaris was detected from two forest soil samples out of ten that were collected when fruit bodies of C. militaris were found. This method seemed effective in detection of C. militaris in the soil and useful for rapid and reliable quantification of C. militaris in different ecosystems. Ó 2014 Elsevier Inc. All rights reserved.
1. Introduction Cordyceps militaris (Hypocreales: Cordycipitaceae) is an ascomycete entomopathogenic fungus, which attacks larvae and pupae of lepidopteran insects in leaf litter, moss or upper soil layers (Sung et al., 2007), and also in the air (Sato et al., 1997). C. militaris is widely used as a popular tonic and traditional Chinese medicines that have anti-cancer activities obtained from active metabolites (Ng and Wang, 2005; Cunningham et al., 1950). In Japan, epidemics of C. militaris has been reported in relation to population outbreaks of the beech caterpillar, Syntypistis punctatella (Lepidoptera: Notodontidae), which is a major insect defoliator on beech trees (Fagus crenata and Fagus japonica) in Japan (Kamata, 2000). During the outbreak period, C. militaris causes mortality greater than 90% of overwintering pupae of S. punctatella (Kamata, 2000). However, knowledge on epizootiology of C. militaris during latent periods is limited because the densities of fruit bodies and host insect pupae are so low. Kamata et al. (1997) introduced lab-reared insects as baits, which is alternate methodology to evaluate the infection rate. However, it is time-consuming to
⇑ Corresponding author. Fax: +81 (0)3 5841 5494. E-mail address: [email protected] (S.A. Saragih). http://dx.doi.org/10.1016/j.jip.2014.11.002 0022-2011/Ó 2014 Elsevier Inc. All rights reserved.
rear, bury, and incubate great numbers of insects that is necessary for statistically tolerable level. In this paper, we developed culture-independent method based on DNA using quantitative real-time PCR (qPCR) as an effective method to detect and to quantify C. militaris. We designed and tested several primer pairs to get the best primer pair that specifically amplifies a targeting sequence. Standard curves were separately obtained for both DNA density and mass of the fungus in soil. Finally, this method was tested for soils that were sampled during population outbreaks of S. punctatella to quantify C. militaris. 2. Materials and methods Cultures of C. militaris, Bauveria bassiana, Metarhizium anisopliae, Isaria farinosa, and Isaria fumosorosea, which had been stored in Forestry and Forest Product Research Institute (FFPRI) in Tsukuba, Japan, were used for this study (Table 1). Genomic DNA of the five fungi was extracted from potato dextrose liquid cultures that had been incubated for 48 h at 25 °C and 180 rpm. DNA quantity of the extracts was determined using a spectrophotometer. Eight primer pairs were designed based on internal transcribed spacer (ITS) region using software MEGA 6 (Tamura et al., 2013) (Table 2). The eight primers were checked for their specificity using
71
S.A. Saragih et al. / Journal of Invertebrate Pathology 124 (2015) 70–72 Table 1 List of fungal isolates of Cordyceps militaris and four other entomopathogenic fungi, which were originated from Japan and used for checking specificity of eight primer pairs. Fungal isolatea
Species
F1105-1 F1035 F1042 F1075 F2223
Cordyceps militaris Metarhizium anisopliae Beauveria bassiana Isaria farinosa Isaria fumosorosea
a All isolates were stored in the Forestry and Forest Products Research Institute’s collection of entomopathogenic fungi, Tsukuba, Japan.
BLAST similarity searches (NCBI) (Altschul et al., 1997). The qPCR was run to check the quality of primer pairs using genomic DNA of C. militaris and of the other four species and blank (only each primer pair) as negative control. Melting curves were scrutinized to determine specificity for each primer pair. PCR was performed using genomic DNA with specific primer in 20 ll reaction contained 2 ll of template DNA, 2 ll of TaKaRa Ex Taq (Mg2+ free Buffer) (TaKaRa), 1.6 ll of dNTP Mixture (TaKaRa), 0.4 ll of each 25 nM primer, 0.1 ll of TaKaRa Ex Taq Polymerase (TaKaRa) and DNase free water under the following condition: initial denaturing at 95 °C for 3 min, followed by 55 cycles of denaturing at 98 °C for 10 s, annealing at 65 °C for 30 s, extension at 68 °C for 60 s, and final extension at 68 °C for 5 m. The product of PCR (20 ll) then was put into 1% (w/v) agarose gels and run for 40 min at 100 V in TAE buffer and confirmed by electrophoresis under UV light. Direct sequencing was performed to confirm the success of PCR amplification. Sequence was then analyzed using software MEGA 6 and alignment using ClustalW and then compare to database sequence by using BLAST similarity searches (NCBI) (Altschul et al., 1997). The qPCR was performed in 20 ll mixture volume contained 10 ll of SYBR Green PCR Master Mix (Applied Biosystems), 4 ll of each 2.5 nM primer (F and R), 2 ll of template DNA, using a PikoReal Real-Time PCR System (Thermo Scientific) in the following condition: initial denaturing at 95 °C for 7 min, followed by 60 cycles of denaturing at 95 °C for 10 s, annealing at 65 °C for 30 s, extension at 68 °C for 20 s, and final extension at 60 °C for 30 s. Melting curve was set between 60 and 95 °C. A standard curve was generated based on the threshold cycles (Ct) using 10-fold serial dilutions from 101 (lowest density = level 1) to 1010 (highest density = level 10) by plotting Ct value against log 10 of initial amount of genomic DNA (DNA quantity, ng/ll). Amplification efficiency (E, which is defined as E = 101/slope – 1)
from the slope of the linear plot were calculated for the standard quantification curve (Smith and Osborn, 2009). To obtain standard curve for C. militaris DNA in soil, another extraction was also done using autoclaved soil that was added a certain dose of C. militaris suspension after autoclaving (standard soil DNA). Extracted DNA (100 ll) was stored at 30 °C. Dry weight of C. militaris per 1 gram soil was calculated as 11.994 mg at the highest level. Quantification of C. militaris in the standard soil DNA was conducted using best primer pair after conforming specificity by qPCR in the same mixture and condition. A standard curve was obtained for the standard soil DNA as the same methodology as genomic DNA. In August 2013, soil samples were collected from two sites in a natural beech (F. crenata) forest in the Northern Japan (Hachimantai A and B), in which fruit bodies of C. militaris were found at a timing of soil sampling. Elevation of the collecting sites was 890 m a.s.l. at Hachimantai A (N39°590 46.8900 , E140°480 20.9700 ) and 1050 m a.s.l. at Hachimantai B (N39°580 17.5000 , E140°480 10.8800 ). Three soil subsamples were taken from A0 layer approximately 60 cm apart from each other using a cylindrical soil core sampler (7.5 cm in diameter, 7.5 cm in height). The three sub-samples were homogenized and stored at 30 °C until DNA extraction. Soil DNA was extracted from 0.5 g of each of the soil samples using Power Soil DNA Isolation Kit (MO BIO Laboratories) in accordance with manufacturer’s protocol. The extracted soil DNA (100 ll) was stored at 30 °C. The qPCR was applied to the soil extracts to determine the density of C. militaris in each soil samples. 3. Results and discussion Among eight primer pairs, the primer pair CM2946F (50 ACGTC CCCTGGGGGATG 30 )/CM3160R (50 CTGATCCGAGGTCAACGTTCAG 30 ) with annealing temperature of 65 °C and cycle number of 60 was the best combination of primer and conditions since only this primer showed specificity with a single peak of melting curve in qPCR. Results were also found negative for presence of four related species such as B. bassiana, M. anisopliae, I. farinosa, and I. fumosorosea as well as a control. In the normal PCR, this primer pair generated single DNA product of 167 bp (GenBank accession number AB932851). BLAST similarity searches using sequence of the 167 bp showed 99 hits of C. militaris with 99% match. Standard curves were obtained for genomic DNA and the standard soil DNA separately. The qPCR using genomic DNA of C. militaris generated a standard curve (slope = 3.7227, R2 = 0.9984, n = 7, and E = 0.86) (Fig. 1). The Ct value also showed linear correlation with log 10 of dry weight of C. militaris in soil
Table 2 Eight primer pairs specific to C. militaris designed using software MEGA 6 based on ITS region. Melting temperature (Tm) was set higher than 54 °C for maintenance of specificity and efficiency (Dieffenbach et al., 1993). Primer ID
Primer sequences (50 –30 )
Tm value
% GC
Estimated length (bp)
CM2946F CM3160R CM2946F CM3150R CM1948F CM2292R CM2239F CM2425R CM2693F CM2823R CM2655F CM2822R CM2945F CM3158R CM2945F CM3149R
F: ACGTCCCCTGGGGGATG R: CTGATCCGAGGTCAACGTTCAG F: ACGTCCCCTGGGGGATG R: GGTCAACGTTCAGAGTTGGGC F: GACCCAGGCACATCAGCA R: CCCAGCACGACGGAGTTT F: GTACTTCCTTGGTCGAAAGGCT R: GCCTCACTGAGCCATTCG F: GGGCCCCAAACACTGTATCTAC R: CGTTCTTCATCGATGCCAGAG F: CTGGACGCGGGCCTGGG R: GTTCTTCATCGATGCCAGAG F: GACGTCCCCTGGGGGATG R: GATCCGAGGTCAACGTTCAG F: GACGTCCCCTGGGGGATG R: GTCAACGTTCAGAGTTGGGC
62 62 62 62 60 60 58 58 60 61 60 62 62 62 62 62
71 55 71 57 61 61 50 61 55 52 82 50 72 55 72 55
167 158 345 185 172 138 166 158
72
S.A. Saragih et al. / Journal of Invertebrate Pathology 124 (2015) 70–72
Fig. 1. A standard curve for genomic DNA of C. militaris obtained from seven levels of 10-fold dilutions (from level 3 to level 9) by plotting Ct value against log10 of the initial amount of genomic DNA (ng/ll). Amplification efficiency (E) and a coefficient of determination (R2) are indicated in the graph.
C. militaris was detected in one of five soil samples from Hachimantai A (Ct value = 47.71) and one sample from Hachimantai B (Ct value = 40.93) by using qPCR. Both Ct values were greater than a limit (approximately 34 cycles) to obtain C. militaris density in soil. The soils were sampled while fruit bodies of C. militaris were found on the ground so that the results seem reasonable. However, C. militaris was detected from only two samples out of ten but was not quantified probably due to low density. Methodologies of soil sampling and/or soil DNA extraction should be improved for monitoring C. militaris dynamics in soil. We concluded that cultivation-independent detection using qPCR with the primer pair CM2946F/CM3160R was effective, rapid, sensitive and specific in detection of C. militaris in the soil, which is useful for regulation of insect population and for human health as a tonic and traditional Chinese medicines. In future, this method can be used for rapid and reliable quantification of C. militaris in different ecosystem spatially and temporally. Acknowledgments This work was supported by Grants-in-aid for Scientific Research from the Japan Society for the Promotion of Science (JSPS) to NK (25292084). References
Fig. 2. A standard curve for standard soil DNA of C. militaris obtained from five levels of 10-fold dilutions (from level 5 to level 9) by plotting Ct value against log10 of the initial amount of soil DNA (ng/g soil). The standard soil DNA was extracted from soil at Hachimantai A, which was autoclaved and then added each of 10-fold dilutions (from 101 to 1010) of C. militaris suspension. Amplification efficiency (E) and a coefficient of determination (R2) are indicated in the graph.
(ng/g soil) (slope = 4.1692, R2 = 0.9937, n = 5, and E = 0.74) (Fig. 2). Hence, the qPCR with this primer pair was thought to be able to quantify C. militaris in soil. A greater slope of the standard curve and smaller amplification efficiency (E) in the standard soil DNA indicate that soil significantly decreased sensitivity of qPCR at each dilution step. Type of soil and also DNA extraction protocol seemed likely factors that had affected assay sensitivity as suggested by Castrillo et al. (2007).
Altschul, S.F., Madden, T.L., Schaffer, A.A., Zhang, J.H., Zhang, Z., Miller, W., Lipman, D.J., 1997. Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucl. Acids Res. 25, 3389–3402. Castrillo, L.A., Thomsen, L., Juneja, P., Hajek, A.E., 2007. Detection and quantification of Entomophaga maimaiga resting spores in forest soil using real-time PCR. Mycol. Res. 111, 324–331. Cunningham, K.G., Manson, W., Spring, F.S., Hutchinson, S.A., 1950. Cordycepin, a metabolic product isolated from cultures of Cordyceps militaris (Linn), link. Nature 166, 949. Dieffenbach, C.W., Lowe, T.M., Dveksler, G.S., 1993. General concepts for PCR primer design. Genome Res. 3, S30–S37. Kamata, N., Sato, H., Shimazu, M., 1997. Seasonal changes in the infection of pupae of the beech caterpillar, Quadricalcarifera punctatella (Motsch.) (Lep., Notodontidae), by Cordyceps militaris Link (Clavicipitales: Clavicipitaceae) in the soil of the Siebold’s beech forest. J. Appl. Ent. 121, 17–21. Kamata, N., 2000. Population dynamics of the beech caterpillar, Syntypistis punctatella, and biotic and abiotic factors. Popul. Ecol. 42, 267–278. Ng, T.B., Wang, H.X., 2005. Pharmacological actions of Cordyceps, a prized folk medicine. Pharm. Pharmacol. 57, 1509–1519. Sato, H., Kamata, N., Shimazu, M., 1997. Aerial infection of Cordyceps militaris Link (Clavicipitales: Clavicipitaceae) against larvae of Quadricalcarifera punctatella (Motschulsky) (Lepidoptera: Notodontidae). Appl. Entomol. Zool. 32, 249–252. Smith, C.J., Osborn, A.M., 2009. Advantages and limitations of quantitative PCR (QPCR)-based approaches in microbial ecology. FEMS Microbiol. Ecol. 67, 6–20. Sung, G.H., Hywel-Jones, N.L., Sung, J.M., Luangsa-ard, J.J., Shrestha, B., Spatafora, J.W., 2007. Phylogenetic classification of Cordyceps and the clavicipitaceous fungi. Stud. Mycol. 57, 5–59. Tamura, K., Stecher, G., Peterson, D., Filipski, A., Kumar, S., 2013. MEGA6: molecular evolutionary genetics analysis version 6.0. Mol. Biol. Evol. 30, 2725–2729.
Contents lists available at ScienceDirect
Journal of Invertebrate Pathology journal homepage: www.elsevier.com/locate/jip
Short Communication
Quantitative real-time PCR (qPCR) – Based tool for detection and quantification of Cordyceps militaris in soil Syaiful Amri Saragih a,⇑, S. Takemoto b, Y. Hisamoto c, M. Fujii d, H. Sato e, N. Kamata d a
Education and Research Center, The University of Tokyo Forests, Graduate School of Agricultural and Life Sciences, The University of Tokyo, Bunkyo, Tokyo 113-8657, Japan The University of Tokyo Tanashi Forest, The University of Tokyo Forests, Graduate School of Agricultural and Life Sciences, The University of Tokyo, Nishi-Tokyo, Tokyo 188-0002, Japan c The University of Tokyo Chiba Forest, The University of Tokyo Forests, Graduate School of Agricultural and Life Sciences, The University of Tokyo, Kamogawa, Chiba 299-5503, Japan d The University of Tokyo Chichibu Forest, The University of Tokyo Forests, Graduate School of Agricultural and Life Sciences, The University of Tokyo, Chichibu, Saitama 368-0034, Japan e Department of Forest Entomology, Forestry and Forest Products Research Institute, Tsukuba, Ibaraki 305-8687, Japan b
a r t i c l e
i n f o
Article history: Received 20 May 2014 Accepted 6 November 2014 Available online 15 November 2014 Keywords: Entomopathogenic fungus Culture-independent method Genomic DNA Soil DNA Amplification efficiency
a b s t r a c t A quantitative real-time PCR using a primer pair CM2946F/CM3160R was developed for specific detection and quantification of Cordyceps militaris from soil. Standard curves were obtained for genomic DNA and DNA extracts from autoclaved soil with a certain dose of C. militaris suspension. C. militaris was detected from two forest soil samples out of ten that were collected when fruit bodies of C. militaris were found. This method seemed effective in detection of C. militaris in the soil and useful for rapid and reliable quantification of C. militaris in different ecosystems. Ó 2014 Elsevier Inc. All rights reserved.
1. Introduction Cordyceps militaris (Hypocreales: Cordycipitaceae) is an ascomycete entomopathogenic fungus, which attacks larvae and pupae of lepidopteran insects in leaf litter, moss or upper soil layers (Sung et al., 2007), and also in the air (Sato et al., 1997). C. militaris is widely used as a popular tonic and traditional Chinese medicines that have anti-cancer activities obtained from active metabolites (Ng and Wang, 2005; Cunningham et al., 1950). In Japan, epidemics of C. militaris has been reported in relation to population outbreaks of the beech caterpillar, Syntypistis punctatella (Lepidoptera: Notodontidae), which is a major insect defoliator on beech trees (Fagus crenata and Fagus japonica) in Japan (Kamata, 2000). During the outbreak period, C. militaris causes mortality greater than 90% of overwintering pupae of S. punctatella (Kamata, 2000). However, knowledge on epizootiology of C. militaris during latent periods is limited because the densities of fruit bodies and host insect pupae are so low. Kamata et al. (1997) introduced lab-reared insects as baits, which is alternate methodology to evaluate the infection rate. However, it is time-consuming to
⇑ Corresponding author. Fax: +81 (0)3 5841 5494. E-mail address: [email protected] (S.A. Saragih). http://dx.doi.org/10.1016/j.jip.2014.11.002 0022-2011/Ó 2014 Elsevier Inc. All rights reserved.
rear, bury, and incubate great numbers of insects that is necessary for statistically tolerable level. In this paper, we developed culture-independent method based on DNA using quantitative real-time PCR (qPCR) as an effective method to detect and to quantify C. militaris. We designed and tested several primer pairs to get the best primer pair that specifically amplifies a targeting sequence. Standard curves were separately obtained for both DNA density and mass of the fungus in soil. Finally, this method was tested for soils that were sampled during population outbreaks of S. punctatella to quantify C. militaris. 2. Materials and methods Cultures of C. militaris, Bauveria bassiana, Metarhizium anisopliae, Isaria farinosa, and Isaria fumosorosea, which had been stored in Forestry and Forest Product Research Institute (FFPRI) in Tsukuba, Japan, were used for this study (Table 1). Genomic DNA of the five fungi was extracted from potato dextrose liquid cultures that had been incubated for 48 h at 25 °C and 180 rpm. DNA quantity of the extracts was determined using a spectrophotometer. Eight primer pairs were designed based on internal transcribed spacer (ITS) region using software MEGA 6 (Tamura et al., 2013) (Table 2). The eight primers were checked for their specificity using
71
S.A. Saragih et al. / Journal of Invertebrate Pathology 124 (2015) 70–72 Table 1 List of fungal isolates of Cordyceps militaris and four other entomopathogenic fungi, which were originated from Japan and used for checking specificity of eight primer pairs. Fungal isolatea
Species
F1105-1 F1035 F1042 F1075 F2223
Cordyceps militaris Metarhizium anisopliae Beauveria bassiana Isaria farinosa Isaria fumosorosea
a All isolates were stored in the Forestry and Forest Products Research Institute’s collection of entomopathogenic fungi, Tsukuba, Japan.
BLAST similarity searches (NCBI) (Altschul et al., 1997). The qPCR was run to check the quality of primer pairs using genomic DNA of C. militaris and of the other four species and blank (only each primer pair) as negative control. Melting curves were scrutinized to determine specificity for each primer pair. PCR was performed using genomic DNA with specific primer in 20 ll reaction contained 2 ll of template DNA, 2 ll of TaKaRa Ex Taq (Mg2+ free Buffer) (TaKaRa), 1.6 ll of dNTP Mixture (TaKaRa), 0.4 ll of each 25 nM primer, 0.1 ll of TaKaRa Ex Taq Polymerase (TaKaRa) and DNase free water under the following condition: initial denaturing at 95 °C for 3 min, followed by 55 cycles of denaturing at 98 °C for 10 s, annealing at 65 °C for 30 s, extension at 68 °C for 60 s, and final extension at 68 °C for 5 m. The product of PCR (20 ll) then was put into 1% (w/v) agarose gels and run for 40 min at 100 V in TAE buffer and confirmed by electrophoresis under UV light. Direct sequencing was performed to confirm the success of PCR amplification. Sequence was then analyzed using software MEGA 6 and alignment using ClustalW and then compare to database sequence by using BLAST similarity searches (NCBI) (Altschul et al., 1997). The qPCR was performed in 20 ll mixture volume contained 10 ll of SYBR Green PCR Master Mix (Applied Biosystems), 4 ll of each 2.5 nM primer (F and R), 2 ll of template DNA, using a PikoReal Real-Time PCR System (Thermo Scientific) in the following condition: initial denaturing at 95 °C for 7 min, followed by 60 cycles of denaturing at 95 °C for 10 s, annealing at 65 °C for 30 s, extension at 68 °C for 20 s, and final extension at 60 °C for 30 s. Melting curve was set between 60 and 95 °C. A standard curve was generated based on the threshold cycles (Ct) using 10-fold serial dilutions from 101 (lowest density = level 1) to 1010 (highest density = level 10) by plotting Ct value against log 10 of initial amount of genomic DNA (DNA quantity, ng/ll). Amplification efficiency (E, which is defined as E = 101/slope – 1)
from the slope of the linear plot were calculated for the standard quantification curve (Smith and Osborn, 2009). To obtain standard curve for C. militaris DNA in soil, another extraction was also done using autoclaved soil that was added a certain dose of C. militaris suspension after autoclaving (standard soil DNA). Extracted DNA (100 ll) was stored at 30 °C. Dry weight of C. militaris per 1 gram soil was calculated as 11.994 mg at the highest level. Quantification of C. militaris in the standard soil DNA was conducted using best primer pair after conforming specificity by qPCR in the same mixture and condition. A standard curve was obtained for the standard soil DNA as the same methodology as genomic DNA. In August 2013, soil samples were collected from two sites in a natural beech (F. crenata) forest in the Northern Japan (Hachimantai A and B), in which fruit bodies of C. militaris were found at a timing of soil sampling. Elevation of the collecting sites was 890 m a.s.l. at Hachimantai A (N39°590 46.8900 , E140°480 20.9700 ) and 1050 m a.s.l. at Hachimantai B (N39°580 17.5000 , E140°480 10.8800 ). Three soil subsamples were taken from A0 layer approximately 60 cm apart from each other using a cylindrical soil core sampler (7.5 cm in diameter, 7.5 cm in height). The three sub-samples were homogenized and stored at 30 °C until DNA extraction. Soil DNA was extracted from 0.5 g of each of the soil samples using Power Soil DNA Isolation Kit (MO BIO Laboratories) in accordance with manufacturer’s protocol. The extracted soil DNA (100 ll) was stored at 30 °C. The qPCR was applied to the soil extracts to determine the density of C. militaris in each soil samples. 3. Results and discussion Among eight primer pairs, the primer pair CM2946F (50 ACGTC CCCTGGGGGATG 30 )/CM3160R (50 CTGATCCGAGGTCAACGTTCAG 30 ) with annealing temperature of 65 °C and cycle number of 60 was the best combination of primer and conditions since only this primer showed specificity with a single peak of melting curve in qPCR. Results were also found negative for presence of four related species such as B. bassiana, M. anisopliae, I. farinosa, and I. fumosorosea as well as a control. In the normal PCR, this primer pair generated single DNA product of 167 bp (GenBank accession number AB932851). BLAST similarity searches using sequence of the 167 bp showed 99 hits of C. militaris with 99% match. Standard curves were obtained for genomic DNA and the standard soil DNA separately. The qPCR using genomic DNA of C. militaris generated a standard curve (slope = 3.7227, R2 = 0.9984, n = 7, and E = 0.86) (Fig. 1). The Ct value also showed linear correlation with log 10 of dry weight of C. militaris in soil
Table 2 Eight primer pairs specific to C. militaris designed using software MEGA 6 based on ITS region. Melting temperature (Tm) was set higher than 54 °C for maintenance of specificity and efficiency (Dieffenbach et al., 1993). Primer ID
Primer sequences (50 –30 )
Tm value
% GC
Estimated length (bp)
CM2946F CM3160R CM2946F CM3150R CM1948F CM2292R CM2239F CM2425R CM2693F CM2823R CM2655F CM2822R CM2945F CM3158R CM2945F CM3149R
F: ACGTCCCCTGGGGGATG R: CTGATCCGAGGTCAACGTTCAG F: ACGTCCCCTGGGGGATG R: GGTCAACGTTCAGAGTTGGGC F: GACCCAGGCACATCAGCA R: CCCAGCACGACGGAGTTT F: GTACTTCCTTGGTCGAAAGGCT R: GCCTCACTGAGCCATTCG F: GGGCCCCAAACACTGTATCTAC R: CGTTCTTCATCGATGCCAGAG F: CTGGACGCGGGCCTGGG R: GTTCTTCATCGATGCCAGAG F: GACGTCCCCTGGGGGATG R: GATCCGAGGTCAACGTTCAG F: GACGTCCCCTGGGGGATG R: GTCAACGTTCAGAGTTGGGC
62 62 62 62 60 60 58 58 60 61 60 62 62 62 62 62
71 55 71 57 61 61 50 61 55 52 82 50 72 55 72 55
167 158 345 185 172 138 166 158
72
S.A. Saragih et al. / Journal of Invertebrate Pathology 124 (2015) 70–72
Fig. 1. A standard curve for genomic DNA of C. militaris obtained from seven levels of 10-fold dilutions (from level 3 to level 9) by plotting Ct value against log10 of the initial amount of genomic DNA (ng/ll). Amplification efficiency (E) and a coefficient of determination (R2) are indicated in the graph.
C. militaris was detected in one of five soil samples from Hachimantai A (Ct value = 47.71) and one sample from Hachimantai B (Ct value = 40.93) by using qPCR. Both Ct values were greater than a limit (approximately 34 cycles) to obtain C. militaris density in soil. The soils were sampled while fruit bodies of C. militaris were found on the ground so that the results seem reasonable. However, C. militaris was detected from only two samples out of ten but was not quantified probably due to low density. Methodologies of soil sampling and/or soil DNA extraction should be improved for monitoring C. militaris dynamics in soil. We concluded that cultivation-independent detection using qPCR with the primer pair CM2946F/CM3160R was effective, rapid, sensitive and specific in detection of C. militaris in the soil, which is useful for regulation of insect population and for human health as a tonic and traditional Chinese medicines. In future, this method can be used for rapid and reliable quantification of C. militaris in different ecosystem spatially and temporally. Acknowledgments This work was supported by Grants-in-aid for Scientific Research from the Japan Society for the Promotion of Science (JSPS) to NK (25292084). References
Fig. 2. A standard curve for standard soil DNA of C. militaris obtained from five levels of 10-fold dilutions (from level 5 to level 9) by plotting Ct value against log10 of the initial amount of soil DNA (ng/g soil). The standard soil DNA was extracted from soil at Hachimantai A, which was autoclaved and then added each of 10-fold dilutions (from 101 to 1010) of C. militaris suspension. Amplification efficiency (E) and a coefficient of determination (R2) are indicated in the graph.
(ng/g soil) (slope = 4.1692, R2 = 0.9937, n = 5, and E = 0.74) (Fig. 2). Hence, the qPCR with this primer pair was thought to be able to quantify C. militaris in soil. A greater slope of the standard curve and smaller amplification efficiency (E) in the standard soil DNA indicate that soil significantly decreased sensitivity of qPCR at each dilution step. Type of soil and also DNA extraction protocol seemed likely factors that had affected assay sensitivity as suggested by Castrillo et al. (2007).
Altschul, S.F., Madden, T.L., Schaffer, A.A., Zhang, J.H., Zhang, Z., Miller, W., Lipman, D.J., 1997. Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucl. Acids Res. 25, 3389–3402. Castrillo, L.A., Thomsen, L., Juneja, P., Hajek, A.E., 2007. Detection and quantification of Entomophaga maimaiga resting spores in forest soil using real-time PCR. Mycol. Res. 111, 324–331. Cunningham, K.G., Manson, W., Spring, F.S., Hutchinson, S.A., 1950. Cordycepin, a metabolic product isolated from cultures of Cordyceps militaris (Linn), link. Nature 166, 949. Dieffenbach, C.W., Lowe, T.M., Dveksler, G.S., 1993. General concepts for PCR primer design. Genome Res. 3, S30–S37. Kamata, N., Sato, H., Shimazu, M., 1997. Seasonal changes in the infection of pupae of the beech caterpillar, Quadricalcarifera punctatella (Motsch.) (Lep., Notodontidae), by Cordyceps militaris Link (Clavicipitales: Clavicipitaceae) in the soil of the Siebold’s beech forest. J. Appl. Ent. 121, 17–21. Kamata, N., 2000. Population dynamics of the beech caterpillar, Syntypistis punctatella, and biotic and abiotic factors. Popul. Ecol. 42, 267–278. Ng, T.B., Wang, H.X., 2005. Pharmacological actions of Cordyceps, a prized folk medicine. Pharm. Pharmacol. 57, 1509–1519. Sato, H., Kamata, N., Shimazu, M., 1997. Aerial infection of Cordyceps militaris Link (Clavicipitales: Clavicipitaceae) against larvae of Quadricalcarifera punctatella (Motschulsky) (Lepidoptera: Notodontidae). Appl. Entomol. Zool. 32, 249–252. Smith, C.J., Osborn, A.M., 2009. Advantages and limitations of quantitative PCR (QPCR)-based approaches in microbial ecology. FEMS Microbiol. Ecol. 67, 6–20. Sung, G.H., Hywel-Jones, N.L., Sung, J.M., Luangsa-ard, J.J., Shrestha, B., Spatafora, J.W., 2007. Phylogenetic classification of Cordyceps and the clavicipitaceous fungi. Stud. Mycol. 57, 5–59. Tamura, K., Stecher, G., Peterson, D., Filipski, A., Kumar, S., 2013. MEGA6: molecular evolutionary genetics analysis version 6.0. Mol. Biol. Evol. 30, 2725–2729.
