Cellular Immunology 292 (2014) 40–44
Contents lists available at ScienceDirect
Cellular Immunology journal homepage: www.elsevier.com/locate/ycimm
Quantitative analysis of elastase and cathepsin G mRNA levels in peripheral blood CD14+ cells from patients with rheumatoid arthritis Dorota Trzybulska a,⇑, Anna Olewicz-Gawlik a, Katarzyna Graniczna a, Kajetan Kisiel b, Michał Moskal b, Dorota Cies´lak a,b, Paweł Hrycaj a,b a b
Department of Rheumatology and Clinical Immunology, Poznan University of Medical Sciences, Przybyszewskiego Street 39, 60-356 Poznan, Poland Department of Rheumatology, Koscian Municipal Hospital, Szpitalna Street 7, 64-000 Koscian, Poland
a r t i c l e
i n f o
Article history: Received 20 February 2014 Accepted 29 August 2014 Available online 10 September 2014 Keywords: Cathepsin G CD14+ cells Elastase Monocytes/macrophages Rheumatoid arthritis
a b s t r a c t In rheumatoid arthritis (RA) activity of serine proteases is an important factor contributing to destructive changes in the joints. The aim of this study was to compare elastase (ELANE) and cathepsin G (CTSG) mRNA levels in peripheral blood CD14+ cells obtained from RA patients, healthy subjects (HS) and patients with osteoarthritis (OA). CD14+ cells were isolated from peripheral blood by positive magnetic selection. The expression levels of ELANE and CTSG were determined by quantitative real-time PCR. ELANE mRNA expression was significantly higher in RA patients when compared to HS (p < 0.001) and OA patients (p < 0.001). The results suggest that in RA, peripheral blood CD14+ cells express serine protease mRNA as a result of systemic mechanisms probably related to inflammation/cytokines before entering inflamed joints. Ó 2014 Elsevier Inc. All rights reserved.
1. Introduction Autoimmune diseases develop as a result of an aberrant immune response, which causes chronic inflammation and permanent damage to the host cells. RA is one of the most common autoimmune diseases mainly affecting the synovial membrane. The prevalence of RA is estimated to range from 0.5% to 1% in the European and North American population [1]. RA has a heterogeneous character with an extremely variable clinical course [2,3]. Synovial tissue inflammation is inextricably linked with an influx of inflammatory cells into the joint cavity. This is a multistage process regulated by the presence of chemokines and adhesive molecules which guide the migration of leukocytes from peripheral blood to the sites of inflammation [4]. The CD14 antigen is expressed mainly on human monocytes/ macrophages. Activated monocytes/macrophages are one of the cells which, by producing cytokines and mediators responsible for synovitis, play a crucial role in RA inflammation. Monocytes/ macrophages also have an ability to differentiate into osteoclasts, ⇑ Corresponding author. Fax: +48 618547212. E-mail addresses: [email protected] (D. Trzybulska), [email protected] (A. Olewicz-Gawlik), [email protected] (K. Graniczna), kajetan.kisiel@interia. pl (K. Kisiel), [email protected] (M. Moskal), [email protected] (D. Cies´lak), [email protected] (P. Hrycaj). http://dx.doi.org/10.1016/j.cellimm.2014.08.009 0008-8749/Ó 2014 Elsevier Inc. All rights reserved.
which participate in the formation of bone erosions in patients with RA [5–7]. They are found in pannus tissue along with fibroblast-like synoviocytes and other cells of the immune system [7,8]. Hence, targeting monocytes in RA therapy may bring good results within the scope of inflammation reduction as well as bone resorption [7]. Matrix metalloproteinases and serine proteases, which are produced by the invasive rheumatoid pannus, cause progressive destruction of cartilage, subchondral bone, tendons and ligaments [7,9–11]. Excessive activity of serine proteases such as human neutrophil elastase (HNE; EC 3.4.21.37) and cathepsin G (CatG; EC 3.4.21.20) is frequently seen in inflammatory diseases. They are expressed mainly by neutrophils, but can also be secreted by monocytes [12]. These enzymes modulate the inflammatory process by controlling the activity of chemokines, cytokines, growth factors and cell surface receptors. Simultaneously, they activate lymphocytes and cleave apoptotic and adhesive molecules [13]. Serine protease inhibitors prevent these processes as they reduce proteolytic activity of serine proteases and, in consequence, they hinder connective tissue degradation [13,14]. The role of monocytes/macrophages in RA pathogenesis has not been fully investigated. Therefore, we decided to determine transcriptional levels of ELANE coding, HNE and CTSG coding CatG in peripheral CD14+ cells and to compare them between RA patients, healthy subjects and OA patients. Additionally, correlation analysis
41
D. Trzybulska et al. / Cellular Immunology 292 (2014) 40–44
between the transcriptional levels of proteases studied and laboratory and clinical RA features was performed. 2. Materials and methods 2.1. Study groups The study comprised 30 patients with established RA, fulfilling both the 1987 ACR [15] and the 2010 ACR/EULAR classification criteria [16]. Patients were recruited in 2010 and 2011. Coexistence of other connective tissue diseases, malignancies, symptoms of infection and previous or current treatment with biologics were all exclusionary. Laboratory assessments included routine measurements of the erythrocyte sedimentation rate (ESR, Westergren) and serum concentration of high-sensitivity C reactive protein (hs-CRP) and rheumatoid factor (RF, available for 23 patients with RA). Pain (assessed by patients) and overall disease activity (determined by both patients and physicians) were measured by a visual analogue scale (VAS) [17]. Disease activity was assessed by a EULAR recommended disease activity score based on the erythrocyte sedimentation rate (DAS28-ESR) [18]. The comparison group consisted of 11 OA patients (2 patients with gonarthrosis and 9 patients with degenerative spine disease). RA and OA patients were recruited consecutively from the Department of Rheumatology, Koscian Municipal Hospital, Koscian, Poland. Thirty age- and gender-matched healthy donors from the Regional Centre of Blood Donation and Blood Treatment in Poznan formed the control group (healthy subjects, HS). The protocol for this study was approved by the Bioethics Committee of Poznan University of Medical Sciences, Poland. Written informed consent was obtained from every subject before any study procedure was carried out. 2.2. CD14+ cells isolation CD14+ cells were isolated from fresh EDTA whole blood (stored at 4 °C for no longer than 6 hours after drawing from the antecubital vein) by immunomagnetic positive separation using DynabeadsÒ CD14 (Invitrogen, Carlsbad, CA, USA), in accordance with the manufacturer’s protocol. Bead-bound cells were lysed in 1 ml of TRIzol (Invitrogen, Carlsbad, CA, USA) and stored at 80 °C until RNA extraction.
of Biochemistry and Biophysics, the Polish Academy of Sciences, Warsaw, Poland, oligo.pl). Gradient PCRs were carried out to determine the optimum annealing temperature for primers. qPCRs were carried out on Corbett Rotor-Gene 6000 with Rotor-Gene 6000 Series Software 1.7 (Corbett Life Science, Australia) employing QuantiFast SYBRÒ Green PCR Kit (Qiagen, Valencia, CA, USA). To determine relative transcriptional expression levels of ELANE and CTSG in CD14+ cells, a standard curve-based method was applied [20]. For each gene studied, a standard curve was generated using a mix of randomly pooled cDNA samples reflecting the expected expression levels in a 0.6-fold dilution series of cDNA in the range from 1.00 to 0.0778. Reactions were carried out in duplicate using a negative control sample and an inter-run calibrator in each reaction to control and correct for possible run-to-run variations. The thermal cycling conditions were as follows: denaturation 95 °C 5 min followed by 45 cycles of 95 °C for 5 s and 60 °C 30 s (for CTSG 20 s) and melting curve creation: 65–97 °C. The levels of ELANE and CTSG mRNA were normalized to the levels of mRNA of the housekeeping porphobilinogen deaminase (PBGD). The results are expressed in arbitrary units as base-10 logarithms of the target gene/housekeeping gene ratio of each sample divided by the target gene/housekeeping gene ratio of a calibrator. 2.4. Statistical analyses The calculations were carried out with Microsoft Excel 2010 and STATISTICA 10.0 software (StatSoft, 2011). The Shapiro–Wilk test was used to verify the assumption of normality of the data. Due to the non-normal distribution, non-parametric tests were used for these analyses. The presence of statistically significant differences concerning the expression levels of ELANE and CTSG in CD14+ cells between the groups being studied was determined by the Kruskal–Wallis one-way analysis of variance (ANOVA) by ranks and post hoc multiple comparisons of the mean ranks for all groups. Spearman’s rank correlation analysis was applied to find the associations between monocytic ELANE and CTSG levels and other laboratory and clinical parameters of RA activity. All the data are expressed as medians (interquartile ranges, IQR). The differences were considered to be statistically significant at p < 0.05. 3. Results 3.1. Demography
2.3. RNA extraction, reverse transcription and qPCR Total RNA extraction was performed according to the method described by Chomczynski and Sacchi [19]. RNA concentration and purity were measured using the NanoDrop1000 Spectrophotometer (Thermo Scientific, Waltham, MA, USA). 0.1 lg of total RNA was reverse-transcribed into cDNA using a QuantiTectÒ Reverse Transcription Kit (Qiagen, Valencia, CA, USA), in accordance with the manufacturer’s instructions. The primers (Table 1) used in this study were designed on exon–exon junctions or on different exons using Primer3 and BLAST and synthesized by DNA Sequencing and Oligonucleotides Synthesis Laboratory (Institute
All the subjects were of Caucasian origin. The median age of OA patients (9 women/2 men) was 62 years (IQR = 5). The median age of the HS group (19 women/11 men) was 44 years (IQR = 6). The median age of RA group (19 women/11 men) was 54 (IQR = 11). Table 2 presents a demographic, laboratory and clinical profile of RA patients. 3.2. ELANE and CTSG mRNA expression levels ELANE mRNA levels in CD14+ cells isolated from RA patients were higher than those of HS (p < 0.001) and OA patients
Table 1 Sequences of primers. Gene name (SYMBOL)
NCBI accession Number
Sequence of primers 50 ?30 (exon number)
Amplicon length (bp)
Porphobilinogen deaminase (PBGD)
NM_000190
160
Elastase (ELANE)
NM_001972
Cathepsin G (CTSG)
NM_001911
GCCAAGGACCAGGACATC (11) TCAGGTACAGTTGCCCATC (12/13) GTGGCGAATGTAAACGTC (2/3) CCGTTGAGCTGGAGAATC (3/4) GAGAAGACTTTGTGCTGAC (2) GGTCCGCTGATTATATTGAG (3)
161 149
42
D. Trzybulska et al. / Cellular Immunology 292 (2014) 40–44
Table 2 Characteristics of RA patients. RA patients (n = 30) Age (years) Gender (women/men) BMI Disease duration (years)
54 (11)a 19/11 25 (4.62) 5 (7)
Serological and clinical parameters of RA activity Westergren ESR (mm/h) hs-CRP (mg/L) RF (IU/ml), n = 23 SJC (28 joints) TJC (28 joints) DAS28-ESR DAS28-ESR < 5.1, no (%) PtPA-VAS (mm) PtGA-VAS (mm) PGA-VAS (mm)
27.5 (20) 9.35 (12.10) 80.1 (195.4) 7.5 (10) 15 (14) 5.91 (2.21) 12 (40) 59.5 (42) 59.5 (38) 35 (41)
Current treatment MTX, no (%) MTX dose (mg/week) NSAID, no (%) Methylprednisolone, no (%) Methylprednisolone dose (mg/day)
29 (96.67) 15 (7.5) 28 (93.33) 16 (53.33) 3 (4)
Coexisting diseases, n (%) Arterial hypertension Hypercholesterolemia Osteoporosis Spondyloarthrosis Diabetes mellitus Asthma
12 (40) 3 (10) 3 (10) 2 (6.67) 1 (3.33) 1 (3.33)
Abbreviations: BMI, body mass index; ESR, erythrocyte sedimentation rate; hs-CRP, high-sensitivity C-reactive protein; RF, rheumatoid factor; SJC, swollen joint count; TJC, tender joint count; DAS28-ESR, EULAR disease activity score based on 28-joint counts and ESR; PtPA-VAS, patients pain assessment on VAS; PtGA-VAS, patient global assessment of disease activity on VAS; PGA-VAS, physician’s global assessment of disease activity on VAS; MTX, methotrexate; NSAID, nonsteroidal antiinflammatory drugs. a Unless otherwise stated, data are expressed as median (interquartile range).
Table 3 ELANE and CTSG mRNA expression levels. RA a
ELANE
2.816 (0.488)
CTSG
2.182 (0.843) ⁄
HS
OA
p
2.279 (0.621)
2.147 (0.531)
2.013 (0.743)
1.850 (0.292)
Contents lists available at ScienceDirect
Cellular Immunology journal homepage: www.elsevier.com/locate/ycimm
Quantitative analysis of elastase and cathepsin G mRNA levels in peripheral blood CD14+ cells from patients with rheumatoid arthritis Dorota Trzybulska a,⇑, Anna Olewicz-Gawlik a, Katarzyna Graniczna a, Kajetan Kisiel b, Michał Moskal b, Dorota Cies´lak a,b, Paweł Hrycaj a,b a b
Department of Rheumatology and Clinical Immunology, Poznan University of Medical Sciences, Przybyszewskiego Street 39, 60-356 Poznan, Poland Department of Rheumatology, Koscian Municipal Hospital, Szpitalna Street 7, 64-000 Koscian, Poland
a r t i c l e
i n f o
Article history: Received 20 February 2014 Accepted 29 August 2014 Available online 10 September 2014 Keywords: Cathepsin G CD14+ cells Elastase Monocytes/macrophages Rheumatoid arthritis
a b s t r a c t In rheumatoid arthritis (RA) activity of serine proteases is an important factor contributing to destructive changes in the joints. The aim of this study was to compare elastase (ELANE) and cathepsin G (CTSG) mRNA levels in peripheral blood CD14+ cells obtained from RA patients, healthy subjects (HS) and patients with osteoarthritis (OA). CD14+ cells were isolated from peripheral blood by positive magnetic selection. The expression levels of ELANE and CTSG were determined by quantitative real-time PCR. ELANE mRNA expression was significantly higher in RA patients when compared to HS (p < 0.001) and OA patients (p < 0.001). The results suggest that in RA, peripheral blood CD14+ cells express serine protease mRNA as a result of systemic mechanisms probably related to inflammation/cytokines before entering inflamed joints. Ó 2014 Elsevier Inc. All rights reserved.
1. Introduction Autoimmune diseases develop as a result of an aberrant immune response, which causes chronic inflammation and permanent damage to the host cells. RA is one of the most common autoimmune diseases mainly affecting the synovial membrane. The prevalence of RA is estimated to range from 0.5% to 1% in the European and North American population [1]. RA has a heterogeneous character with an extremely variable clinical course [2,3]. Synovial tissue inflammation is inextricably linked with an influx of inflammatory cells into the joint cavity. This is a multistage process regulated by the presence of chemokines and adhesive molecules which guide the migration of leukocytes from peripheral blood to the sites of inflammation [4]. The CD14 antigen is expressed mainly on human monocytes/ macrophages. Activated monocytes/macrophages are one of the cells which, by producing cytokines and mediators responsible for synovitis, play a crucial role in RA inflammation. Monocytes/ macrophages also have an ability to differentiate into osteoclasts, ⇑ Corresponding author. Fax: +48 618547212. E-mail addresses: [email protected] (D. Trzybulska), [email protected] (A. Olewicz-Gawlik), [email protected] (K. Graniczna), kajetan.kisiel@interia. pl (K. Kisiel), [email protected] (M. Moskal), [email protected] (D. Cies´lak), [email protected] (P. Hrycaj). http://dx.doi.org/10.1016/j.cellimm.2014.08.009 0008-8749/Ó 2014 Elsevier Inc. All rights reserved.
which participate in the formation of bone erosions in patients with RA [5–7]. They are found in pannus tissue along with fibroblast-like synoviocytes and other cells of the immune system [7,8]. Hence, targeting monocytes in RA therapy may bring good results within the scope of inflammation reduction as well as bone resorption [7]. Matrix metalloproteinases and serine proteases, which are produced by the invasive rheumatoid pannus, cause progressive destruction of cartilage, subchondral bone, tendons and ligaments [7,9–11]. Excessive activity of serine proteases such as human neutrophil elastase (HNE; EC 3.4.21.37) and cathepsin G (CatG; EC 3.4.21.20) is frequently seen in inflammatory diseases. They are expressed mainly by neutrophils, but can also be secreted by monocytes [12]. These enzymes modulate the inflammatory process by controlling the activity of chemokines, cytokines, growth factors and cell surface receptors. Simultaneously, they activate lymphocytes and cleave apoptotic and adhesive molecules [13]. Serine protease inhibitors prevent these processes as they reduce proteolytic activity of serine proteases and, in consequence, they hinder connective tissue degradation [13,14]. The role of monocytes/macrophages in RA pathogenesis has not been fully investigated. Therefore, we decided to determine transcriptional levels of ELANE coding, HNE and CTSG coding CatG in peripheral CD14+ cells and to compare them between RA patients, healthy subjects and OA patients. Additionally, correlation analysis
41
D. Trzybulska et al. / Cellular Immunology 292 (2014) 40–44
between the transcriptional levels of proteases studied and laboratory and clinical RA features was performed. 2. Materials and methods 2.1. Study groups The study comprised 30 patients with established RA, fulfilling both the 1987 ACR [15] and the 2010 ACR/EULAR classification criteria [16]. Patients were recruited in 2010 and 2011. Coexistence of other connective tissue diseases, malignancies, symptoms of infection and previous or current treatment with biologics were all exclusionary. Laboratory assessments included routine measurements of the erythrocyte sedimentation rate (ESR, Westergren) and serum concentration of high-sensitivity C reactive protein (hs-CRP) and rheumatoid factor (RF, available for 23 patients with RA). Pain (assessed by patients) and overall disease activity (determined by both patients and physicians) were measured by a visual analogue scale (VAS) [17]. Disease activity was assessed by a EULAR recommended disease activity score based on the erythrocyte sedimentation rate (DAS28-ESR) [18]. The comparison group consisted of 11 OA patients (2 patients with gonarthrosis and 9 patients with degenerative spine disease). RA and OA patients were recruited consecutively from the Department of Rheumatology, Koscian Municipal Hospital, Koscian, Poland. Thirty age- and gender-matched healthy donors from the Regional Centre of Blood Donation and Blood Treatment in Poznan formed the control group (healthy subjects, HS). The protocol for this study was approved by the Bioethics Committee of Poznan University of Medical Sciences, Poland. Written informed consent was obtained from every subject before any study procedure was carried out. 2.2. CD14+ cells isolation CD14+ cells were isolated from fresh EDTA whole blood (stored at 4 °C for no longer than 6 hours after drawing from the antecubital vein) by immunomagnetic positive separation using DynabeadsÒ CD14 (Invitrogen, Carlsbad, CA, USA), in accordance with the manufacturer’s protocol. Bead-bound cells were lysed in 1 ml of TRIzol (Invitrogen, Carlsbad, CA, USA) and stored at 80 °C until RNA extraction.
of Biochemistry and Biophysics, the Polish Academy of Sciences, Warsaw, Poland, oligo.pl). Gradient PCRs were carried out to determine the optimum annealing temperature for primers. qPCRs were carried out on Corbett Rotor-Gene 6000 with Rotor-Gene 6000 Series Software 1.7 (Corbett Life Science, Australia) employing QuantiFast SYBRÒ Green PCR Kit (Qiagen, Valencia, CA, USA). To determine relative transcriptional expression levels of ELANE and CTSG in CD14+ cells, a standard curve-based method was applied [20]. For each gene studied, a standard curve was generated using a mix of randomly pooled cDNA samples reflecting the expected expression levels in a 0.6-fold dilution series of cDNA in the range from 1.00 to 0.0778. Reactions were carried out in duplicate using a negative control sample and an inter-run calibrator in each reaction to control and correct for possible run-to-run variations. The thermal cycling conditions were as follows: denaturation 95 °C 5 min followed by 45 cycles of 95 °C for 5 s and 60 °C 30 s (for CTSG 20 s) and melting curve creation: 65–97 °C. The levels of ELANE and CTSG mRNA were normalized to the levels of mRNA of the housekeeping porphobilinogen deaminase (PBGD). The results are expressed in arbitrary units as base-10 logarithms of the target gene/housekeeping gene ratio of each sample divided by the target gene/housekeeping gene ratio of a calibrator. 2.4. Statistical analyses The calculations were carried out with Microsoft Excel 2010 and STATISTICA 10.0 software (StatSoft, 2011). The Shapiro–Wilk test was used to verify the assumption of normality of the data. Due to the non-normal distribution, non-parametric tests were used for these analyses. The presence of statistically significant differences concerning the expression levels of ELANE and CTSG in CD14+ cells between the groups being studied was determined by the Kruskal–Wallis one-way analysis of variance (ANOVA) by ranks and post hoc multiple comparisons of the mean ranks for all groups. Spearman’s rank correlation analysis was applied to find the associations between monocytic ELANE and CTSG levels and other laboratory and clinical parameters of RA activity. All the data are expressed as medians (interquartile ranges, IQR). The differences were considered to be statistically significant at p < 0.05. 3. Results 3.1. Demography
2.3. RNA extraction, reverse transcription and qPCR Total RNA extraction was performed according to the method described by Chomczynski and Sacchi [19]. RNA concentration and purity were measured using the NanoDrop1000 Spectrophotometer (Thermo Scientific, Waltham, MA, USA). 0.1 lg of total RNA was reverse-transcribed into cDNA using a QuantiTectÒ Reverse Transcription Kit (Qiagen, Valencia, CA, USA), in accordance with the manufacturer’s instructions. The primers (Table 1) used in this study were designed on exon–exon junctions or on different exons using Primer3 and BLAST and synthesized by DNA Sequencing and Oligonucleotides Synthesis Laboratory (Institute
All the subjects were of Caucasian origin. The median age of OA patients (9 women/2 men) was 62 years (IQR = 5). The median age of the HS group (19 women/11 men) was 44 years (IQR = 6). The median age of RA group (19 women/11 men) was 54 (IQR = 11). Table 2 presents a demographic, laboratory and clinical profile of RA patients. 3.2. ELANE and CTSG mRNA expression levels ELANE mRNA levels in CD14+ cells isolated from RA patients were higher than those of HS (p < 0.001) and OA patients
Table 1 Sequences of primers. Gene name (SYMBOL)
NCBI accession Number
Sequence of primers 50 ?30 (exon number)
Amplicon length (bp)
Porphobilinogen deaminase (PBGD)
NM_000190
160
Elastase (ELANE)
NM_001972
Cathepsin G (CTSG)
NM_001911
GCCAAGGACCAGGACATC (11) TCAGGTACAGTTGCCCATC (12/13) GTGGCGAATGTAAACGTC (2/3) CCGTTGAGCTGGAGAATC (3/4) GAGAAGACTTTGTGCTGAC (2) GGTCCGCTGATTATATTGAG (3)
161 149
42
D. Trzybulska et al. / Cellular Immunology 292 (2014) 40–44
Table 2 Characteristics of RA patients. RA patients (n = 30) Age (years) Gender (women/men) BMI Disease duration (years)
54 (11)a 19/11 25 (4.62) 5 (7)
Serological and clinical parameters of RA activity Westergren ESR (mm/h) hs-CRP (mg/L) RF (IU/ml), n = 23 SJC (28 joints) TJC (28 joints) DAS28-ESR DAS28-ESR < 5.1, no (%) PtPA-VAS (mm) PtGA-VAS (mm) PGA-VAS (mm)
27.5 (20) 9.35 (12.10) 80.1 (195.4) 7.5 (10) 15 (14) 5.91 (2.21) 12 (40) 59.5 (42) 59.5 (38) 35 (41)
Current treatment MTX, no (%) MTX dose (mg/week) NSAID, no (%) Methylprednisolone, no (%) Methylprednisolone dose (mg/day)
29 (96.67) 15 (7.5) 28 (93.33) 16 (53.33) 3 (4)
Coexisting diseases, n (%) Arterial hypertension Hypercholesterolemia Osteoporosis Spondyloarthrosis Diabetes mellitus Asthma
12 (40) 3 (10) 3 (10) 2 (6.67) 1 (3.33) 1 (3.33)
Abbreviations: BMI, body mass index; ESR, erythrocyte sedimentation rate; hs-CRP, high-sensitivity C-reactive protein; RF, rheumatoid factor; SJC, swollen joint count; TJC, tender joint count; DAS28-ESR, EULAR disease activity score based on 28-joint counts and ESR; PtPA-VAS, patients pain assessment on VAS; PtGA-VAS, patient global assessment of disease activity on VAS; PGA-VAS, physician’s global assessment of disease activity on VAS; MTX, methotrexate; NSAID, nonsteroidal antiinflammatory drugs. a Unless otherwise stated, data are expressed as median (interquartile range).
Table 3 ELANE and CTSG mRNA expression levels. RA a
ELANE
2.816 (0.488)
CTSG
2.182 (0.843) ⁄
HS
OA
p
2.279 (0.621)
2.147 (0.531)
2.013 (0.743)
1.850 (0.292)
