Meat Science 96 (2014) 964–970

Contents lists available at ScienceDirect

Meat Science journal homepage: www.elsevier.com/locate/meatsci

Quantification of viable Escherichia coli O157:H7 in meat products by duplex real-time PCR assays Rubén Gordillo, Alicia Rodríguez, María L. Werning, Elena Bermúdez, Mar Rodríguez ⁎ Food Hygiene and Safety, Faculty of Veterinary Science, University of Extremadura, Avda. de la Universidad, s/n., 10003 Cáceres, Spain

a r t i c l e

i n f o

Article history: Received 14 November 2012 Received in revised form 3 May 2013 Accepted 12 October 2013 Available online 18 October 2013 Keywords: E. coli O157:H7 qPCR DNA mRNA RTE meat products

a b s t r a c t Rapid and specific detection of viable Escherichia coli O157:H7 cells in ready-to-eat (RTE) meat products, by duplex quantitative PCR (qPCR) procedures with mRNA and SYBR Green and TaqMan methodologies were developed. Specific primers and probes were designed based on the serotype of E. coli O157:H7, fliCh7 and rfbE genes. No cross-reactivity with other microorganisms was observed. The detection limit of the assays was 101 or 102 CFU/g for artificially contaminated meat products, and after a 4 h enrichment period at 37 °C, the detection limit decreased to about 1 CF U/g. Time-to completion of the assay was approximately 8 h. Thus, these qPCR methods offer a useful, rapid and efficient tool for screening viable E. coli O157:H7 in RTE meat products. This tool could also be proposed for monitoring these foodborne pathogens in HACCP programs. © 2013 Elsevier Ltd. All rights reserved.

1. Introduction Enterohaemorrhagic Escherichia coli O157:H7 is an important foodborne pathogen associated with severe, chronic and potentially fatal illnesses, such as hemorrhagic colitis and hemolytic uremic syndrome (Tarr, 1995). Although E. coli O157:H7 is thermally destroyed (62.5 °C for 4.4 min Juneja, Marmer, & Eblen, 1999), the cooked meat products may become recontaminated by this pathogen during processing after heat treatment. This fact represents a serious hazard to consumer health in preparation of the sliced meat products ready-to-eat (RTE) such as cooked and drycured products which are consumed without cooking after manufacture (Sheen & Hwang, 2010). Traditional methods have been used to detect E. coli O157:H7, however they are time-consuming and can take up to 5–6 days to perform them. Nowadays, molecular methods as PCR-based protocols have been established as a valuable alternative to traditional detection methods (Malorny et al., 2003). In this way, quantitative PCR (qPCR) provides a tool for an accurate and sensitive quantification of DNA and cDNA targets that could be applied to detect E. coli O157:H7 in foods (Carey, Kostrzynska, & Thompson, 2009; Di & Tumer, 2010; Fitzmaurice et al., 2004; Gonzales et al., 2011; Sen, Sinclair, Boczek, & Rice, 2011). False positive results may occur due to the presence of DNA from non-viable bacteria (Josephson, Gerba, & Pepper, 1993; Wolffs, Norling, & Rådström, 2005). A possible solution may be to take RNA as ⁎ Corresponding author. Tel.: +34 927 257 125; fax: +34 927 257 110. E-mail address: [email protected] (M. Rodríguez). URL: http://higiene.unex.es (M. Rodríguez). 0309-1740/$ – see front matter © 2013 Elsevier Ltd. All rights reserved. http://dx.doi.org/10.1016/j.meatsci.2013.10.018

target, however it tends to degrade relatively rapid after cell death (Nocker & Camper, 2009). Messenger RNA (mRNA) could be considered as an appropriate indicator of cell viability because it has a short half-life of few minutes, and should belong to target genes of the pathogen which are always expressed (independent from physiological and environmental changes) (Kushner, 1996; Yaron & Matthews, 2002). The correct choice of the target sequence to design primers is essential for a good power of discrimination and sensitivity of the method. Several multiplex qPCR procedures to detect E. coli O157:H7 based on different combinations of their major virulence genes, such as fliC, stx1, stx2, eaeA, rfbE, uidA and hlyA, have been developed (Carey et al., 2009; Di & Tumer, 2010; Fratamico & DebRoy, 2010; Gonzales et al., 2011; Lee & Levin, 2011; Shah, Shringi, Besser, & Call, 2009; Sharma, 2006; Sharma & Dean-Nystrom, 2003; Sharma, DeanNystrom, & Casey, 1999). However, the value of screening for the presence of some targets (e.g. stx gene sequences) remains controversial, since not all Shiga toxin-producing E. coli have been proven to be clinically significant in humans (Brooks et al., 2005; Perelle, Dilasser, Grout, & Fach, 2007). Moreover, not all of above genes are suitable targets for detecting viable E. coli O157:H7 because the signal of some genes is dependent on growth conditions and can be influenced by numerous environmental factors (Di & Tumer, 2010; Yaron & Matthews, 2002). Other species of bacteria such as Escherichia fergusonii, Vibrio cholerae or Yersinia enterocolitica contain the rfbE gene sequences (Fegan, Barlow, & Gobius, 2006; Maurer et al., 1999) therefore need more than one target. Specifically, E. fergusonii is a species of the genus Escherichia that is closely related to E. coli (Farmer et al., 1985) and the genetic transfer of the O antigen gene cluster between E. coli O157:H7 and E. fergusonii has been previously established (Fegan et al., 2006). In this study a duplex qPCR assay incorporating a

R. Gordillo et al. / Meat Science 96 (2014) 964–970

965

Table 1 Bacterial strains used in this study and results from qPCR methods based on SYBR Green and TaqMan methodologies obtained in the specificity assays. Species

SYBR Green a

Ct ± SD

TaqMan b

Tm ± SD (°C)

c

d

e

f

76.5 ± 0.34 76.5 ± 0.34 h – – i 78.1 ± 0.34 – 76.8 ± 0.28 – – – – – – – – – i 84.0 ± 0.01 i 84.0 ± 0.01 i 84.0 ± 0.01 i 84.1 ± 0.23 i 84.1 ± 0.23 – – – – – i 80.1 ± 0.03 – – –

79.5 ± 0.35 79.5 ± 0.35 79.5 ± 0.23 –

22.4 ± 0.92 20.0 ± 0.14 40.0 ± 0.01 40.0 ± 0.01 40.0 ± 0.01 40.0 ± 0.01 21.4 ± 0.23 38.4 ± 1.27 38.6 ± 0.05 40.0 ± 0.01 37.9 ± 0.58 38.5 ± 0.25 38.1 ± 0.39 40.0 ± 0.01 40.0 ± 0.01 38.2 ± 0.52 35.0 ± 0.39 37.1 ± 0.90 40.0 ± 0.01 36.5 ± 0.05 40.0 ± 0.01 40.0 ± 0.01 40.0 ± 0.01 40.0 ± 0.01 40.0 ± 0.01 40.0 ± 0.01 40.0 ± 0.01 40.0 ± 0.01 40.0 ± 0.01 40.0 ± 0.01

21.2 ± 0.08 19.4 ± 0.13 24.2 ± 1.17 40.0 ± 0.01 40.0 ± 0.01 40.0 ± 0.01 40.0 ± 0.01 38.6 ± 0.87 40.0 ± 0.01 40.0 ± 0.01 38.2 ± 0.11 40.0 ± 0.01 40.0 ± 0.01 40.0 ± 0.01 40.0 ± 0.01 40.0 ± 0.01 33.0 ± 0.15 35.4 ± 0.45 40.0 ± 0.01 36.9 ± 0.33 40.0 ± 0.01 35.8 ± 0.77 40.0 ± 0.01 40.0 ± 0.01 40.0 ± 0.01 40.0 ± 0.01 40.0 ± 0.01 40.0 ± 0.01 40.0 ± 0.01 40.0 ± 0.01

fliCh7

rfbE

g

Escherichia coli O157:H7 CECT 4267 E. coli O157:H7 CECT 4782 E. coli O1:H7 CECT 515 E. coli O55:H6 CECT 729 E. coli O141:H4 CECT 504 E. coli O158:H23 CECT 744 E. coli O157:H− jEc10s E. coli O156 kFCVTEC 5 E. coli O91 FCVTEC 38 E. coli O176 FCVTEC 70 E. coli O166 FCVTEC 158 E. coli O76 FCVTEC 167 E. coli O87 FCVTEC 177 E. coli O6 FCVTEC 191 E. coli O123 FCVTEC 196 E. coli O128 FCVTEC 198 E. fergusonii lDSM 13698 E. fergusonii mCReSA GN0137 E. fergusonii CReSA GN0154 E. fergusonii CReSA GN0155 E. fergusonii CReSA GN0831 E. albertii DSM 17582 Listeria monocytogenes CECT 934 L. ivanovii subsp. londoniensis CECT 5375 L. ivanovii subsp. ivanovii CECT 5368 Salmonella enterica subsp. enterica CECT 4374 Staphylococcus aureus CECT 976 Yersinia enterocolitica CECT 4315 Clostridium perfringens CECT 376 Vibrio cholerae CECT 514

15.8 ± 0.33 15.0 ± 1.00 18.9 ± 0.23 40.0 ± 0.01 34.3 ± 0.21 40.0 ± 0.01 14.6 ± 0.13 40.0 ± 0.01 40.0 ± 0.01 40.0 ± 0.01 40.0 ± 0.01 40.0 ± 0.01 40.0 ± 0.01 40.0 ± 0.0 40.0 ± 0.01 40.0 ± 0.01 29.5 ± 0.24 34.5 ± 0.5 34.1 ± 0.1 35.9 ± 1.0 34.7 ± 0.1 40.0 ± 0.01 40.0 ± 0.01 40.0 ± 0.01 40.0 ± 0.01 40.0 ± 0.01 34.6 ± 0.25 40.0 ± 0.01 40.0 ± 0.01 40.0 ± 0.01

Ct ± SD

– – – – – – – – – – –

– – – – – – – –

rfbE

fliCh7

No Template Control (NTC) Ct value was established in 35 for TaqMan assay. a Data represent the mean threshold cycle (Ct) value obtained in the qPCR reaction ± standard deviation (SD), each consisting of triplicate samples. b Data represent the mean melting temperature (Tm) value obtained in the qPCR reaction ± standard deviation (SD), each consisting of triplicate samples. c qPCR with primer pair RGrfbE-F/R. d qPCR with primer pair RGfliCh7-F/R. e qPCR with primer pair RFBEO157-F/R and probe RFBEO157-P. f qPCR with primer pair RGfliCh7-F/R and probe RGfliCh7-P. g CECT, Spanish Type Culture Collection. h No PCR amplification was observed in SYBR Green qPCR reactions. i Nonespecific amplification. j Ec10s: strain belonging to the Culture Collection of Food Hygiene and Safety from the University of Extremadura. k FCVTEC, Collection of Infectious Diseases and Epidemiology, School of Veterinary Sciences, University of Extremadura. l DSM, German Collection of Microorganims and Cell Cultures. m CReSA, Collection of Research Center for Animal Health, Barcelona, Spain.

combination of serotype-specific markers of E. coli O157:H7 including the rfbE and fliCh7 genes, encoding the O157 antigen and the H7 flagellar antigen respectively, to ensure specificity in the detection of the microorganism, was developed. The detection and isolation of E. coli O157:H7 in foods, such as drycured or dry-fermented meat products, with high levels of natural microbial population can become very difficult (Johnson, Brooke, & Fritschel, 1998). Further, the efficiency of the qPCR can be seriously affected by the presence of inhibitors from the food matrix, such as proteinases and other compounds naturally present in foods, or by the heterogeneous composition of some food matrices (Flekna, Schneeweiss, Smulders, Wagner, & Hein, 2007; Powell, Gooding, Garret, Lund, & McKee, 1994; Rossen, Norskov, Holmstrom, & Rasmussen, 1992; Rossmanith, Süb, Wagner, & Hein, 2007). Thus, immunomagnetic separation (IMS) technology in combination with selective enrichment has been found as a good alternative to improve rates of detection and isolation of E. coli O157:H7 in complex food matrices (Gordillo, Córdoba, Andrade, Luque, & Rodríguez, 2011; Weagant & Bound, 2001; Weagant, Bryant, & Jinneman, 1995). These methods can concentrate foodborne pathogens and remove PCR inhibitors from foods in combination with kits for DNA extraction (Fedio et al., 2011; Sarimehmetoglu et al., 2009; Shah et al., 2009). The

aim of our study was to develop sensitive and specific mRNA-based qPCR tests for detection, and quantification of viable E. coli O157:H7 in RTE meat products. 2. Materials and methods 2.1. Bacterial strains and culture conditions To optimize the amplification conditions, two reference strains of E. coli O157:H7 were used. The specificity of the qPCR protocol was assessed by using other verotoxigenic strains of E. coli and foodborne pathogens. All reference strains are listed in Table 1. The bacteria were stored at −80 °C in Brain Heart Infusion (BHI) broth containing 25% glycerol. 2.2. DNA extraction from pure cultures Total genomic DNA was extracted from 1 mL overnight cultures in BHI broth incubated at 37 °C. This extract was centrifuged for 5 min at 12,000 ×g and resuspended in 500 μL of TES buffer (0.05 M Tris, 0.05 M NaCl, 0.005 M EDTA, pH 8) as it is described by Lawson, Gharbia, Shah, and Clark (1989), including a boiling step for 10 min

966

R. Gordillo et al. / Meat Science 96 (2014) 964–970

and immediate chilling at −80 °C for 5 min. For Staphylococcus aureus, 1 μL of lysostaphin (1 mg/mL) (Sigma-Aldrich Co., St Louis, Missouri, USA) was used and the mixture was then incubated at 37 °C for 30min. Later, DNA was extracted using a mix of phenol and chloroform. Ethanol was used for the next DNA precipitation and, then the DNA obtained was eluted in 100 μL of sterile ultrapure water. The quantity and quality of DNA were spectrophotometrically determined in a Biophotometer (Eppendorf AG, Hamburg, Germany).

Reeves, 2000) were designed using the Primer Express software (Applied Biosystems, Foster City, California, USA). With this primer pair, an amplicon of 109 bp was obtained in the qPCR SYBR Green assay. Two specific primer pairs (RGrfbE-F/R and RFBEO157-F/R for SYBR Green and TaqMan assays, respectively) and a TaqMan probe (RFBEO157-P) (Table 2) were designed on the basis of the rfbE gene of E. coli O157:H7 (accession number S83460.1) using the Primer Express software too. With the primer pair RGrfbE-F/R, an amplicon of 65 bp was obtained in the qPCR SYBR Green assay.

2.3. DNA and RNA extraction from inoculated meat samples 2.6. qPCR reactions To evaluate the effect of the meat matrix on template preparation and to test the sensitivity of the qPCR method, E. coli O157:H7 CECT 4267 was inoculated in different RTE meat products collected from several local supermarkets. These samples included dry-cured meat products (dry-cured ham and dry-cured pork loin), dry-fermented sausages (“chorizo”, “salchichón” and “salami”), and cooked meat products (cooked ham, cooked turkey breast, chopped, and mortadella). All meat samples were confirmed to be negative for E. coli O157:H7 by means of method ISO 16654:2001 (Anonymous, 2001). The nucleic acid extraction of E. coli O157:H7 from meat samples was carried out according to the method previously described by Gordillo et al. (2011) with some modifications for the RNA extraction. For this, 20 μL of the IMS-bead complex was processed according to the instructions of the MasterPure RNA Isolation Kit (Epicentre Biotechnologies, Wisconsin, USA). Contaminating DNA presents in RNA preparations was removed by treatment with Recombinant DNase I (RNase-free) as recommended by the manufacturer (Takara Bio Inc., Otsu, Shiga, Japan). The RNA pellet was dissolved in 50 μL of DMPC-treated water. In order to check the integrity of total RNA, an aliquot of the RNA was separated on 1% agarose gel. The concentration and purity of RNA samples were determined spectrophotometrically by absorbance measurements at 260 and 280 nm. 2.4. Synthesis of cDNA For cDNA synthesis, 5 μL of total RNA was used along with the PrimeScript RT reagent Kit (Perfect Real Time) (Takara Bio Inc). The reaction mixture was essentially prepared as described by the manufacturer. 2.5. qPCR primers design The primers FLICH7-F and FLICH7-R based upon the fliCh7 gene (Gannon et al., 1997) were applied on genomic DNA from E. coli O157:H7 strains and an amplicon of 625bp was obtained. This amplicon was purified, sequenced and analyzed. Then, a specific primer pair RGfliCh7-F/R and a TaqMan probe (RGfliCh7-P) (Table 2) from specific conserved regions of 625-bp amplicon (Wang, Rothemund, Curd, & Table 2 Nucleotide sequence of primers and probe used for TaqMan and SYBR Green qPCR assays. Primer/probe name

Nucleotide sequences (5′-3′)

Amplicon Position length

RGfliCh7-F RGfliCh7-R RGfliCh7-P

GCGCGAAGTTAAACACCACG CGGTGACTTTATCGCCATTCC [FAM]CCGAAAATACCTTGTTAACTACCGA [TAMRA] GAGCCACCCCCATTTTCG GTTCTATGTCACTAACAGACATTTGCC GGATGACAAATATCTGCGCTGC GGTGATTCCTTAATTCCTCTCTTTCC [HEX]TACAAGTCCACAAGGAAAG[BHQ1]

109 bp

584a 693 626

65 bp

397b 462 797b 1010 912

RGrfbE-F RGrfbE-R RFBEO157-F RFBEO157-R RFBEO157-P

213 bp

a Positions are in accordance with the published sequences of fliCh7 gene of E. coli O157: H7 (GenBank accession no. AF228487). b Positions are in accordance with the published sequences of rfbE gene of E. coli O157: H7 (GenBank accession no. S83460.1).

The Applied Biosystems 7500 Fast Real-Time PCR system (Applied Biosystems) was used for qPCR amplification and detection. qPCR was prepared in triplicates of 25 μL of reaction mixture. Three replicates of a control sample without DNA or cDNA template were also included. All the assays were carried out in triplicate. 2.6.1. SYBR Green duplex qPCR conditions Two specific primer pair RGfliCh7-F/R and RGrfbE-F/R were evaluated in a SYBR Green protocol. For this, the DNA and cDNA of E. coli O157:H7 CECT 4267 were used. The optimized SYBR Green protocol was carried out in a final volume of 25 μL, containing 4 μL of DNA or cDNA template, 17 μL of 2× SYBR® Premix Ex Taq™ (Takara Bio Inc.), 0.17 μL of 50× ROX™ Reference Dye (Takara Bio Inc.), 0.6 μM of each primer of the RGrfbE-F/R primer pair and 0.1 μM of each primer of the RGfliCh7-F/R primer pair. The SYBR Green method was conducted with the following thermal cycling conditions: a single step of 10 min at 95 °C, 40 cycles of 95 °C for 15 s and 60 °C for 1 min. After the final PCR cycle, melting curve analysis of the PCR products was performed by heating to 60–99 °C and continuous measurement of the fluorescence to verify the PCR product. 2.6.2. TaqMan duplex qPCR conditions The two primer pairs RGfliCh7-F/R and RFBEO157-F/R and the two probes RGfliCh7-P and RFBEO157-P were assayed with E. coli O157:H7 CECT 4267 for the TaqMan methodology. To optimize the reaction mix, several concentrations ranging from 0.8 to 0.1 μM for each primer pair, and 0.6 μM to 0.05 μM for both probes were assayed. The reaction mixture for this assay consisted of 12.5 μL of Premix Ex Taq™ (Takara Bio Inc.), 0.125 μL of 50× ROX™ Reference Dye (Takara Bio Inc.), 0.6 μM of each RFBEO157-F/R primers and 0.1 μM of each RGfliCh7-F/R primers and 0.3 μM of the RFBEO157-P probe, 0.05 μM of the RGfliCh7-P probe and 4 μL of DNA or cDNA template in a final volume of 25 μL. The thermal cycling conditions included an incubation step of 2 min at 50 °C to allow the activation of the uracil-N-glycosylase (UNG) enzyme, an incubation step for 10 min at 95 °C to denature the UNG enzyme and activate AmpliTaq Gold polymerase, and 40 cycles at 95 °C for 15 s, 58 °C for 30 s and 60 °C for 30 s. 2.7. Specificity of duplex qPCR The specificity of the qPCR was tested on a fixed amount of genomic DNA (1.0 ng) from 15 reference strains including the E. coli species and other foodborne pathogens (Table 1). The qPCR reactions were carried out as described in Section 2.6. To evaluate the specificity of the primers designed for the SYBR Green assay, the melting temperature (Tm) was automatically calculated and compared with that deduced from the sequence of the expected fragment. In addition, for SYBR Green and TaqMan assays, the size of amplicons was estimated by electrophoresis in 2.5% agarose gels. 2.8. Sensitivity of duplex qPCR on artificially inoculated meat products The sensitivity of the optimized qPCR methods was assayed with DNA and cDNA extracted from the 9 different types of non-sterile

R. Gordillo et al. / Meat Science 96 (2014) 964–970

commercial RTE meat products inoculated with ten-fold serial dilutions of E. coli O157:H7 CECT 4267, at levels ranging from 1 to 106 CFU/g of food approximately. Samples were spread-plated on CHROMagar™ O157 medium (CHROMagar, Paris, France) and incubated at 37 °C for 24 h to estimate the amount of viable E. coli O157:H7. Five grams of samples with a previous enrichment at 37 °C for 0, 2 and 4 h in 2% brilliant green bile (BGB) broth (Scharlau) were then treated for DNA and mRNA extraction (Section 2.3). Inoculations and extractions were performed in triplicate for each meat product. In addition, triplicates of non-inoculated negative control were included in each experiment. qPCR reactions were carried out using 4μL of DNA or cDNA extracted from the inoculated meat products and non-inoculated negative controls in triplicate. Standard curves were generated for each group of food products after 4 h of enrichment and the efficiencies for each standard curve were calculated using the formula E = 10−1/S − 1 (S being the slope of the linear fit). 2.9. Statistical data analysis Normality of distribution of the data was tested by the Kolmogorov– Smirnov test. All the statistical analyses were performed with the SPSS v.15.0. software. One way analysis of variance (ANOVA) was carried out to determinate significant differences within and between groups. Tukey's test was applied to compare the mean values. Statistical significance was set at P ≤ 0.05. The relationships between variables were evaluated by Pearson's correlation coefficients, with correlation significance at level 0.01.

967

76.5 °C ± 0.34 °C. In addition, nonspecific amplification, including primer–dimers, was observed (Fig. 1). The best primers and probe concentrations giving the lowest Ct value with an adequate fluorescence for a given target concentration were selected for further analyses. The optimal primers concentrations used for the SYBR Green reactions were 0.1 μM and 0.6 μM for RGfliCh7-F/R and RGrfbE-F/R primer pairs, respectively. For the TaqMan assays, the lowest Ct value was also obtained with 0.6 μM of each RFBEO157-F/R primers and 0.1 μM of each RGfliCh7-F/R primers and 0.3 μM of RFBEO157-P probe and 0.05 μM of RGfliCh7-P probe. 3.2. Specificity of duplex qPCR The specificity of primers and probes was tested with genomic DNA of E. coli O157:H7, E. coli non-O157:H7, E. fergusonii, E. albertii, and other foodborne pathogens (Table 1). The two strains of E. coli O157:H7 showed means Ct values from 15.0 ± 1.00 to 15.8 ± 0.33 using the SYBR Green methodology, from 19.4 ± 0.13 to 21.2 ± 0.08 with the specific probe designed from the fliCh7 gene and from 20.0 ± 0.14 to 22.4 ± 0.92 with the specific probe whose design was based on the rfbE gene. In the SYBR Green method, all serotype O157:H7 strains showed Tm values ranging from 76.5 to 76.8 °C for the rfbE gene amplification, and 79.5 °C for the fliCh7 gene amplification. However those ones from non-O157:H7 strains ranged from 78.1 to 84.1 °C (Table 1). No amplification (Ct ≥ 40) was detected in any of the other tested strains. The specific PCR products were only obtained from E. coli O157:H7 strains, except for the strains E. coli CECT 515 (serotype O1:H7) and E. coli Ec10s (serotype O157:H−) which showed amplification only with the primers based on the fliCh7 and rfbE genes, respectively (Table 1).

3. Results 3.3. Sensitivity of duplex qPCR on artificially inoculated meat products 3.1. Optimization of duplex qPCR For the SYBR Green assay, the primer pair RGfliCh7-F/R gave a PCR product of 109 bp with a Tm value of 79.5 ± 0.35 °C. The other primer pair RGrfbE-F/R amplified a PCR product of 65 bp with a Tm value of

Fluorescence (-dF/dT)

A 0.7 0.6 0.5 0.4 O157:H7

0.3

O1:H7 0,2

O157:H-

0.1 0

Temperature (oC)

B

109 bp 65 bp

1

2

3

4

Fig. 1. Fluorescence melting curve (A) and agarose gel analysis (B) of amplification of fliCh7 and rfbE genes from E. coli O157:H7 in the SYBR Green duplex qPCR using DNA of three different E. coli strains. Lane 1: DNA molecular size marker of 2.1–0.15 kbp, lane 2: E. coli O157:H7 CECT 4267, lane 3: E. coli O1:H7 CECT 515, lane 4: E. coli O157:H− Ec10s.

The ability of the optimized qPCR protocols to quantify E. coli O157: H7 was evaluated in different artificially inoculated meat products. Table 3 shows an example of the detection limits of optimized qPCR assays, specifically for TaqMan technology. As it is observed, the limits of detection ranged widely depending on enrichment time of the inoculated samples. Thus, for example, these limits for fermented sausage “salchichón” samples without enrichment reached levels up to 3.5 ± 0.74 × 102 CFU/g, however, these samples decreased to 1 CFU/ g when were incubated for 4 h at 37 °C for both DNA and cDNA templates (Table 3). No amplification (Ct≥40) was detected in negative controls. Thus, the maximum time of enrichment tested in this work (4 h) was selected for further analysis. Standard curves using DNA and cDNA extracted from inoculated meat products after 4 h of enrichment at 37 °C were generated for each food matrix. A good slope and linear correlation (R2) were also obtained for all food matrices. Examples of standard curves obtained using both TaqMan and SYBR Green methodologies are shown in Figs. 2 and 3. The efficiencies values ranged from 95.8 to 117.5% for DNA and 92.9 to 109.9% for cDNA when both SYBR Green and TaqMan methodologies were used. In addition, no significant differences (P N 0.05) were found between standard curves obtained by the different methodologies since the slopes and R2 were similar. The relationships between E. coli O157:H7 counts by plate (CFU/g) and E. coli O157:H7 counts by qPCR (CFU/g) were evaluated by Pearson's correlation coefficients, and values of 0.871 for DNA and 0.700 for cDNA were obtained. 4. Discussion In this study, two duplex qPCR assays based on SYBR Green and TaqMan methodologies to detect and quantify viable E. coli O157:H7 have been developed. The correct choice of target sequence for design of primers and probes is essential for development of new protocols to

968

R. Gordillo et al. / Meat Science 96 (2014) 964–970

Table 3 Detection limits of the qPCR assay with Taqman technology when the strain E. coli O157:H7 CECT 4267 was inoculated in different meat products for 0, 2 and 4 h of enrichment at 37 °C. Data are expressed in CFU/g (data are concerning the rfbE gene). Meat product

0h

2h

DNA

cDNA 2

Dry-cured ham Dry-cured pork loin Fermented sausage “salami” Fermented sausage “salchichón” Fermented sausage “chorizo” Cooked turkey breast Cooked ham Chopped Mortadella

1

(3.5 ± 0.67) × 10 (3.1 ± 1.06) × 101 (3.1 ± 1.83) × 102 (3.5 ± 0.74) × 102 (2.6 ± 0.68) × 102 (4.1 ± 1.54) × 101 (3.1 ± 1.45) × 101 (3.9 ± 1.17) × 102 (4.1 ± 1.38) x 101

(3.1 ± 0.81) × 10 (4.2 ± 2.04) × 100 (3.9 ± 1.77) × 101 (3.3 ± 0.83) × 100 (4.8 ± 2.1) × 100 (5.1 ± 2.78) × 100 (4.2 ± 2.56) × 100 (5.3 ± 2.78) × 101 (8.2 ± 2.76) × 100

detect these microorganisms. In this work, specific primers and probes were designed on the basis of the rfbE and fliCh7 genes. Although the fliCh7 gene expression expression is influenced by the conditions of growth of the microorganism (Soutourina et al., 1999; Yaron & Matthews, 2002), the rfbE gene expression is independent of them. This gene is more stable because it is one of genes responsible for O side-chain synthesis, a part of essential constituent of the bacterial outer membrane (Yaron & Matthews, 2002). The rfbE gene is also present in others microorganisms (V. cholera, Y. enterocolitica, and E. fergusonii specially). Although this could lead to false positives, the O157 rfb operon contains gene sequences of specific enzymes that are either unique to E. coli O157 serotypes (Bilge, Vary, Dowell, & Tarr, 1996) to serve as molecular markers for this microorganism (Maurer et al., 1999). Thus, the specific primers and probes designed on the basis of the rfbE gene, seem to be suitable to quantify E. coli O157:H7 since only serotype O157 strains showed Tm values of 76.5 °C and 76.8 °C corresponding to the rfbE gene with SYBR Green methodology. As DNA melting curves are a function of the GC/AT radio, length, and sequences (Ririe, Rasmussen, & Wittwer, 1997), although DNA from one of the E. fergusonii strains was amplified with a Ct value

Threshold cycle (Ct)

A

40 y = 3.262x + 30.162 R² = 0.9831

35 30 25 20 y = 3.308x+ 30.181 R²= 0.991

15

4h

DNA

cDNA 0

(3.5 ± 0.67) × 10 (3.2 ± 1.06) × 100 (3.1 ± 1.83) × 101 (3.5 ± 0.74) × 101 (2.6 ± 0.68) × 101 (4.1 ± 1.54) × 100 (3.1 ± 1.45) × 100 (3.9 ± 1.17) × 101 (4.1 ± 1.38) × 100

0

(3.1 ± 0.81) × 10 b1 (3.9 ± 1.77) × 100 b1 b1 b1 b1 5.3 ± 2.78) × 100 b1

DNA

cDNA

b1 b1 1.1 ± 1.83 b1 b1 b1 b1 b1 b1

b1 b1 b1 b1 b1 b1 b1 b1 b1

of 29.5, its Tm value was 84.0 °C, being this one very different to the specific Tm value obtained by serotype O157. Nonspecific amplificacions in the TaqMan assays were considered those ones with Ct values outside of the optimal range (Ct ≥ 35), because the amplified products did not corresponded to the expected size (213 bp rfbE gene and 109 bp fliCh7 gene). The quality of DNA and RNA extracted from foods is critical because the efficiency of qPCR methods can be reduced by the inhibitors from the matrix or degradation and damage of nucleic acid (Miller, Bryant, Madsen, & Ghiorse, 1999). The isolation of stable RNA from complex material, such foods, that contains nucleases and PCR inhibitors is a challenge (Fratamico, Wang, Yan, Zhang, & Li, 2011). In addition, the use of partially degraded RNA can lead to changes or incorrect quantification results (Fleige & Pfaffl, 2006). Hence, it is necessary to study the robustness of newly developed methods in foods, including DNA extracted from E. coli artificially inoculated in meat products. Therefore, good DNA and RNA extraction methods are necessary to allow a correct quantification of these nucleic acids. Multiplex qPCR are always difficult to optimize. For this reason, the duplex qPCR for both methodologies conditions and concentration of primers and probes as well as the specificity study of the above methods were optimized using genomic DNA as target. Regarding to specificity of the designed primer pairs and hydrolysis probes for SYBR Green and TaqMan assays, this one was confirmed in this study since only the strains which had O157 and H7 serotypes were detected by both qPCR. However, no nonspecific amplification was observed in those strains without these antigens. The functionality of the developed methods was also demonstrated by the high linear relationship of the standard curves constructed with the DNA and cDNA 10-fold dilutions and Ct values for the different

10 5 0

-1

0

2

3

40

4

Log CFU/g

35

35

Threshold cycle (Ct)

B 40 Threshold cycle (Ct)

1

y = 3.2687x + 32.499 R² = 0.98

30 25 20 15

y = 3.2945x + 26.285 R² = 0.9941

10

y =-3.216x + 28.028 R² = 0.9907

30 25 20 15

y =-3.3094x + 20.551 R² = 0.9928

10 5

5 0

0 -1

0

1

2

3

4

Log CFU/g Fig. 2. DNA (A) and cDNA (B) standard curves showing the log CFU/g vs threshold cycle (Ct) values of duplex TaqMan qPCR method for E. coli O157:H7 CECT 4267 inoculated in mortadella after 4 h of enrichment at 37 °C. (●) fliCh7 gene, (■) rfbE gene.

-2

-1

0

1

2

3

4

Log CFU/g Fig. 3. Standard curves showing the log CFU/g vs threshold cycle (Ct) values of duplex SYBR qPCR method for E. coli O157:H7 CECT 4267 inoculated in dry-cured pork loin after 4 h of enrichment at 37 °C. (♦) DNA (●) cDNA.

R. Gordillo et al. / Meat Science 96 (2014) 964–970

meat products. Raymaekers, Smets, Maes, and Cartuyvels (2009) suggested that slopes of the standard curve should range between − 3.1 and − 3.6, corresponding to a PCR efficiency of 80 and 110% and the R2 values be ≥ 0.98 for PCR validation. Thus, when the sensitivity of the qPCR assays was evaluated in different food matrices, all standard curves showed suitable linearity (R2 N 0.98) and all slopes were within the recommended range suggested. The detection limits in all inoculated meat products were about 1 CFU/g for both qPCR and RT-qPCR methods, regardless of the used methodology, after only 4h of enrichment at 37°C. This level of sensitivity is higher than those obtained by other authors who needed more time of enrichment to reach similar detection levels of E. coli O157:H7 in meat and meat products using multiplex TaqMan qPCR (Fedio et al., 2011; Fratamico & DebRoy, 2010; Kawasaki et al., 2010) or simplex TaqMan qPCR (Fu, Rogelj, & Kieft, 2005; Miszczycha et al., 2012; Takahashi et al., 2009). Probably the sensitivity achieved with both SYBR and TaqMan technologies can be due to the combined use of an enrichment in BGB broth and the use of immuno particles, when is compared to other similar methods. The BGB broth has a composition that favors the microorganisms' growth and the function of the inmuno particles consists of concentrating bacteria and removing PCR inhibitors. In addition, E. coli is an intestinal microorganism which is very tolerant to bile salts, despite the fact that these salts inhibit the growth of other bacteria, particularly Gram-positive organisms (Begley, Gahan, & Hill, 2005) which are present at high levels in fermented and drycured meat products. The enrichment step not only increases the template copy numbers, it also dilutes inhibitory substances and the length of enrichment affects the detection sensitivity of qPCR assays. The effect of meat matrix on the sensitivity of the PCR differed depending on the product when no enrichment step was carried out. The sensitivity of the qPCR methods can be improved by increasing the enrichment time, showing acceptable levels of detection at 2 h. However, after 4 h of enrichment the rfbE and fliCh7 genes were consistently and reproducibly detected in all artificially contaminated meat samples. Consequently both SYBR Green and TaqMan RT-qPCR procedures developed in the present study could be carried out in a relatively short time period (5–6 h for DNA/RNA extraction and 2–3 h for qPCR or RT-qPCR). Although both methods are sensitive and specific, the non-sequence-specific SYBR Green assay is cheaper than the fluorescent probe-based TaqMan assay being an additional advantage for routine analyses of food commodities. However, the SYBR Green reagent system may lose specificity if primers–dimers are formed or nonspecific fragments are present (Kubista et al., 2006), whereas TaqMan oligoprobes may offer a more accurate detection. The time-consuming of analysis by both qPCR methods is considerably lower than that needed to quantify E. coli O157:H7 by conventional culturing techniques (3–5 days). These last techniques based on the sorbitol-negative fermenting characteristic of E. coli O157:H7 are proposed by the method ISO 16654:2001 (Anonymous, 2001) for selective differentiation and isolation E. coli O157:H7 in food and animal foodstuffs, is based on an enrichment procedure (16– 24 h), followed by a separation and concentration step, and then an isolation step on selective chromogenic media. Although these methods have been reported to be sensitive (1–2 CFU/25 g) (Voitoux, Lafarge, Collette, & Lombard, 2002), several studies have demonstrated which these methods are often associated with a low rate of E. coli O157:H7 recovery from foods (Kehl, 2002). This is due to the fact that cells entering a dormancy state where they become viable but nonculturable (Dinu & Bach, 2011), leading to an underestimation of numbers or a failure to isolate a viable culture, although the cells may still retain pathogenicity, or be recoverable to a viable cell state (Farrokh et al., 2013). In contrast to standard culture confirmation, the qPCR methods designed in this study are characterized by reduced enrichment and analysis time and high-throughput automated analysis. The limits of detection of both methods were less than 1CFU/g after only

969

4 h of enrichment. In addition, they have been designed using genetic markers specific for the O- and H-antigens associated with E. coli O157: H7 which would avoid the presence of possible false negative and false positive results. For all this, both developed methods could be appropriate for an accurate quantification of viable E. coli O157:H7 in meat products at very low levels where this microorganism could grow and this growth may suppose a hazard for health consumers. In conclusion, both qPCR and RT-qPCR methods offer a useful, rapid and efficient tool to quantify E. coli O157:H7 in food products and could be used for monitoring these foodborne pathogens in HACCP programs. This monitoring may allow taking rapid corrective actions to avoid the presence of this pathogen in the processed meat products. Acknowledgments This work has been funded by project Carnisenusa CSD2007-00016, Consolider Ingenio 2010 and GRU10162 of the Gobierno de Extremadura and FEDER. References Anonymous (2001). ISO 16654:2001 Microbiology of food and animal feeding stuffs. Horizontal method for the detection of Escherichia coli O157. Geneve, Switzerland: International Organization for Standardization. Begley, M., Gahan, C. G. M., & Hill, C. (2005). The interaction between bacteria and bile. FEMS Microbiology Review, 29, 625–651. Bilge, S. S., Vary, J. C., Jr., Dowell, S. F., & Tarr, P. I. (1996). Role of the Escherichia coli O157: H7 O side chain in adherence and analysis of an rfb locus. Infection and Immunity Journal, 64, 4795–4801. Brooks, J. T., Sowers, E. G., Wells, J. G., Greene, K. D., Griffin, P.M., Hoekstra, R. M., & Strockbine, N. A. (2005). Non-O157 Shiga toxin-producing Escherichia coli infections in the United States, 1983–2002. The Journal of Infectious Diseases, 192, 1422–1429. Carey, C. M., Kostrzynska, M., & Thompson, S. (2009). Escherichia coli O157:H7 stress and virulence gene expression on Romaine lettuce using comparative real-time PCR. Journal of Microbiological Methods, 77, 235–242. Di, R., & Tumer, N. E. (2010). Real-time reverse transcription PCR detection of viable shiga toxin-producing Escherichia coli O157:H7 in food. Journal of Food Safety, 30, 51–66. Dinu, L. -D., & Bach, S. (2011). Induction of viable but nonculturable Escherichia coli O157: H7 in the phyllosphere of lettuce: A food safety risk factors. Applied and Environmental Microbiology, 77, 8295–8302. Farmer, J. J., III, Fanning, G. R., Davis, B. R., O'Hara, C. M., Riddle, C., Hickman-Brenner, F. W., Asbury, M. A., Lowery, V. A., & Brenner, D. J. (1985). Escherichia fergusonii and Enterobacter taylorae, two new species of Enterobacteriaceae isolated from clinical specimens. Journal of Clinical Microbiology, 21, 77–81. Farrokh, C., Jordan, K., Auvray, F., Glass, K., Oppegaard, H., Raynaud, S., Thevenot, D., Condron, R., De Reu, K., Govaris, A., Heggum, K., Heyndrickx, M., Hummerjohann, J., Lindsay, D., Miszczycha, S., Moussiegt, S., Verstraete, K., & Cerf, O. (2013). Review of Shiga-toxin-producing Escherichia coli (STEC) and their significance in dairy production. International Journal of Food Microbiology, 162, 190–212. Fedio, W. M., Jinneman, K. C., Yoshitomi, K. J., Zapata, R., Wendakoon, C. N., Browning, P., & Weagant, S. D. (2011). Detection of E. coli O157:H7 in raw ground beef by Pathatrix™ immunomagnetic-separation, real-time PCR and cultural methods. International Journal of Food Microbiology, 148, 87–92. Fegan, N., Barlow, R. S., & Gobius, K. S. (2006). Escherichia coli O157 somatic antigen is present in an isolate of E. fergusonii. Current Microbiology, 52, 482–486. Fitzmaurice, J., Glennon, M., Duffy, G., Sheridan, J. J., Carroll, C., & Maher, M. (2004). Application of real-time PCR and RT-PCR assays for the detection and quantitation of VT 1 and VT 2 toxin genes in E. coli O157:H7. Molecular and Cellular Probes, 18, 123–132. Fleige, S., & Pfaffl, M. W. (2006). RNA integrity and the effect on the real-time qRT-PCR performance. Molecular Aspects of Medicine, 27, 126–139. Flekna, G., Schneeweiss, W., Smulders, F. J. M., Wagner, M., & Hein, I. (2007). Real-time PCR method with statistical analysis to compare the potential of DNA isolation methods to remove PCR inhibitors from samples for diagnostic PCR. Molecular and Cellular Probes, 21, 282–287. Fratamico, P.M., & DebRoy, C. (2010). Detection of Escherichia coli O157:H7 in food using real-time multiplex PCR assays targeting the stx1, stx2, wzyO157, and the fliCh7 or eae Genes. Food Analytical Methods, 3, 330–337. Fratamico, P.M., Wang, S., Yan, X., Zhang, W., & Li, Y. (2011). Differential gene expression of E. coli O157:H7 in ground beef extract compared to Tryptic Soy Broth. Journal of Food Science, 76, 79–87. Fu, Z., Rogelj, S., & Kieft, T. L. (2005). Rapid detection of Escherichia coli O157:H7 by immunomagnetic separation and real-time PCR. International Journal of Food Microbiology, 99, 47–57. Gannon, V. P. J., D'Souza, S., Graham, T., King, R. K., Rahn, K., & Read, S. (1997). Use of the flagellar H7 gene as a target in multiplex PCR assays and improved specificity in identification of enterohemorrhagic Escherichia coli strains. Journal of Clinical Microbiology, 35, 656–662.

970

R. Gordillo et al. / Meat Science 96 (2014) 964–970

Gonzales, T. K., Kulow, M., Park, D. J., Kaspar, C. W., Anklam, K. S., Pertzborn, K. M., Kerrish, K. D., Ivanek, R., & Döpfer, D. (2011). A high-throughput open-array qPCR gene panel to identify, virulotype, and subtype O157 and non-O157 enterohemorrhagic Escherichia coli. Molecular and Cellular Probes, 25, 222–230. Gordillo, R., Córdoba, J. J., Andrade, M. J., Luque, M. I., & Rodríguez, M. (2011). Development of PCR assays for detection of Escherichia coli O157:H7 in meat products. Meat Science, 88, 767–773. Johnson, J. L., Brooke, C. L., & Fritschel, S. J. (1998). Comparison of the BAX for screening E. coli O157:H7 method with conventional methods for detection of extremely low levels of Escherichia coli O157:H7 in ground beef. Applied and Environmental Microbiology, 64, 4390–4395. Josephson, K. L., Gerba, C. P., & Pepper, I. L. (1993). Polymerase chain reaction detection of non-viable bacterial pathogens. Applied and Environmental Microbiology, 59, 3513–3515. Juneja, V. K., Marmer, B.S., & Eblen, B.S. (1999). Predictive model for the combined effect of temperature, pH, sodium chloride, and sodium pyrophosphate on the heat resistance of Escherichia coli O157:H7. Journal of Food Safety, 19, 147–160. Kawasaki, S., Fratamico, P.M., Horikoshi, N., Okada, Y., Takeshita, K., Sameshima, T., & Kawamoto, S. (2010). Multiplex real-time polymerase chain reaction assay for simultaneous detection and quantification of Salmonella species, Listeria monocytogenes, and Escherichia coli O157:H7 in ground pork samples. Foodborne Pathogens and Disease, 7, 549–554. Kehl, S.C. (2002). Role of the laboratory in the diagnosis of enterohemorrhagic Escherichia coli infections. Journal of Clinical Microbiology, 40, 2711–2715. Kubista, M., Andrade, J. M., Bengtsson, M., Forrotan, A., Jonák, J., Lind, K., Sindelka, R., Sjöback, R., Sjögreen, B., Strömbom, L., Ståhlberg, A., & Zoric, N. (2006). The real-time polymerase chain reaction. Molecular Aspects of Medicine, 27, 95–125. Kushner, S. R. (1996). mRNA decay. In F. C. Neidhardt (Ed.), Escherichia coli and Salmonella cellular and molecular biology (pp. 849–860). Washington: ASM Press. Lawson, P. A., Gharbia, S. E., Shah, H. N., & Clark, D. J. (1989). Recognition of Fusobacterium nucleatum subgroups Fn-1, Fn-2 and Fn-3 by ribosomal RNA gene restriction patterns. FEMS Microbiology Reviews, 65, 41–46. Lee, J. L., & Levin, R. E. (2011). Detection of 5 CFU/g of Escherichia coli O157:H7 on lettuce using activated charcoal and real-time PCR without enrichment. Food Microbiology, 28, 562–567. Malorny, B., Tassios, P. T., Radström, P., Cook, N., Wagner, M., & Hoorfar, J. (2003). Standardization of diagnostic PCR for the detection of foodborne pathogens. International Journal of Food Microbiology, 83, 39–48. Maurer, J. J., Schmidt, D., Petrosko, P., Sanchez, S., Bolton, L., & Lee, M.D. (1999). Development of primers to O-antigen biosynthesis genes for specific detection of Escherichia coli O157 by PCR. Applied and Environmental Microbiology, 65, 2954–2960. Miller, D. N., Bryant, J. E., Madsen, E. L., & Ghiorse, W. C. (1999). Evaluation and optimization of DNA extraction and purification procedures for soil and sediment samples. Applied and Environmental Microbiology, 65, 4715–4724. Miszczycha, S. D., Ganet, S., Duniere, L., Rozand, C., Loukiadis, E., & Thevenot-Sergentet, D. (2012). Novel real-time PCR method to detect Escherichia coli O157:H7 in raw milk cheese and raw ground meat. Journal of Food Protection, 8, 1373–1381. Nocker, A., & Camper, A. K. (2009). Novel approaches toward preferential detection of viable cells using nucleic acid amplification techniques. FEMS Microbiology Letters, 291, 137–142. Perelle, S., Dilasser, F., Grout, J., & Fach, P. (2007). Screening food raw materials for the presence of the world's most frequent clinical cases of Shiga toxin-encoding Escherichia coli O26, O103, O111, O145 and O157. International Journal of Food Microbiology, 113, 284–288. Powell, H. A., Gooding, C. M., Garret, S. D., Lund, B.M., & McKee, R. A. (1994). Proteinase inhibition of the detection of Listeria monocytogenes in milk using the polymerase chain reaction. Letters in Applied Microbiology, 18, 59–61.

Raymaekers, M., Smets, R., Maes, B., & Cartuyvels, R. (2009). Checklist for optimization and validation of real-time PCR assays. Journal of Clinical Laboratory Analysis, 23, 145–151. Ririe, K. M., Rasmussen, R. P., & Wittwer, C. T. (1997). Product differentiation by analysis of DNA melting curves during the polymerase chain reactions. Analytical Biochemisty Journal, 245, 154–160. Rossen, L., Norskov, P., Holmstrom, K., & Rasmussen, O. F. (1992). Inhibition of PCR by components of food samples, microbial diagnostic assays and DNA-extraction solutions. International Journal of Food Microbiology, 17, 37–45. Rossmanith, P., Süb, B., Wagner, M., & Hein, I. (2007). Development of matrix lysis for concentration of gram positive bacteria from food and blood. Journal of Microbiology Methods, 69, 504–511. Sarimehmetoglu, B., Aksoy, M. H., Ayaz, N. D., Ayaz, Y., Kuplulu, O., & Kaplan, Y. Z. (2009). Detection of Escherichia coli O157:H7 in ground beef using immunomagnetic separation and multiplex PCR. Food Control, 20, 357–361. Sen, K., Sinclair, J. L., Boczek, L., & Rice, E. W. (2011). Development of a sensitive detection method for stressed E. coli O157:H7 in source and finished drinking water by culture-qPCR. Environmental Science and Technology, 45, 2250–2256. Shah, D. H., Shringi, S., Besser, T. E., & Call, D. R. (2009). Escherichia. In D. Liu (Ed.), Molecular detection of foodborne pathogens (pp. 369–389). Boca Raton: CRC Press Taylor & Francis group. Sharma, V. K. (2006). Real-time reverse transcription-multiplex PCR for simultaneous and specific detection of rfbE and eae genes of Escherichia coli O157:H7. Molecular and Cellular Probes, 20, 298–306. Sharma, V. K., & Dean-Nystrom, E. A. (2003). Detection of enterohemorrhagic Escherichia coli O157:H7 using a multiplex real-time PCR assay for genes encoding intimin and Shiga toxins. Veterinary Microbiology, 93, 247–260. Sharma, V. K., Dean-Nystrom, E. A., & Casey, T. A. (1999). Semi-automated fluorogenic PCR assays (TaqMan) for rapid detection of Escherichia coli O157:H7 and other Shiga toxigenic E. coli. Molecular and Cellular Probes, 13, 291–302. Sheen, S., & Hwang, C. A. (2010). Mathematical modelling the cross-contamination of Escherichia coli O157:H7 on the surface of ready-to-eat meat product while slicing. Food Microbiology, 27, 37–43. Soutourina, O., Kolb, A., Krin, E., Laurent-Winter, C., Rimsky, S., Danchin, A., & Bertin, P. (1999). Multiple control of flagellum biosynthesis in Escherichia coli: Role of H-NS protein and the cyclic AMP-catabolite activator protein complex in transcription of the ¯hDC master operon. Journal of Bacteriology, 181, 7500–7508. Takahashi, H., Kimura, B., Tanaka, Y., Shinozaki, J., Suda, T., & Fujii, T. (2009). Real-time PCR and enrichment culture for sensitive detection and enumeration of Escherichia coli. Journal of Microbiological Methods, 79, 124–127. Tarr, P. I. (1995). E. coli O157:H7: Clinical, diagnostic, and epidemiological aspects of human infection. Clinical and Infectious Diseases, 20, 1–10. Voitoux, E., Lafarge, V., Collette, C., & Lombard, B. (2002). Applicability of the draft standard method for the detection of Escherichia coli O157 in dairy products. International Journal of Food Microbiology, 77, 213–221. Wang, L., Rothemund, D., Curd, H., & Reeves, P. R. (2000). Sequence diversity of the Escherichia coli H7 fliC genes: Implication for a DNA-based typing scheme for E. coli O157:H7. Journal of Clinical Microbiology, 38, 1786–1790. Weagant, S. D., & Bound, A. J. (2001). Evaluation of techniques for enrichment and isolation of Escherichia coli O157:H7 from artificially-contaminated sprouts. International Journal of Food Microbiology, 71, 87–92. Weagant, S. D., Bryant, J. L., & Jinneman, K. G. (1995). An improved rapid technique for isolation of Escherichia coli O157:H7 from foods. Journal of Food Protection, 58, 7–12. Wolffs, P., Norling, B., & Rådström, P. (2005). Risk assessment of false-positive quantitative real-time PCR results in food, due to detection of DNA originating from dead cells. Journal of Microbiology Methods, 60, 315–323. Yaron, S., & Matthews, K. R. (2002). A reverse transcriptase-polymerase chain reaction assay for detection of viable Escherichia coli O157:H7: Investigation of specific target genes. Journal of Applied Microbiology, 92, 633–640.