Immunology Letters 162 (2014) 119–123
Contents lists available at ScienceDirect
Immunology Letters journal homepage: www.elsevier.com/locate/immlet
Quantification of V(D)J recombination by real-time quantitative PCR Fatima-Zohra Braikia a,b , Guillaume Chemin a,b , Mohammed Moutahir a,b , Ahmed Amine Khamlichi a,b,∗ a b
CNRS UMR 5089; IPBS (Institut de Pharmacologie et de Biologie Structurale); FRBT, 205 route de Narbonne, BP 64182, F-31077 Toulouse, France Université de Toulouse; UPS; IPBS F-31077 Toulouse, France
a r t i c l e
i n f o
Article history: Received 23 May 2014 Received in revised form 30 July 2014 Accepted 3 August 2014 Available online 12 August 2014 Keywords: B lymphocyte IgH locus V(D)J recombination Real-time quantitative PCR
a b s t r a c t B and T lymphocytes have the unique capacity to somatically rearrange their antigen receptor loci through V(D)J recombination. D-JH and VH -DJH recombination events are usually visualized by semi-quantitative PCR followed by detection of end products, which is time consuming and requires the use of hazardous elements. Additionally, it necessitates relatively large amounts of genomic DNA which could be limiting when the cell populations of interest are rare. Here, we describe a real-time quantitative PCR assay for a fast quantification of V(D)J recombination events at the IgH locus. © 2014 Elsevier B.V. All rights reserved.
1. Introduction Early B and T lymphocytes have the unique capacity to somatically rearrange their antigen receptor loci in a cell-type and developmental-stage specific manner through V(D)J recombination. This process is initiated by a lymphoid-specific recombinase complex, RAG1/RAG2, that recognizes conserved recombination signal sequences flanking variable (V), diversity (D), and joining (J) gene segments in the variable domain of antigen receptor loci, and involves an ordered rearrangement of V, (D) and J gene segments [1,2]. The mouse immunoglobulin heavy chain (IgH) locus spans some 3 megabases and is composed of more than 150 VH genes (spanning ∼2.5 Mb), divided into domain-organized gene families, including the distal VH and the proximal VH family, a dozen of DH segments, four JH segments, and eight constant genes [3,4]. The IgH locus is the site of two recombination events: D-JH recombination occurs on both IgH alleles before the initiation of VH -DJH joining on one of the IgH alleles [1]. D-JH and VH -DJH recombination events are usually visualized by semi-quantitative PCR followed by Southern blot- or dye-based quantifications, which are time consuming and eventually make use of hazardous elements. Classical semi-quantitative PCR also
∗ Corresponding author at: CNRS UMR 5089-IPBS, 205 route de Narbonne, 31077 Toulouse Cedex, France. Tel.: +33 561 175 522; fax: +33 561 175 997. E-mail address: [email protected] (A.A. Khamlichi). http://dx.doi.org/10.1016/j.imlet.2014.08.002 0165-2478/© 2014 Elsevier B.V. All rights reserved.
requires relatively large amounts of genomic DNA which could be limiting if the starting cell population is rare. Additionally, subtle differences in the frequency of V(D)J recombination may be overlooked or biased by these approaches as they rely on end-products of the PCR. Moreover, the use of a backward primer downstream of the JH cluster favors amplification of shorter DH JH and VH DH JH amplicons. Finally, this approach could be laborious when comparing various genotypes. In an attempt to overcome these shortcomings, we developed a real-time quantitative PCR assay for a fast and unbiased quantification of V(D)J recombination events at the IgH locus.
2. Materials and methods Mice. The experiments on mice have been carried out according to the CNRS Ethical guidelines and approved by the Regional Ethical Committee. The generation and phenotypic analysis of the mutant mouse line are described in detail elsewhere (Chemin et al., in preparation). In this knock-in mouse line, an ∼2.6 kb CpG-rich sequence was inserted between the E enhancer and the JH cluster. Antibodies. PE-conjugated anti-CD43 and FITC-conjugated anti were purchased from BD-Pharmingen. APC-conjugated anti-B220 was from BioLegend. Purification of pro-B cells. Single cell suspensions from the bone marrow of 6- to 8-week-old mice were prepared by standard techniques. Pro-B cells were sorted by using CD19-magnetic microbeads and LS columns (Miltenyi), labeled with anti-B220,
120
F.-Z. Braikia et al. / Immunology Letters 162 (2014) 119–123
anti-CD43, and anti-, and sorted as B220+ − CD43high fraction. The purity of the sorted population was checked by FACS. Primers. The primers are listed in Table 1. All the primers were designed for this study except for DHL-Fw, VH7183-Fw and VHJ558-Fw primers which were from Perlot et al. [5]. Standard curves. Genomic DNA (gDNA) from the sorted pro-B cell population was prepared by standard techniques, and diluted for the qPCR assays. 30 ng of gDNA or 3-fold dilutions thereof were analyzed as described below for DH -JH and VH -DH JH recombination by qPCR at the optimal temperature using the primers listed in Table 1. In order to keep the total amount of DNA (30 ng) constant,
appropriate amounts of gDNA from Rag2-deficient pro-B cells were added to the dilution samples. A negative control without gDNA was included. Real-time PCR. All the qPCRs were performed on a CFX-96 thermal cycler (Bio-Rad), using the SsoFast EvaGreen Supermix kit (Bio-Rad). We usually used 10 ng of gDNA in a final volume of 10 l. The qPCR program was as follows: denaturation at 98 ◦ C for 30 s, annealing and polymerization at the appropriate hybridization temperature (see Table 1), for 10 s. This cycle was repeated 40 times. For the melting (or dissociation) curve, the increment was 0.5 ◦ C/10 s between 65 ◦ C and 95 ◦ C. HS5 sequence was used for normalization.
Fig. 1. (A) A scheme of the IgH locus in its germline (GL), pre-rearranged configuration. E enhancer and the 3 regulatory region (3 RR) which control the locus expression are shown. The distal and the proximal VH gene families are illustrated by one segment only, J558 for the distal VH family and 7183 for the proximal VH family. The HS5 sequence used for normalization is located downstream of the IgH locus. The approximate sizes of the VH , DH -JH and the constant domains are indicated. (B). Pro-B cells from WT bone marrows were sorted as B220+ CD43high − (P7 window in the upper panel) and checked for purity by FACS (P8 square in the bottom panel). At least 97% pure pro-B cells were consistently obtained. (C) Determination of the standard curve by using triplicates of a series of 3-fold dilutions of gDNA (from sorted WT pro-B cells) as a template, starting with 30 ng of gDNA. This amount was kept constant by completing with the relevant amount of Rag2−/− gDNA to the dilution samples. The relative position of the primers is indicated in the upper scheme. For each primer combination, the upper panel shows the standard curve of the primer pair used to quantify DH JH segments. The bottom shows the post-amplification melting curve which was established by increasing the temperature of the reaction (0.5 ◦ C/10 s between 65 ◦ C and 95 ◦ C). (D) Upper and bottom panels are as in (C), the upper panels correspond to the primer pairs amplifying pVH DH JH segments. (E) Upper and bottom panels are as in (C), the upper panels correspond to the primer pairs amplifying dVH DH JH segments.
F.-Z. Braikia et al. / Immunology Letters 162 (2014) 119–123
121
Fig. 1. (A)(Continued.)
Agarose gel electrophoresis. The qPCR products were visualized by ethidium bromide on standard 1.5% agarose gels. Sequencing of V(D)J amplicons. The qPCR products were purified by using the QIAquick PCR purification kit (Qiagen) and cloned into pCR2.1-TOPO (InVitrogen) for sequencing.
3. Results and discussion We designed reverse primers that specifically pair downstream of each JH segment of the IgH locus (Table 1). Consequently, realtime quantitative PCRs (qPCRs) are performed in parallel to amplify
Table 1 The sequences of the primers used, the recombination step they amplify, their hybridization temperature, efficiency and correlation coefficients (R2 ) are indicated. Forward primers
Reverse primers
Recombination
Hybridization (◦ C)
Efficiency (%)
R2
DH -JH recombination DHL-Fw: TTTTTGTCAAGGGATCTACTACTGTG DHL-Fw: TTTTTGTCAAGGGATCTACTACTGTG DHL-Fw: TTTTTGTCAAGGGATCTACTACTGTG DHL-Fw: TTTTTGTCAAGGGATCTACTACTGTG
JH1R: GACTGCCTCTTTTCCTGGGAGTG JH2R4: TAGACCCCTGACAATAAATGA JH3R1: CGATAGACCCTGGACAAGATTC JH4R2: TATTTCCCAACTTCTCTCAGCC
DH -JH1 DH -JH2 DH -JH3 DH -JH4
60.0 61.0 61.0 61.0
87.9 85.4 106.5 106.5
0.988 0.992 0.984 0.985
pVH -DH JH recombination VH7183-Fw: GCGAAGCTTGTGGAGTCTGGGGGAGGCTTA VH7183-Fw: GCGAAGCTTGTGGAGTCTGGGGGAGGCTTA VH7183-Fw: GCGAAGCTTGTGGAGTCTGGGGGAGGCTTA VH7183-Fw: GCGAAGCTTGTGGAGTCTGGGGGAGGCTTA
JH1R: GACTGCCTCTTTTCCTGGGAGTG JH2R1: CTGAGGAGACTGTGAGAGTGGTG JH3R5: CAGTTCTAATGTCACCACAGACC JH4R1: CTGAGGAGACGGTGACTGAGGT
pVH -DH JH1 pVH -DH JH2 pVH -DH JH3 pVH -DH JH4
60.0 60.5 60.0 60.5
120.0 90.1 92.6 88.5
0.981 0.986 0.991 0.986
dVH -DH JH recombination VHJ558-Fw: GCGAAGCTTARGCCTGGGRCTTCAGTGAAG VHJ558-Fw: GCGAAGCTTARGCCTGGGRCTTCAGTGAAG VHJ558-Fw: GCGAAGCTTARGCCTGGGRCTTCAGTGAAG VHJ558-Fw: GCGAAGCTTARGCCTGGGRCTTCAGTGAAG
JH1R: GACTGCCTCTTTTCCTGGGAGTG JH2R1: CTGAGGAGACTGTGAGAGTGGTG JH3R5: CAGTTCTAATGTCACCACAGACC JH4R1: CTGAGGAGACGGTGACTGAGGT
dVH -DH JH1 dVH -DH JH2 dVH -DH JH3 dVH -DH JH4
60.0 60.5 61.5 60.5
103.6 96.0 90.7 87.7
0.996 0.991 0.995 0.995
Normalization HS5-Fw1: ACTCAAGGGTTAAGAGCACTGGCT
HS5-R1: AATCCTTCAGGGCATCCTGGAACT
63.0
98.0
0.986
122
F.-Z. Braikia et al. / Immunology Letters 162 (2014) 119–123
Fig. 2. (A) Analysis of qPCR products by gel electrophoresis. Genomic DNA purified from sorted pro-B cells was subjected to qPCR for amplification of DH JH and VH -DH JH recombination events by using appropriate primer pairs, and the qPCR products run on a standard agarose gel. The prominent bands of the right size corresponding to the amplified DH JH1 , pVH DH JH4 and dVH DH JH4 segments are shown here as an example. HS5 sequence was used for normalization. Two aliquots from two independent experiments are shown. (B) Sequence analysis of the qPCR products. Amplicons were cloned and sequenced (∼10 sequences for each recombined segment). Examples of the sequences obtained for DH JH segments and the distal (dVH ) dVH DH JH (involving distal dVH gene segment) are displayed. The clonality of the sequences was based on sequence diversity at DH -JH joints and VH -DH -JH joints. Therefore, sequences with identical nucleotide additions and/or deletions were considered as one sequence. For dVH DH JH segments, only sequences in which the DH segment could be unambiguously identified (underlined) are shown. The DH segments involved in DH JH and dVH DH JH recombination are indicated between brackets. The 5 sequence of germline (GL) JH1 and JH4 are indicated in italics.
recombination events involving each JH segment. For VH and DH segments, we used degenerate primers known to pair with all the DH segments or with either the proximal or the distal familyspecific VH segments of the IgH locus (Fig. 1A and Table 1). As a control, we amplified HS5 sequence located downstream of the IgH locus, which is not targeted by V(D)J recombination (Fig. 1A). All the assays were performed on genomic DNAs prepared from sorted pro-B cells (Fig. 1B) since DH -JH and VH -DH JH recombination steps occur at this developmental stage. A temperature gradient was first performed for each primer pair in order to identify the annealing temperature yielding a single PCR product (not shown). We next determined the standard curve at the optimal temperature by using serial dilutions of genomic DNA. To keep the final concentration of gDNA constant in the dilution samples, appropriate amount of gDNA from Rag2-deficient pro-B cells was added. Examples of the standard curves obtained with primer pairs that amplify DH JH and VH DH JH segments are shown in Fig. 1C–E. Of note, effecting serial dilutions without keeping the total amount of gDNA constant in the dilution samples (thus adding water instead of Rag2−/− gDNA) did not affect the efficiency of the reaction (Fig. S1). To check that the amplicons are genuine products of DH -JH and VH -DH JH recombination events, we performed three assays. (1) We performed a melting curve analysis by increasing the temperature after completion of the PCR. A single peak was found for each set
of primer pairs indicating the presence of a single PCR product (Fig. 1C–E), and excluding primer-dimer contaminations. (2) The qPCR products were also checked by gel electrophoresis. A single band of the expected size was prominently detected for DH JH and VH DH JH segments as illustrated in Fig. 2A (top panels). (3) The amplicons were then sequenced and checked for their clonality based on sequence diversity at the DH JH and VH DH JH junctions (Fig. 2B, bottom panel). Interestingly, among a total of 80 sequences, only two sequences displayed identical N elements at their junction (and therefore counted as one VH DJH sequence), strongly suggesting, within the limits of our pool of sequences, that there was no obvious bias in favor of specific recombination products. Together, the three assays allowed us to conclude that the qPCR products are genuine products of V(D)J recombination. In order to validate the qPCR-based V(D)J recombination assay, we quantified DH JH and VH DH JH recombination events in pro-B cells from a mutant mouse line in which a methylated sequence was inserted upstream of E enhancer. FACS analyses of the bone marrows showed a block at the pro-B cell stage (with ∼15% proB/∼6% pre-B cells in the mutant mice versus ∼7% pro-B/∼18% pre-B cells in WT controls) (Chemin et al., in preparation). As controls, we included genomic DNAs from pro-B cells of Rag2-deficient mice (which are unable to initiate V(D)J recombination) and from the kidney of WT mice (which could be minimally contaminated by circulating B cells). As seen in Fig. 3, no amplification could be detected
F.-Z. Braikia et al. / Immunology Letters 162 (2014) 119–123
123
Fig. 3. Quantification of DH JH and VH DH JH recombination events in pro-B cells from WT and a mutant mouse line with a block at the pro-B cell stage. Genomic DNAs from Rag2-deficient pro-B cells and from a WT kidney were used as negative controls.
in the controls. In contrast, an accumulation for the DH JH segments (∼2-fold) and a 4- to 5-fold reduction of pVH DH JH segments and of dVH DH JH segments were seen in the mutant mice compared to WT controls (Fig. 3, and data not shown). 4. Conclusion In conclusion, we have developed a real-time PCR assay to quantify DH JH and VH DH JH recombination events at the mouse IgH locus. This technique could, in principle, be extended to other antigen receptor loci, and be adapted to chromosomal translocations associated with V(D)J recombination. Conflict of interest The authors declare that they have no conflict of interest. Acknowledgments We thank the IPBS animal facility staff and F. L’Faqihi/V. Duplan-Eche at the Purpan CPTP plate-forms respectively, for their excellent work. This work was funded by ARC (Grant
SFI20101201441), ANR (ANR-07-BLAN-0080-03), INCa (PLBIO11181), LCC – Comité de Haute-Garonne, and Cancéropôle GSO. Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at http://dx.doi.org/10.1016/j.imlet. 2014.08.002. References [1] Jung D, Giallourakis C, Mostoslavsky R, Alt FW. Mechanism and control of V(D)J recombination at the immunoglobulin heavy chain locus. Annu Rev Immunol 2006;24:541–70. [2] Schatz DG, Ji Y. Recombination centres and the orchestration of V(D)J recombination. Nat Rev Immunol 2011;11:251–63. [3] Johnston CM, Wood AL, Bolland DJ, Corcoran AE. Complete sequence assembly and characterization of the C57BL/6 mouse Ig heavy chain V region. J Immunol 2006;176:4221–34. [4] Retter I, Chevillard C, Scharfe M, Conrad A, Hafner M, Im TH, et al. Sequence and characterization of the Ig heavy chain constant and partial variable region of the mouse strain 129S1. J Immunol 2007;179:2419–27. [5] Perlot T, Alt FW, Bassing CH, Suh H, Pinaud E. Elucidation of IgH intronic enhancer functions via germ-line deletion. Proc Natl Acad Sci USA 2005;102: 14362–7.
Contents lists available at ScienceDirect
Immunology Letters journal homepage: www.elsevier.com/locate/immlet
Quantification of V(D)J recombination by real-time quantitative PCR Fatima-Zohra Braikia a,b , Guillaume Chemin a,b , Mohammed Moutahir a,b , Ahmed Amine Khamlichi a,b,∗ a b
CNRS UMR 5089; IPBS (Institut de Pharmacologie et de Biologie Structurale); FRBT, 205 route de Narbonne, BP 64182, F-31077 Toulouse, France Université de Toulouse; UPS; IPBS F-31077 Toulouse, France
a r t i c l e
i n f o
Article history: Received 23 May 2014 Received in revised form 30 July 2014 Accepted 3 August 2014 Available online 12 August 2014 Keywords: B lymphocyte IgH locus V(D)J recombination Real-time quantitative PCR
a b s t r a c t B and T lymphocytes have the unique capacity to somatically rearrange their antigen receptor loci through V(D)J recombination. D-JH and VH -DJH recombination events are usually visualized by semi-quantitative PCR followed by detection of end products, which is time consuming and requires the use of hazardous elements. Additionally, it necessitates relatively large amounts of genomic DNA which could be limiting when the cell populations of interest are rare. Here, we describe a real-time quantitative PCR assay for a fast quantification of V(D)J recombination events at the IgH locus. © 2014 Elsevier B.V. All rights reserved.
1. Introduction Early B and T lymphocytes have the unique capacity to somatically rearrange their antigen receptor loci in a cell-type and developmental-stage specific manner through V(D)J recombination. This process is initiated by a lymphoid-specific recombinase complex, RAG1/RAG2, that recognizes conserved recombination signal sequences flanking variable (V), diversity (D), and joining (J) gene segments in the variable domain of antigen receptor loci, and involves an ordered rearrangement of V, (D) and J gene segments [1,2]. The mouse immunoglobulin heavy chain (IgH) locus spans some 3 megabases and is composed of more than 150 VH genes (spanning ∼2.5 Mb), divided into domain-organized gene families, including the distal VH and the proximal VH family, a dozen of DH segments, four JH segments, and eight constant genes [3,4]. The IgH locus is the site of two recombination events: D-JH recombination occurs on both IgH alleles before the initiation of VH -DJH joining on one of the IgH alleles [1]. D-JH and VH -DJH recombination events are usually visualized by semi-quantitative PCR followed by Southern blot- or dye-based quantifications, which are time consuming and eventually make use of hazardous elements. Classical semi-quantitative PCR also
∗ Corresponding author at: CNRS UMR 5089-IPBS, 205 route de Narbonne, 31077 Toulouse Cedex, France. Tel.: +33 561 175 522; fax: +33 561 175 997. E-mail address: [email protected] (A.A. Khamlichi). http://dx.doi.org/10.1016/j.imlet.2014.08.002 0165-2478/© 2014 Elsevier B.V. All rights reserved.
requires relatively large amounts of genomic DNA which could be limiting if the starting cell population is rare. Additionally, subtle differences in the frequency of V(D)J recombination may be overlooked or biased by these approaches as they rely on end-products of the PCR. Moreover, the use of a backward primer downstream of the JH cluster favors amplification of shorter DH JH and VH DH JH amplicons. Finally, this approach could be laborious when comparing various genotypes. In an attempt to overcome these shortcomings, we developed a real-time quantitative PCR assay for a fast and unbiased quantification of V(D)J recombination events at the IgH locus.
2. Materials and methods Mice. The experiments on mice have been carried out according to the CNRS Ethical guidelines and approved by the Regional Ethical Committee. The generation and phenotypic analysis of the mutant mouse line are described in detail elsewhere (Chemin et al., in preparation). In this knock-in mouse line, an ∼2.6 kb CpG-rich sequence was inserted between the E enhancer and the JH cluster. Antibodies. PE-conjugated anti-CD43 and FITC-conjugated anti were purchased from BD-Pharmingen. APC-conjugated anti-B220 was from BioLegend. Purification of pro-B cells. Single cell suspensions from the bone marrow of 6- to 8-week-old mice were prepared by standard techniques. Pro-B cells were sorted by using CD19-magnetic microbeads and LS columns (Miltenyi), labeled with anti-B220,
120
F.-Z. Braikia et al. / Immunology Letters 162 (2014) 119–123
anti-CD43, and anti-, and sorted as B220+ − CD43high fraction. The purity of the sorted population was checked by FACS. Primers. The primers are listed in Table 1. All the primers were designed for this study except for DHL-Fw, VH7183-Fw and VHJ558-Fw primers which were from Perlot et al. [5]. Standard curves. Genomic DNA (gDNA) from the sorted pro-B cell population was prepared by standard techniques, and diluted for the qPCR assays. 30 ng of gDNA or 3-fold dilutions thereof were analyzed as described below for DH -JH and VH -DH JH recombination by qPCR at the optimal temperature using the primers listed in Table 1. In order to keep the total amount of DNA (30 ng) constant,
appropriate amounts of gDNA from Rag2-deficient pro-B cells were added to the dilution samples. A negative control without gDNA was included. Real-time PCR. All the qPCRs were performed on a CFX-96 thermal cycler (Bio-Rad), using the SsoFast EvaGreen Supermix kit (Bio-Rad). We usually used 10 ng of gDNA in a final volume of 10 l. The qPCR program was as follows: denaturation at 98 ◦ C for 30 s, annealing and polymerization at the appropriate hybridization temperature (see Table 1), for 10 s. This cycle was repeated 40 times. For the melting (or dissociation) curve, the increment was 0.5 ◦ C/10 s between 65 ◦ C and 95 ◦ C. HS5 sequence was used for normalization.
Fig. 1. (A) A scheme of the IgH locus in its germline (GL), pre-rearranged configuration. E enhancer and the 3 regulatory region (3 RR) which control the locus expression are shown. The distal and the proximal VH gene families are illustrated by one segment only, J558 for the distal VH family and 7183 for the proximal VH family. The HS5 sequence used for normalization is located downstream of the IgH locus. The approximate sizes of the VH , DH -JH and the constant domains are indicated. (B). Pro-B cells from WT bone marrows were sorted as B220+ CD43high − (P7 window in the upper panel) and checked for purity by FACS (P8 square in the bottom panel). At least 97% pure pro-B cells were consistently obtained. (C) Determination of the standard curve by using triplicates of a series of 3-fold dilutions of gDNA (from sorted WT pro-B cells) as a template, starting with 30 ng of gDNA. This amount was kept constant by completing with the relevant amount of Rag2−/− gDNA to the dilution samples. The relative position of the primers is indicated in the upper scheme. For each primer combination, the upper panel shows the standard curve of the primer pair used to quantify DH JH segments. The bottom shows the post-amplification melting curve which was established by increasing the temperature of the reaction (0.5 ◦ C/10 s between 65 ◦ C and 95 ◦ C). (D) Upper and bottom panels are as in (C), the upper panels correspond to the primer pairs amplifying pVH DH JH segments. (E) Upper and bottom panels are as in (C), the upper panels correspond to the primer pairs amplifying dVH DH JH segments.
F.-Z. Braikia et al. / Immunology Letters 162 (2014) 119–123
121
Fig. 1. (A)(Continued.)
Agarose gel electrophoresis. The qPCR products were visualized by ethidium bromide on standard 1.5% agarose gels. Sequencing of V(D)J amplicons. The qPCR products were purified by using the QIAquick PCR purification kit (Qiagen) and cloned into pCR2.1-TOPO (InVitrogen) for sequencing.
3. Results and discussion We designed reverse primers that specifically pair downstream of each JH segment of the IgH locus (Table 1). Consequently, realtime quantitative PCRs (qPCRs) are performed in parallel to amplify
Table 1 The sequences of the primers used, the recombination step they amplify, their hybridization temperature, efficiency and correlation coefficients (R2 ) are indicated. Forward primers
Reverse primers
Recombination
Hybridization (◦ C)
Efficiency (%)
R2
DH -JH recombination DHL-Fw: TTTTTGTCAAGGGATCTACTACTGTG DHL-Fw: TTTTTGTCAAGGGATCTACTACTGTG DHL-Fw: TTTTTGTCAAGGGATCTACTACTGTG DHL-Fw: TTTTTGTCAAGGGATCTACTACTGTG
JH1R: GACTGCCTCTTTTCCTGGGAGTG JH2R4: TAGACCCCTGACAATAAATGA JH3R1: CGATAGACCCTGGACAAGATTC JH4R2: TATTTCCCAACTTCTCTCAGCC
DH -JH1 DH -JH2 DH -JH3 DH -JH4
60.0 61.0 61.0 61.0
87.9 85.4 106.5 106.5
0.988 0.992 0.984 0.985
pVH -DH JH recombination VH7183-Fw: GCGAAGCTTGTGGAGTCTGGGGGAGGCTTA VH7183-Fw: GCGAAGCTTGTGGAGTCTGGGGGAGGCTTA VH7183-Fw: GCGAAGCTTGTGGAGTCTGGGGGAGGCTTA VH7183-Fw: GCGAAGCTTGTGGAGTCTGGGGGAGGCTTA
JH1R: GACTGCCTCTTTTCCTGGGAGTG JH2R1: CTGAGGAGACTGTGAGAGTGGTG JH3R5: CAGTTCTAATGTCACCACAGACC JH4R1: CTGAGGAGACGGTGACTGAGGT
pVH -DH JH1 pVH -DH JH2 pVH -DH JH3 pVH -DH JH4
60.0 60.5 60.0 60.5
120.0 90.1 92.6 88.5
0.981 0.986 0.991 0.986
dVH -DH JH recombination VHJ558-Fw: GCGAAGCTTARGCCTGGGRCTTCAGTGAAG VHJ558-Fw: GCGAAGCTTARGCCTGGGRCTTCAGTGAAG VHJ558-Fw: GCGAAGCTTARGCCTGGGRCTTCAGTGAAG VHJ558-Fw: GCGAAGCTTARGCCTGGGRCTTCAGTGAAG
JH1R: GACTGCCTCTTTTCCTGGGAGTG JH2R1: CTGAGGAGACTGTGAGAGTGGTG JH3R5: CAGTTCTAATGTCACCACAGACC JH4R1: CTGAGGAGACGGTGACTGAGGT
dVH -DH JH1 dVH -DH JH2 dVH -DH JH3 dVH -DH JH4
60.0 60.5 61.5 60.5
103.6 96.0 90.7 87.7
0.996 0.991 0.995 0.995
Normalization HS5-Fw1: ACTCAAGGGTTAAGAGCACTGGCT
HS5-R1: AATCCTTCAGGGCATCCTGGAACT
63.0
98.0
0.986
122
F.-Z. Braikia et al. / Immunology Letters 162 (2014) 119–123
Fig. 2. (A) Analysis of qPCR products by gel electrophoresis. Genomic DNA purified from sorted pro-B cells was subjected to qPCR for amplification of DH JH and VH -DH JH recombination events by using appropriate primer pairs, and the qPCR products run on a standard agarose gel. The prominent bands of the right size corresponding to the amplified DH JH1 , pVH DH JH4 and dVH DH JH4 segments are shown here as an example. HS5 sequence was used for normalization. Two aliquots from two independent experiments are shown. (B) Sequence analysis of the qPCR products. Amplicons were cloned and sequenced (∼10 sequences for each recombined segment). Examples of the sequences obtained for DH JH segments and the distal (dVH ) dVH DH JH (involving distal dVH gene segment) are displayed. The clonality of the sequences was based on sequence diversity at DH -JH joints and VH -DH -JH joints. Therefore, sequences with identical nucleotide additions and/or deletions were considered as one sequence. For dVH DH JH segments, only sequences in which the DH segment could be unambiguously identified (underlined) are shown. The DH segments involved in DH JH and dVH DH JH recombination are indicated between brackets. The 5 sequence of germline (GL) JH1 and JH4 are indicated in italics.
recombination events involving each JH segment. For VH and DH segments, we used degenerate primers known to pair with all the DH segments or with either the proximal or the distal familyspecific VH segments of the IgH locus (Fig. 1A and Table 1). As a control, we amplified HS5 sequence located downstream of the IgH locus, which is not targeted by V(D)J recombination (Fig. 1A). All the assays were performed on genomic DNAs prepared from sorted pro-B cells (Fig. 1B) since DH -JH and VH -DH JH recombination steps occur at this developmental stage. A temperature gradient was first performed for each primer pair in order to identify the annealing temperature yielding a single PCR product (not shown). We next determined the standard curve at the optimal temperature by using serial dilutions of genomic DNA. To keep the final concentration of gDNA constant in the dilution samples, appropriate amount of gDNA from Rag2-deficient pro-B cells was added. Examples of the standard curves obtained with primer pairs that amplify DH JH and VH DH JH segments are shown in Fig. 1C–E. Of note, effecting serial dilutions without keeping the total amount of gDNA constant in the dilution samples (thus adding water instead of Rag2−/− gDNA) did not affect the efficiency of the reaction (Fig. S1). To check that the amplicons are genuine products of DH -JH and VH -DH JH recombination events, we performed three assays. (1) We performed a melting curve analysis by increasing the temperature after completion of the PCR. A single peak was found for each set
of primer pairs indicating the presence of a single PCR product (Fig. 1C–E), and excluding primer-dimer contaminations. (2) The qPCR products were also checked by gel electrophoresis. A single band of the expected size was prominently detected for DH JH and VH DH JH segments as illustrated in Fig. 2A (top panels). (3) The amplicons were then sequenced and checked for their clonality based on sequence diversity at the DH JH and VH DH JH junctions (Fig. 2B, bottom panel). Interestingly, among a total of 80 sequences, only two sequences displayed identical N elements at their junction (and therefore counted as one VH DJH sequence), strongly suggesting, within the limits of our pool of sequences, that there was no obvious bias in favor of specific recombination products. Together, the three assays allowed us to conclude that the qPCR products are genuine products of V(D)J recombination. In order to validate the qPCR-based V(D)J recombination assay, we quantified DH JH and VH DH JH recombination events in pro-B cells from a mutant mouse line in which a methylated sequence was inserted upstream of E enhancer. FACS analyses of the bone marrows showed a block at the pro-B cell stage (with ∼15% proB/∼6% pre-B cells in the mutant mice versus ∼7% pro-B/∼18% pre-B cells in WT controls) (Chemin et al., in preparation). As controls, we included genomic DNAs from pro-B cells of Rag2-deficient mice (which are unable to initiate V(D)J recombination) and from the kidney of WT mice (which could be minimally contaminated by circulating B cells). As seen in Fig. 3, no amplification could be detected
F.-Z. Braikia et al. / Immunology Letters 162 (2014) 119–123
123
Fig. 3. Quantification of DH JH and VH DH JH recombination events in pro-B cells from WT and a mutant mouse line with a block at the pro-B cell stage. Genomic DNAs from Rag2-deficient pro-B cells and from a WT kidney were used as negative controls.
in the controls. In contrast, an accumulation for the DH JH segments (∼2-fold) and a 4- to 5-fold reduction of pVH DH JH segments and of dVH DH JH segments were seen in the mutant mice compared to WT controls (Fig. 3, and data not shown). 4. Conclusion In conclusion, we have developed a real-time PCR assay to quantify DH JH and VH DH JH recombination events at the mouse IgH locus. This technique could, in principle, be extended to other antigen receptor loci, and be adapted to chromosomal translocations associated with V(D)J recombination. Conflict of interest The authors declare that they have no conflict of interest. Acknowledgments We thank the IPBS animal facility staff and F. L’Faqihi/V. Duplan-Eche at the Purpan CPTP plate-forms respectively, for their excellent work. This work was funded by ARC (Grant
SFI20101201441), ANR (ANR-07-BLAN-0080-03), INCa (PLBIO11181), LCC – Comité de Haute-Garonne, and Cancéropôle GSO. Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at http://dx.doi.org/10.1016/j.imlet. 2014.08.002. References [1] Jung D, Giallourakis C, Mostoslavsky R, Alt FW. Mechanism and control of V(D)J recombination at the immunoglobulin heavy chain locus. Annu Rev Immunol 2006;24:541–70. [2] Schatz DG, Ji Y. Recombination centres and the orchestration of V(D)J recombination. Nat Rev Immunol 2011;11:251–63. [3] Johnston CM, Wood AL, Bolland DJ, Corcoran AE. Complete sequence assembly and characterization of the C57BL/6 mouse Ig heavy chain V region. J Immunol 2006;176:4221–34. [4] Retter I, Chevillard C, Scharfe M, Conrad A, Hafner M, Im TH, et al. Sequence and characterization of the Ig heavy chain constant and partial variable region of the mouse strain 129S1. J Immunol 2007;179:2419–27. [5] Perlot T, Alt FW, Bassing CH, Suh H, Pinaud E. Elucidation of IgH intronic enhancer functions via germ-line deletion. Proc Natl Acad Sci USA 2005;102: 14362–7.
