Journal of Microbiological Methods 100 (2014) 121–127
Contents lists available at ScienceDirect
Journal of Microbiological Methods journal homepage: www.elsevier.com/locate/jmicmeth
Qualitative detection of class IIa bacteriocinogenic lactic acid bacteria from traditional Chinese fermented food using a YGNGV-motif-based assay Wenli Liu a, Lanwei Zhang a,⁎, Huaxi Yi a, John Shi b, Chaohui Xue a, Hongbo Li a, Yuehua Jiao a, Nditange Shigwedha a, Ming Du a, Xue Han a a b
School of Food Science & Technology, Harbin Institute of Technology, 73 HuangHe Avenue, Harbin, Heilongjiang 150090, China Guelph Food Research Centre, Agriculture and Agri-Food Canada, Guelph, Ontario N1G5C9, Canada
a r t i c l e
i n f o
Article history: Received 21 February 2014 Accepted 4 March 2014 Available online 26 March 2014 Keywords: Agar well Class IIa bacteriocin Lactic acid bacteria PCR YGNGV-motif-based assay
a b s t r a c t In the present study, a YGNGV-motif-based assay was developed and applied. Given that there is an increasing demand for natural preservatives, we set out to obtain lactic acid bacteria (LAB) that produce bacteriocins against Gram-positive and Gram-negative bacteria. We here isolated 123 LAB strains from 5 types of traditional Chinese fermented food and screened them for the production of bacteriocins using the agar well diffusion assay (AWDA). Then, to acquire LAB producing class IIa bacteriocins, we used a YGNGV-motif-based assay that was based on 14 degenerate primers matching all class IIa bacteriocin-encoding genes currently deposited in NCBI. Eight of the LAB strains identified by AWDA could inhibit Gram-positive and Gram-negative bacteria; 5 of these were YGNGV-amplicon positive. Among these 5 isolates, amplicons from 2 strains (Y31 and Y33) matched class IIa bacteriocin genes. Strain Y31 demonstrated the highest inhibitory activity and the best match to a class IIa bacteriocin gene in NCBI, and was identified as Enterococcus faecium. The bacteriocin from Enterococcus avium Y33 was 100% identical to enterocin P. Both of these strains produced bacteriocins with strong antimicrobial activity against Listeria monocytogenes, Escherichia coli, and Bacillus subtilis, hence these bacteriocins hold promise as potential bio-preservatives in the food industry. These findings also indicated that the YGNGV-motif-based assay used in this study could identify novel class IIa bacteriocinogenic LAB, rapidly and specifically, saving time and labour by by-passing multiple separation and purification steps. © 2014 Elsevier B.V. All rights reserved.
1. Introduction Consumers express concern about the safety of chemical preservatives in foods that may negatively impact their health (Falguni et al., 2010); thus, there is an increasing demand for natural preservatives. Biopreservation refers to the use of antagonistic microorganisms or their metabolic products to enhance food safety and extend shelf life. Traditionally, lactic acid bacteria (LAB) that produce bacteriocins have been applied to food and animal feed as a natural biopreservative (Kouakou et al., 2010; Lee et al., 2013; Voulgari et al., 2010). The preserving effect of LAB (e.g., Lactococcus, Lactobacillus, Leuconostoc, and Pediococcus) in food is mainly due to the generation of some metabolites, i.e., organic acids (lactic and acetic acids), hydrogen peroxide,
⁎ Corresponding author. Tel.: +86 451 86282908; fax: +86 451 86282907. E-mail address: [email protected] (L. Zhang).
http://dx.doi.org/10.1016/j.mimet.2014.03.006 0167-7012/© 2014 Elsevier B.V. All rights reserved.
diacetyl, bacteriocins, and bacteriocin-like inhibitory substances (BLIS) by these bacteria (De Vuyst and Vandamme, 1994; Gilliland, 1985; Paul Ross et al., 2002). Bacteriocins are defined as ribosomally synthesized antimicrobial peptides that are usually active against closely related microorganisms (Birri et al., 2010). Several bacteriocins produced by LAB display a wide spectrum of antagonistic activity (Aunpad and Na-Bangchang, 2007; Lemos Miguel et al., 2008). Moreover, the bacteriocins from LAB can inhibit foodborne pathogenic and spoilage bacteria and have attracted considerable attention in the field of food preservation (Pimentel-Filho et al., 2014; Zouhir et al., 2010). Based on their molecular structure, bacteriocins have been grouped into four classes: (i) class I bacteriocins are lantibiotics (molecular weight ≤ 5 kDa); these small peptides contain lanthionine and/or Lmethyl-lanthionine residues (Eijsink et al., 2002; Nes et al., 1996); (ii) class II bacteriocins are known as non-modified heat-stable bacteriocins, of a molecular weight ≤ 10 kDa (Eijsink et al., 2002; Nes and Holo, 2000); (iii) class III bacteriocins are proteins ≥ 10 kDa (Eijsink
122
W. Liu et al. / Journal of Microbiological Methods 100 (2014) 121–127
Fig. 1. Sequence alignment of class IIa bacteriocins, showing the conserved sites in colour, was performed using CLUSTALW2 software (http://www.ebi.ac.uk/Tools/phylogeny/clustalw2_ phylogeny/).
et al., 2002); and (iv) class IV bacteriocins are large, complex molecules containing carbohydrate or lipid groups (Joerger and Klaenhammer, 1990). To date, the class II bacteriocins are divided into six subclasses, viz. class IIa, class IIb, class IIc, class IId, class IIe, and class IIf (Van Belkum and Stiles, 2000). Class IIa bacteriocins have strong antibacterial activity against Listeria monocytogenes and contain a conserved YGNGVXCXXXXCXV sequence motif at their N-terminus (Fig. 1) (Eijsink et al., 1998). This class has attracted particular attention because of their unique characteristics and potential superiority for use as biopreservatives due to its antibacterial activity against L. monocytogenes which is a common food pathogen (O'sullivan et al., 2002). At present, some methods for screening of class IIa bacteriocin-producing LAB have been developed, including the agar well diffusion assay (AWDA) (Jacobsen et al., 1999; Schillinger and Lücke, 1989), the agar spot test (Todoriki et al., 2001), a microplate assay (Eijsink et al., 1998), flow cytometry assay (Budde and Rasch, 2001; Nuding et al., 2006), a fluorescence resonance energy transfer method based on pH control (Kim and Cha, 2006), and a bioluminometric method (Simon et al., 2001; Valat et al., 2003; Virolainen et al., 2008). However, these methods are time-consuming and laborious, and cannot verify the existence of class IIa bacteriocin directly. In order to improve on these screening methods and acquire class IIa bacteriocins against Gram-positive and Gram-negative bacteria, previous studies have employed a traditional agar well diffusion assay and PCR assay (Macwana and Muriana, 2012; Suwanjinda et al., 2007; Więckowicz et al., 2011; Yi et al., 2010); the results showed that this approach was specific and efficient, but had some limitations. With the development of a modern economy and industrial and technological advances, fewer of the ethnic minorities of China engage in a nomadic life-style. Consequently, the rich microbial resources of traditional Chinese fermented products could soon be lost. Therefore, the aim of this study was to obtain novel class IIa bacteriocinogenic LAB from traditional Chinese fermented food in order to develop microbial resources from these products as a matter of urgency. In this study, we retained and improved the previously reported PCR-based assay; however, the primers developed here were designed according to the sequence alignment of all class IIa bacteriocin-encoding genes in the National Center for Biotechnology Information (NCBI) database and contained the binding sites located within the prebacteriocin-coding region. Moreover, the amplicon sizes in this study were 80–200 bp, which avoided difficulties inherent to amplification of large fragments by PCR, and the annealing temperature was 49–56 °C, which prevented
generation of false positives due to a low annealing temperature. The accuracy of our results was verified by sequencing. 2. Materials and methods 2.1. Strains and growth conditions One hundred and twenty-three LAB were isolated from 5 types of Chinese traditional fermentation foods (kumiss made by the Kazakh herdsmen from Xinjiang, yak yoghurt made by herdsman from the Tibetan Autonomous Prefecture in Qinghai, fermented vegetable juice from Lanzhou, yak yoghourt made by the herdsman from the Subei Mongol Autonomous County in Gansu province, and yak yoghourt made by herdsman from Gannan Tibetan Autonomous Prefecture in Gansu province). The samples were serially diluted in sterile 0.9% (w/v) NaCl solution, plated onto De Man, Rogosa, and Sharpe (MRS) agar, and incubated at 37 °C for 48 h. Colonies with LAB characteristics were isolated and purified using the streak plate method. Purified strains were preliminary identified as coccus, bacilli, and bifidobacteria by Gram-staining, the catalase test, fructose-6-phosphate ketone Table 1 Bacterial strains used in this study. Micro-organism
Collection
Medium
Bacteriocin-producing strains used as reference Lactobacillus plantarum
ATCC14917
MRS
Indicators Listeria monocytogenes Escherichia coli Bacillus subtilis
ATCC19111 ATCC 25922 ATCC 6633
BHI TSA TSA
Potential bacteriocin producer Enterococcus faecium Y31 Enterococcus avium Y33 Streptococcus thermophilus SP1.1 Weissella viridescens IN3521 Streptococcus thermophilus 94.3
Own collection Own collection Own collection Own collection Own collection
MRS MRS MRS MRS MRS
Shenggong, Shanghai, China
LB
Escherichia coli strain used for cloning Escherichia coli DH5a
ATCC, American Type Culture Collection (Rockville, MD, USA). Own, Institute of Food Science and Technology (Harbin Institute Technology, China).
W. Liu et al. / Journal of Microbiological Methods 100 (2014) 121–127
123
Table 2 Sequences of the degenerate oligodeoxyribonucleotide primers used for PCR amplification of class IIa bacteriocin-encoding genes. Oligonucleotide designation
Sequence (5′ to 3′)
Tm (°C)
Length (bp)
Product (bp)
Annealing temperature (°C)
Targeted bacteriocins
Clade1-1F
TGGGGTAAGGCTACCACT TG CCCTTTATTGATGCCAGCTC ATGGGGTTACTTGTGGCA AA CCCTTTATTGATGCCAGCTC AGTGGGAACTAGAATAAGC CAGTCAACAGAGCAGGA TTGTCTAGCTGGCATCGGTA GGACCATGATTAACCCAA CC GCTGGGTTAACTGGGGAGA ATGTCCCATACCTGCCAAAC CGCGTTCATATGGTAATG GT ATGTCCCATACCTGCCAAAC ATTGGGCCAAGGCAACTA CT TTCATGAACAATTTGCTTAG CATT TGGAAAATATTATGGAAA TGGAGTG CCTGGAATTGCTCCACCTAA GAGACACAACTTATCTAT GGGGGTA CCTGGAATTGCTCCACCTAA GGAAATTTAAATGCGCTG GA TTTCCGGAACGAGACTTTTG ACAACCCACGAGGAACTG AC TGATTTCAGCCATTGTTTGG GCAAATTATCGCGAATAC GA GCGGTTATCCTCAATTTCCA CGGTGTACACTGTGGAAA ACAT TTTATTCCAGCCAGCGTTTC GCTTCGCTGGCTTATTTACG AGCTTGAATCGCCTTCGTT
55
20
113
49
Bacteriocin 423, pediocin AcH, sakacin, leucocin A, mesentericin Y105
50 60.23
20 20
151
56
59.67 45.9 45.1 59.44 58.96
20 19 17 20 20
165
42
156
55
Bacteriocin MC4-1, hiracin JM79
60.06 59.68 58.39
19 20 20
86
56
Carnobacteriocin B2, carnobacteriocin BM1, enterocin P
128
55
59.68 60.88
20 20
114
56
60.03
24
60.30
25
123
56
60.07 59.70
20 25
158
56
60.07 60.04
20 20
153
56
60.22 60.01
20 20
91
56
59.52 58.79
20 20
145
55
59.90 59.82
20 20
115
56
60.21 60.01 59.97
20 20 19
114
56
Clade1-1R Clade1-2F Clade1-2R Clade1-3F Clade1-3R Clade2F Clade2R Clade3-1F Clade3-1R Clade3-2F Clade3-2R Clade4-1F Clade4-1R Clade4-2F Clade4-2R Clade4-3F Clade4-3R Clade5-1F Clade5-1R Clade5-2F Clade5-2R Clade5-3F Clade5-3R Clade5-4F Clade5-4R Clade5-5F Clade5-5R
enzyme phosphate test, microscopy, and the morphology and structure of the colony and individual bacteria. All presumptive LAB were assayed for antimicrobial activity. L. monocytogenes ATCC19111, Escherichia coli ATCC 25922, and Bacillus subtilis ATCC 6633 were used as indicator strains. All LAB were cultured at 37 °C in MRS broth without agitation. E. coli ATCC 25922 and B. subtilis ATCC 6633 were cultured in tryptic soy broth (TSB) or tryptic soy agar (TSA), containing 0.3% soya peptone (Aoboxing, Beijing, China), 1.7% tryptone (Oxoid LTD., Basingstoke,
Sakacin A, divercin V41, enterocin A
Enterocin CRL35, mundticin KS, Sakacin X, piscicolin 126, Sakacin P (formerly bavaricin A)
England), 0.25% glucose, 0.5% NaCl, and 0.25% K2HPO4 (pH 7.3), with agitation. L. monocytogenes ATCC19111 was grown in brain heart infusion broth (BHI) or brain heart infusion agar (BHIA) (Hope Biotech, Qingdao, China). All strains were stored in media in the presence of 20% glycerol (v/v) at −80 °C. E. coli DH5α (Shenggong, Shanghai, China) was grown at 37 °C in Luria–Bertani (LB) medium. LB-amp-agar plates (1.5% agar, containing 50 μL/mL of ampicillin; Sigma) with X-Gal (4 μL/mL) and IPTG (Sigma) were used to select DH5α transformant cells containing the
Table 3 Antimicrobial activity of lactic acid bacterial strains assessed in this study. Strains
ATCC14917 Y31 Y33 Sp1.1 94.3 IN3521 IN3821 IN3922 IN3423
Indicator strains Listeria monocytogenes ATCC19111
Escherichia coli ATCC 25922
Bacillus subtilis ATCC 6633
+ ++ ++ ++ ++ ++ ++ + ++
+ ++ + + + + ++ +++ ++
+ +++ +++ +++ +++ +++ ++ +++ +++
Mean values (n = 3) for each experiment. ++ = inhibition zone diameter up to 4 mm. +++ = inhibition zone diameter over 6 mm. + = inhibition zone diameter up to 2 mm. Inhibition zone diameter did not include Oxford cup diameter.
124
W. Liu et al. / Journal of Microbiological Methods 100 (2014) 121–127
of LAB strains was eliminated by adjusting the pH value of the CFSs to 6.0 with 4 M NaOH. The MRS broth (adjusted to pH 6.0 with 4 M NaOH), the CFSs of Lactobacillus plantarum ATCC14917 (adjusted to pH 6.0 with 4 M NaOH), and either lactic acid or acetic acid (pH 6.0) were used as controls. Catalase (50 U/mL, Sigma) was added to the CFSs (adjusted to pH 6.0 with 4 M NaOH), and incubated at 37 °C for 12 h, to eliminate the effect of hydrogen peroxide, CFSs without catalase and L. plantarum ATCC14917 with catalase were used as controls (Gurban oglu Gulahmadov et al., 2006). Bacteriocin activity was expressed as the diameter of zone of inhibition (not including the well) which was measured by a vernier caliper. Strains with the largest zones of inhibition were selected for the following studies. To determine the possible protein nature of the above detected antimicrobial substances, the CFSs (pH 6.0, with catalase) were respectively incubated at 37 °C overnight with pepsin (Sigma), trypsin (Sigma) or protease K (Sigma) at a final concentration of 3 mg/mL individually. CFSs without enzyme treatment and L. plantarum ATCC14917-fermented supernatants with enzyme treatment were used as controls. Diameters of inhibition zones were measured using L. monocytogenes ATCC19111, E. coli ATCC 25922, and B. subtilis ATCC 6633 as indicators (Gao et al., 2010). 2.3. Multiple sequence alignment of class IIa bacteriocin-coding genes and primer design
Fig. 2. PCR amplification of bacteriocin-encoding genes from lactic acid bacteria. a. Agarose gel electrophoresis of PCR fragments from strains ATCC14917, IN3521, SP1.1, 94.3, Y31, and Y33 generated with primer set Clade4-2F/Clade4-2R. Lane M: 50-bp ladder marker, lane 1: ATCC 14917, lane 2: IN 3521, lane 3: SP1.1, lane 4: 94.3, lane 5: Y31, lane 6: Y33, and lane 7: negative control. b. Agarose gel electrophoresis of PCR fragments from strains ATCC14917, IN3521, SP1.1, 94.3, Y31, and Y33 amplified using primer set Clade4-3F/ Clade4-3R. Lane M: 50-bp ladder marker, lane 1: IN3521, lane 2: Y31, lane 3: SP1.1, lane 4: 94.3, lane 5: ATCC14917, lane 6: Y33, and lane 7: negative control.
recombinant plasmid pUCm-T (Shenggong, Shanghai, China). All bacterial strains used in this study are shown in Table 1. 2.2. Screening bacteriocin-producing LAB active against Gram-positive and Gram-negative bacteria by AWDA The AWDA was used to assay the antibacterial activity of the cellfree supernatants (CFSs) of all LAB, as described by Gong et al. (2010), with some modification. Ten millilitres of 1.5% agar (Biotopped Science & Technology Co. Ltd., Beijing, China) was poured into a sterile plate as the first layer of a double-plate. The agar was allowed to dry. Later, Oxford-cups (6 mm in diameter) were put on the first agar layer. A second layer of semi-solid TSA medium (10 mL of 0.7% w/v) containing 200 μL of indicator strain cultured overnight was poured. The inoculated TSA soft agar was rapidly dispensed onto the agar plate and solidified on the Oxford-cups. BHIA was used instead of TSA for L. monocytogenes ATCC19111. The Oxford-cups were removed and wells (6 mm in diameter) were formed. After drying for 30 min in a laminar flow hood, each well was filled with 80 μL of CFS from LAB strains eliminating the effect of organic acid and hydrogen peroxide, and then incubated at 37 °C for 24 h. The influence of organic acid on the antimicrobial activity of CFSs
Nucleotide sequences of 44 bacteriocin-coding genes were obtained from NCBI (http://www.ncbi.nlm.nih.gov/). The phylogenetic relationships among class IIa bacteriocins were obtained using the neighbourjoining method with MEGA5 software, and the consistency of the data was tested by bootstrapping the alignments 1000 times. Using the multiple sequence alignment of the class IIa bacteriocin-coding genes, we manually designed the primers used in this study (Table 2). 2.4. Metagenomic DNA extraction of bacteriocin-producing LAB Total DNA was extracted using the Bacterial DNA kit (Omega Biotechnology, Norcross, USA) according to the manufacturer's instructions, with minor modifications. Briefly, after adding 20 μL of a 50 mg/mL lysozyme solution to the bacterial pellet, samples were centrifuged at 5000 ×g for 5 min. Then, 200 μL of DNA buffer, 40 mg of glass powder, and 25 μL protease K solution were added, and mixed by vortexing 4–5 times for a total time of 80 min. To recover DNA, samples were cleaned up using the HiBind® DNA Mini column, which was centrifuged at 13,000 ×g for 2 min. Thirty microliters of preheated (65 °C) elution buffer was then added to the column and the elution was repeated twice. 2.5. PCR amplification and cloning of bacteriocin-encoding genes from potential LAB Genomic DNA of the target bacteriocin-producing LAB was amplified in 25 μL reaction mixtures containing 10 × Taq Buffer (Fermentas International Inc. Ltd., Ontario, Canada), 10 mM of each deoxynucleoside triphosphates (dNTPs; TaKaRa Bio Inc., Shiga, Japan), 20 mM of each primer (Table 2), and 0.5 U of ExTaq polymerase (Fermentas). Two microliters of genomic DNA (100 ng/μL) was used as template.
Table 4 BLAST results of sequences of the amplified product of strain Y31. Accession number in GenBank
Protein
Identity (%)
Max score
E-value
ZP_06675109.1 ZP_06682229.1 ABI29856.1 ACI25619.1 ZP_19522307.1
Enterocin P precursor Enterocin P precursor Enterocin P protein EntP [Enterococcus mundtii] Bacteriocin enterocin-P
100 100 100 98 95
92.0 92.0 89.7 90.1 89.7
1e−2 5e−22 7e−22 8e−22 1e−21
W. Liu et al. / Journal of Microbiological Methods 100 (2014) 121–127
125
Table 5 BLAST results of sequences of the amplified product of strain Y33. Accession number in GenBank
Protein
Identity (%)
Max score
E-value
WP_002319312.1 WP_002291094.1 ABI29856.1 WP 021108959.1 ZP_19522307.1
Enterocin P precursor Bacteriocin enterocin-P Enterocin P protein Bacteriocin [Enterococcus faecium CRL 1879] EntP [Enterococcus mundtii]
100 100 100 98 98
92.0 92.0 89.7 90.5 90.1
2e−22 2e−22 8e−22 9e−22 1e−21
Amplification conditions were as follows: initial denaturation for 5 min at 94 °C, 30 cycles each consisting of denaturation for 45 s at 94 °C, annealing for 45 s at 49–56 °C (gradient), and elongation for 1 min at 72 °C, followed by a final extension step for 5 min at 72 °C. PCR was performed in a 2720 Thermal cycler (AB Applied Biosystems, Foster, Canada). The resulting fragments were subjected to agarose gel electrophoresis (2.5%) and were purified with the Omega Gel Extraction Kit (Omega Biotechnology) according to the instructions supplied by the manufacturer. Fragments were cloned into pUCm-T vector (Sangon Biotech Co. Ltd., Shanghai, China) as described by Sambrook and Russell (2001), then subjected to DNA sequencing analysis (Sangon Biotech Co. Ltd). Homologies of the obtained sequences were searched in the NCBI database using BLAST (http://blasr.ncbi.nih.gov/Blast.cgi). DNA ligase, restriction enzymes, and primers (are shown in Table 2) used were obtained from Sangon Biotech Co., Ltd. (Shanghai, China). 2.6. Strain identification Strains producing class IIa bacteriocin were determined using the API 20 STREP system or API 50 CHL system (bioMérieux, Marcy l'Etoile, France). The sugar fermentation pattern so obtained was analysed with the API Streptococcus or Lactobacillus Plus software (bioMérieux). The strains were identified up to species level by 16S rDNA sequence analysis. The 16S rDNA gene was amplified using genus-specific primers 5′-AGAGTTTGATCCTGGCTCAG-3′ and 5′-ACGGTTACCTTGTTACGACTT3′. The PCR products were then sequenced for the 16S rDNA (Sangon Biotech Co. Ltd., Shanghai, China). BLAST was used for homology searches in the databases (http://www.ncbi.nlm.nih.gov/BLAST). DNAMAN software (version 4.0) was used to obtain a bootstrap consensus tree (1000 copies) by multiple sequence alignment with the neighbour-joining method. 3. Results and discussion
strains. The CFSs (eliminating organic acid) of 14 strains had distinct antimicrobial activity against L. monocytogenes ATCC19111, E. coli ATCC 25922, and B. subtilis ATCC 6633. After catalase treatment, all 14 strains retained their antibacterial activity. When the CFSs of these 14 strains were treated with protease K, pepsin, and trypsin, the antibacterial activity of 8 strains was either decreased or abolished. The antimicrobial activities of these 8 LAB are shown in Table 3; L. plantarum ATCC14917, a strain previously reported as producing class IIa bacteriocin (Van Reenen et al., 2003), was used as a positive control. Generally, bacteriocins from lactic acid bacteria are regarded to have no antibacterial activity against Gram-negative bacteria (Kang and Lee, 2005). However, the Gram-negative strain E. coli ATCC 25922 was sensitive to bacteriocins produced by these eight LAB. Similar reports have showed that some bacteriocins produced by LAB, especially class II bacteriocins, could inhibit a limited number of Gram-negative bacteria. Bacteriocins bacST202Ch and bacST216Ch, produced by L. plantarum, have been reported to have antibacterial activity against E. coli and Salmonella spp. (Todorov et al., 2010). Sakacin C2, produced by Lactobacillus sake C2, has also been reported to inhibit the growth of Gram-negative bacteria E. coli ATCC 25922 (Gao et al., 2010). 3.2. Amplification of class IIa bacteriocin-encoding genes The bacteriocin-encoding genes of the 8 targeted LAB strains (Table 3) were amplified by PCR, using 14 pairs of primers (Table 2), to verify the class IIa bacteriocins produced by these strains. The results showed that primer sets Clade4-2F/Clade4-2R and Clade4-3F/Clade43R could amplify sequences from L. plantarum ATCC14917 and 5 of the targeted LAB strains at 56 °C, viz., IN3521, SP1.1, 94.3, Y31, and Y33 (Fig. 2a and b). The target product size of primer set Clade4-2F/ Clade4-2R was 123 bp, and strains ATCC14917, IN3521, SP1.1, 94.3, Y31, and Y33 yielded fragments between 120 bp and 140 bp. The target
The current screening process for class IIa bacteriocin-producing LAB strains includes screening for LAB that produce bacteriocins against L. monocytogenes, the extraction of crude protein, separation and purification of the bacteriocin, and determination of the N-terminal amino acid sequence. These procedures are costly in terms of manpower, materials, and time. The AWDA is a commonly used analytical approach, although the drawbacks of the method include a lack of specificity and limited sensitivity. The use of PCR using bacteriocin-specific primers has been reported repeatedly (Knoll et al., 2008; Suwanjinda et al., 2007; Więckowicz et al., 2011; Yi et al., 2010); however, until now this approach has not been used for screening class IIa bacteriocins against Gram-negative bacteria. In order to develop a rapid, facile, and accurate screening method, we here combined the microbiological screening method (AWDA) with the YGNGV-motif-based assay in order to obtain LAB strains that produce class IIa bacteriocins against Gram-positive and Gram-negative bacteria. 3.1. Screening bacteriocin-producing LAB by AWDA In this study, we used AWDA to obtain LAB that produce bacteriocin against Gram-positive and Gram-negative bacteria; 123 LAB were detected that produced antimicrobial peptides against different indicator
Fig. 3. PCR amplification of 16S rDNA genes from bacteriocin-producing lactic acid bacteria. Agarose gel electrophoresis of PCR fragments from strains SP1.1, 94.3, IN 3521, Y31, and Y33 generated with 16S rDNA primers. Lane M: 2000-bp ladder marker, lane 1: SP1.1, lane 2: 94.3, lane 3: IN3521, lane 4: Y31, lane 5: Y33, and lane 6: negative control.
126
W. Liu et al. / Journal of Microbiological Methods 100 (2014) 121–127
Fig. 4. Phylogenetic trees derived from 16S rDNA sequence of five bacteriocin-producing lactic acid bacterial strains. Numbers at the nodes indicated the bootstrap values on neighbourjoining analyses of 1000 resampled data sets. Bar 0.001 represents sequence divergence.
product size of primer set Clade4-3F/Clade4-3R was 158 bp, and strains ATCC14917, IN3521, SP1.1, 94.3, Y31, and Y33 yielded fragments between 150 bp and 200 bp. Therefore, strains IN3521, SP1.1, 94.3, Y31, and Y33 were regarded to contain class IIa bacteriocin structural genes. Previously (Yi et al., 2010), our group has successfully amplified class IIa bacteriocin-encoding genes by designing a degenerate reverse primer with a binding site located within the HPK (histidine protein kinase)-coding region; however, large amplicons (ca. 3 kb) were variably amplified, with large discrepancies, ranging from 400 bp up to 800 bp, depending on the templates used in PCR. Such discrepancies may lead to false positives. Although we obtained some positive results, the sequences of the amplification products were not analysed. Subsequently, our method was developed further by others (Więckowicz et al., 2011), using primers based on all reference bacteriocin gene sequences deposited in the NCBI database. The advantages of their approach were that both novel and known class IIa bacteriocinencoding genes could be determined rapidly; however, the Tm value of the primers used in that study ranged from 30 to 58 °C; that is, the annealing temperature of primers was 25–53 °C, while the scope of the proper annealing temperature was 40–60 °C. Low annealing temperatures can easily lead to false positives, unnecessarily increasing workload. On the other hand, merely identifying the presence of a bacteriocin-encoding gene does not imply that the bacteriocin possesses antibacterial activity, because such genes may not be expressed under fermentation conditions, which will be affected by the medium and variation in the interaction with target cells. Thus, further approaches are required to identify bacteriocins with antibacterial activity. Moreover, some authors did not consider the antibacterial activity of bacteriocins against any specific Gram-negative microorganism. We here first took advantage of the AWDA to screen LAB producing bacteriocin against L. monocytogenes ATCC19111 and a specific microorganism E. coli ATCC 25922 (Gram-negative bacteria); subsequently, class IIa bacteriocin-encoding genes of the bacteriocin-producing LAB strains were amplified, using the novel primers and sequenced. Thus, the method we present here avoided the disadvantages of the above methods (appropriate primers, product sizes, annealing temperatures, and verifying expression of bacteriocin from an organism harbouring a class IIa bacteriocin-encoding gene), while capitalizing on their advantages. 3.3. Sequence analysis of amplicons of class IIa bacteriocin structural genes The amplification products of the 5 target strains were cloned and sequenced. Homology searches of public databases were performed
using the BLASTX programme (http://www.ncbi.nlm.nih.Gov/BLAST). Sequence analysis of strain Y31 and Y33 amplicons revealed a high maximum identity (90–100%) with class IIa bacteriocin-encoding gene sequences in the GenBank database, while those of the strains SP1.1, IN3521, and 94.3 demonstrated low identity. The E-values of the sequences from strains Y31 and Y33 were also low, indicating that these sequences were significantly related to class IIa bacteriocinencoding genes. The bacteriocin from strain Y31 was 100% identical to the enterocin P precursor from Enterococcus faecium E1039 (max score: 92.0, E-value: 1e− 22; Table 4), while that from Y33 was 100% identical to the enterocin P precursor from E. faecium E980 (max score: 92.0, E-value: 2e−22; Table 5). 3.4. Identification of isolates with antimicrobial activity Based on the sugar fermentation reactions using the API 20 Strep system (Streptococcus) or API 50 CHL system (Lactobacillus), the sugar fermentation pattern of strain Y31 was 99% related to an E. faecium strain, strain Y33 was 99% related to an Enterococcus avium strain, strain IN3521 was 99% related to a Weissella viridescens strain, Sp1.1 was 99% related to a Streptococcus thermophilus strain, and 94.3 was 99% related to a S. thermophilus strain. Approximately 1.5 kb fragments of the 16S rDNA were amplified from these strains (Fig. 3); the 16S rDNA sequences of strains Y31, Y33, IN3521, SP1.1, and 94.3 revealed 99% homology to the 16S rDNA sequence of E. faecium strain ATCC 19434 (Accession number: DQ 411813.1), E. avium strain ATCC 14025 (Accession number: DQ 411811.1), W. viridescens strain IMAU FB098 (Accession number: JQ 805716.1), S. thermophilus strain IMAU: 80847 (Accession number: HM 059007.1), and S. thermophilus strain ATCC 19528 (Accession number: NR 042778.1) respectively. Given these results, strains Y31, Y33, IN3521, SP1.1, and 94.3 were confirmed to be E. faecium, E. avium, W. viridescens, S. thermophilus, and S. thermophilus, respectively. Phylogenetic trees derived from the 16S rDNA sequence of these 5 strains are shown in Fig. 4. 4. Conclusions To our knowledge, this is the first report of class IIa bacteriocinogenic LAB derived from 5 types of Chinese homemade fermented food using a traditional microbiological test and a YGNGV-motif-based assay. We here demonstrated that our developed approach is simple, fast, and accurate, requiring only two steps, viz., the AWDA and YGNGV-motifbased assay. We identified 2 strains, viz., E. faecium Y31 and E. avium
W. Liu et al. / Journal of Microbiological Methods 100 (2014) 121–127
Y33, as class IIa bacteriocinogenic LAB strains. Given the antibacterial spectrum of bacteriocins produced by these 2 strains, these bacteriocins may have application as bio-preservatives in the food industry. In addition, this study lays the basis for a correlation of the presences of class IIa bacteriocin-encoding genes and antibacterial activity against Gram-negative bacteria. In future, a novel one-step approach may be provided for identifying class IIa bacteriocins inhibiting specific Gramnegative bacteria. Further studies are required for improving the production of such bacteriocins in order to facilitate their use as biopreservatives in the food industry. Conflicts of interest The authors have no conflicts of interest to declare. Compliance with ethics requirements This study complies with the research ethics and it does not contain any studies with human or animal subjects. Acknowledgements This work was financially supported by the Research Fund for the Doctoral Program of Higher Education of China (No. 20112302110051). References Aunpad, R., Na-Bangchang, K., 2007. Pumilicin 4, a novel bacteriocin with anti-MRSA and anti-VRE activity produced by newly isolated bacteria Bacillus pumilus strain WAPB4. Curr. Microbiol. 55, 308–313. Birri, D.J., Brede, D.A., Forberg, T., Holo, H., Nes, I.F., 2010. Molecular and genetic characterization of a novel bacteriocin locus in Enterococcus avium isolates from infants. Appl. Environ. Microbiol. 76, 483–492. Budde, B.B., Rasch, M., 2001. A comparative study on the use of flow cytometry and colony forming units for assessment of the antibacterial effect of bacteriocins. Int. J. Food Microbiol. 63, 65–72. De Vuyst, L., Vandamme, E.J., 1994. Antimicrobial Potential of Lactic Acid Bacteria. Eijsink, V.G., Skeie, M., Middelhoven, P.H., Brurberg, M.B., Nes, I.F., 1998. Comparative studies of class IIa bacteriocins of lactic acid bacteria. Appl. Environ. Microbiol. 64, 3275–3281. Eijsink, V.G., Axelsson, L., Diep, D.B., Håvarstein, L.S., Holo, H., Nes, I.F., 2002. Production of class II bacteriocins by lactic acid bacteria; an example of biological warfare and communication. Antonie Van Leeuwenhoek 81, 639–654. Falguni, P., Shilpa, V., Mann, B., 2010. Production of proteinaceous antifungal substances from Lactobacillus brevis NCDC 02. Int. J. Dairy Technol. 63, 70–76. Gao, Y., Jia, S., Gao, Q., Tan, Z., 2010. A novel bacteriocin with a broad inhibitory spectrum produced by Lactobacillus sake C2, isolated from traditional Chinese fermented cabbage. Food Control 21, 76–81. Gilliland, S., 1985. Role of Starter Culture Bacteria in Food Preservation. Gong, H., Meng, X., Wang, H., 2010. Plantaricin MG active against Gram-negative bacteria produced by Lactobacillus plantarum KLDS1. 0391 isolated from “Jiaoke”, a traditional fermented cream from China. Food Control 21, 89–96. Gurban oglu Gulahmadov, S., Batdorj, B., Dalgalarrondo, M., Chobert, J.-M., Alekper oglu Kuliev, A., Haertlé, T., 2006. Characterization of bacteriocin-like inhibitory substances (BLIS) from lactic acid bacteria isolated from traditional Azerbaijani cheeses. Eur. Food Res. Technol. 224, 229–235. Jacobsen, C.N., Rosenfeldt Nielsen, V., Hayford, A., Møller, P., Michaelsen, K., Paerregaard, A., Sandström, B., Tvede, M., Jakobsen, M., 1999. Screening of probiotic activities of forty-seven strains of Lactobacillus spp. by in vitro techniques and evaluation of the colonization ability of five selected strains in humans. Appl. Environ. Microbiol. 65, 4949–4956.
127
Joerger, M., Klaenhammer, T., 1990. Cloning, expression, and nucleotide sequence of the Lactobacillus helveticus 481 gene encoding the bacteriocin helveticin J. J. Bacteriol. 172, 6339–6347. Kang, J., Lee, M., 2005. Characterization of a bacteriocin produced by Enterococcus faecium GM‐1 isolated from an infant. J. Appl. Microbiol. 98, 1169–1176. Kim, Y.S., Cha, H.J., 2006. High-throughput and facile assay of antimicrobial peptides using pH-controlled fluorescence resonance energy transfer. Antimicrob. Agents Chemother. 50, 3330–3335. Knoll, C., Divol, B., Du Toit, M., 2008. Genetic screening of lactic acid bacteria of oenological origin for bacteriocin-encoding genes. Food Microbiol. 25, 983–991. Kouakou, P., Ghalfi, H., Dortu, C., Evrard, P., Thonart, P., 2010. Combined use of bacteriocin‐producing strains to control Listeria monocytogenes regrowth in raw pork meat. Int. J. Food Sci. Technol. 45, 937–943. Lee, N.K., Han, E.J., Han, K.J., Paik, H.D., 2013. Antimicrobial effect of bacteriocin KU24 produced by Lactococcus lactis KU24 against methicillin-resistant Staphylococcus aureus. J. Food Sci. 78, M465–M469. Lemos Miguel, M.A., Dias de Castro, Â.C., Ferreira Gomes Leite, S., 2008. Inhibition of vancomycin and high-level aminoglycoside-resistant enterococci strains and Listeria monocytogenes by bacteriocin-like substance produced by Enterococcus faecium E86. Curr. Microbiol. 57, 429–436. Macwana, S.J., Muriana, P.M., 2012. A ‘bacteriocin PCR array’ for identification of bacteriocin-related structural genes in lactic acid bacteria. J. Microbiol. Methods 88, 197–204. Nes, I.F., Holo, H., 2000. Class II antimicrobial peptides from lactic acid bacteria. Pept. Sci. 55, 50–61. Nes, I.F., Diep, D.B., Håvarstein, L.S., Brurberg, M.B., Eijsink, V., Holo, H., 1996. Biosynthesis of bacteriocins in lactic acid bacteria. Antonie Van Leeuwenhoek 70, 113–128. Nuding, S., Fellermann, K., Wehkamp, J., Mueller, H.A., Stange, E.F., 2006. A flow cytometric assay to monitor antimicrobial activity of defensins and cationic tissue extracts. J. Microbiol. Methods 65, 335–345. O'sullivan, L., Ross, R., Hill, C., 2002. Potential of bacteriocin-producing lactic acid bacteria for improvements in food safety and quality. Biochimie 84, 593–604. Paul Ross, R., Morgan, S., Hill, C., 2002. Preservation and fermentation: past, present and future. Int. J. Food Microbiol. 79, 3–16. Pimentel-Filho, N.D.J., Mantovani, H.C., Carvalho, A.F., Dias, R.S., Vanetti, M.C.D., 2014. Efficacy of bovicin HC5 and nisin combination against Listeria monocytogenes and Staphylococcus aureus in fresh cheese. Int. J. Food Sci. Technol. 49, 416–422. Sambrook, J., Russell, D.W., 2001. Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press, New York. Schillinger, U., Lücke, F.K., 1989. Antibacterial activity of Lactobacillus sake isolated from meat. Appl. Environ. Microbiol. 55, 1901–1906. Simon, L., Fremaux, C., Cenatiempo, Y., Berjeaud, J.-M., 2001. Luminescent method for the detection of antibacterial activities. Appl. Microbiol. Biotechnol. 57, 757–763. Suwanjinda, D., Eames, C., Panbangred, W., 2007. Screening of lactic acid bacteria for bacteriocins by microbiological and PCR methods. Biochem. Mol. Biol. Educ. 35, 364–369. Todoriki, K., Mukai, T., Sato, S., Toba, T., 2001. Inhibition of adhesion of food‐borne pathogens to Caco-2 cells by Lactobacillus strains. J. Appl. Microbiol. 91, 154–159. Todorov, S., Ho, P., Vaz-Velho, M., Dicks, L., 2010. Characterization of bacteriocins produced by two strains of Lactobacillus plantarum isolated from Beloura and Chouriço, traditional pork products from Portugal. Meat Sci. 84, 334–343. Valat, C., Champiat, D., N'Guyen, T.T.T., Loiseau, G., Raimbault, M., Montet, D., 2003. Use of ATP bioluminescence to determine the bacterial sensitivity threshold to a bacteriocin. Luminescence 18, 254–258. Van Belkum, M.J., Stiles, M.E., 2000. Nonlantibiotic antibacterial peptides from lactic acid bacteria. Nat. Prod. Rep. 17, 323–335. Van Reenen, C., Chikindas, M., Van Zyl, W., Dicks, L., 2003. Characterization and heterologous expression of a class IIa bacteriocin, plantaricin 423 from Lactobacillus plantarum 423, in Saccharomyces cerevisiae. Int. J. Food Microbiol. 81, 29–40. Virolainen, N.E., Pikkemaat, M.I.G., Elferink, J.A., Karp, M.T., 2008. Rapid detection of tetracyclines and their 4-epimer derivatives from poultry meat with bioluminescent biosensor bacteria. J. Agric. Food Chem. 56, 11065–11070. Voulgari, K., Hatzikamari, M., Delepoglou, A., Georgakopoulos, P., Litopoulou-Tzanetaki, E., Tzanetakis, N., 2010. Antifungal activity of non-starter lactic acid bacteria isolates from dairy products. Food Control 21, 136–142. Więckowicz, M., Schmidt, M., Sip, A., Grajek, W., 2011. Development of a PCR‐based assay for rapid detection of class IIa bacteriocin genes. Lett. Appl. Microbiol. 52, 281–289. Yi, H., Zhang, L., Tuo, Y., Han, X., Du, M., 2010. A novel method for rapid detection of class IIa bacteriocin-producing lactic acid bacteria. Food Control 21, 426–430. Zouhir, A., Hammami, R., Fliss, I., Hamida, J.B., 2010. A new structure-based classification of gram-positive bacteriocins. Protein J. 29, 432–439.
Contents lists available at ScienceDirect
Journal of Microbiological Methods journal homepage: www.elsevier.com/locate/jmicmeth
Qualitative detection of class IIa bacteriocinogenic lactic acid bacteria from traditional Chinese fermented food using a YGNGV-motif-based assay Wenli Liu a, Lanwei Zhang a,⁎, Huaxi Yi a, John Shi b, Chaohui Xue a, Hongbo Li a, Yuehua Jiao a, Nditange Shigwedha a, Ming Du a, Xue Han a a b
School of Food Science & Technology, Harbin Institute of Technology, 73 HuangHe Avenue, Harbin, Heilongjiang 150090, China Guelph Food Research Centre, Agriculture and Agri-Food Canada, Guelph, Ontario N1G5C9, Canada
a r t i c l e
i n f o
Article history: Received 21 February 2014 Accepted 4 March 2014 Available online 26 March 2014 Keywords: Agar well Class IIa bacteriocin Lactic acid bacteria PCR YGNGV-motif-based assay
a b s t r a c t In the present study, a YGNGV-motif-based assay was developed and applied. Given that there is an increasing demand for natural preservatives, we set out to obtain lactic acid bacteria (LAB) that produce bacteriocins against Gram-positive and Gram-negative bacteria. We here isolated 123 LAB strains from 5 types of traditional Chinese fermented food and screened them for the production of bacteriocins using the agar well diffusion assay (AWDA). Then, to acquire LAB producing class IIa bacteriocins, we used a YGNGV-motif-based assay that was based on 14 degenerate primers matching all class IIa bacteriocin-encoding genes currently deposited in NCBI. Eight of the LAB strains identified by AWDA could inhibit Gram-positive and Gram-negative bacteria; 5 of these were YGNGV-amplicon positive. Among these 5 isolates, amplicons from 2 strains (Y31 and Y33) matched class IIa bacteriocin genes. Strain Y31 demonstrated the highest inhibitory activity and the best match to a class IIa bacteriocin gene in NCBI, and was identified as Enterococcus faecium. The bacteriocin from Enterococcus avium Y33 was 100% identical to enterocin P. Both of these strains produced bacteriocins with strong antimicrobial activity against Listeria monocytogenes, Escherichia coli, and Bacillus subtilis, hence these bacteriocins hold promise as potential bio-preservatives in the food industry. These findings also indicated that the YGNGV-motif-based assay used in this study could identify novel class IIa bacteriocinogenic LAB, rapidly and specifically, saving time and labour by by-passing multiple separation and purification steps. © 2014 Elsevier B.V. All rights reserved.
1. Introduction Consumers express concern about the safety of chemical preservatives in foods that may negatively impact their health (Falguni et al., 2010); thus, there is an increasing demand for natural preservatives. Biopreservation refers to the use of antagonistic microorganisms or their metabolic products to enhance food safety and extend shelf life. Traditionally, lactic acid bacteria (LAB) that produce bacteriocins have been applied to food and animal feed as a natural biopreservative (Kouakou et al., 2010; Lee et al., 2013; Voulgari et al., 2010). The preserving effect of LAB (e.g., Lactococcus, Lactobacillus, Leuconostoc, and Pediococcus) in food is mainly due to the generation of some metabolites, i.e., organic acids (lactic and acetic acids), hydrogen peroxide,
⁎ Corresponding author. Tel.: +86 451 86282908; fax: +86 451 86282907. E-mail address: [email protected] (L. Zhang).
http://dx.doi.org/10.1016/j.mimet.2014.03.006 0167-7012/© 2014 Elsevier B.V. All rights reserved.
diacetyl, bacteriocins, and bacteriocin-like inhibitory substances (BLIS) by these bacteria (De Vuyst and Vandamme, 1994; Gilliland, 1985; Paul Ross et al., 2002). Bacteriocins are defined as ribosomally synthesized antimicrobial peptides that are usually active against closely related microorganisms (Birri et al., 2010). Several bacteriocins produced by LAB display a wide spectrum of antagonistic activity (Aunpad and Na-Bangchang, 2007; Lemos Miguel et al., 2008). Moreover, the bacteriocins from LAB can inhibit foodborne pathogenic and spoilage bacteria and have attracted considerable attention in the field of food preservation (Pimentel-Filho et al., 2014; Zouhir et al., 2010). Based on their molecular structure, bacteriocins have been grouped into four classes: (i) class I bacteriocins are lantibiotics (molecular weight ≤ 5 kDa); these small peptides contain lanthionine and/or Lmethyl-lanthionine residues (Eijsink et al., 2002; Nes et al., 1996); (ii) class II bacteriocins are known as non-modified heat-stable bacteriocins, of a molecular weight ≤ 10 kDa (Eijsink et al., 2002; Nes and Holo, 2000); (iii) class III bacteriocins are proteins ≥ 10 kDa (Eijsink
122
W. Liu et al. / Journal of Microbiological Methods 100 (2014) 121–127
Fig. 1. Sequence alignment of class IIa bacteriocins, showing the conserved sites in colour, was performed using CLUSTALW2 software (http://www.ebi.ac.uk/Tools/phylogeny/clustalw2_ phylogeny/).
et al., 2002); and (iv) class IV bacteriocins are large, complex molecules containing carbohydrate or lipid groups (Joerger and Klaenhammer, 1990). To date, the class II bacteriocins are divided into six subclasses, viz. class IIa, class IIb, class IIc, class IId, class IIe, and class IIf (Van Belkum and Stiles, 2000). Class IIa bacteriocins have strong antibacterial activity against Listeria monocytogenes and contain a conserved YGNGVXCXXXXCXV sequence motif at their N-terminus (Fig. 1) (Eijsink et al., 1998). This class has attracted particular attention because of their unique characteristics and potential superiority for use as biopreservatives due to its antibacterial activity against L. monocytogenes which is a common food pathogen (O'sullivan et al., 2002). At present, some methods for screening of class IIa bacteriocin-producing LAB have been developed, including the agar well diffusion assay (AWDA) (Jacobsen et al., 1999; Schillinger and Lücke, 1989), the agar spot test (Todoriki et al., 2001), a microplate assay (Eijsink et al., 1998), flow cytometry assay (Budde and Rasch, 2001; Nuding et al., 2006), a fluorescence resonance energy transfer method based on pH control (Kim and Cha, 2006), and a bioluminometric method (Simon et al., 2001; Valat et al., 2003; Virolainen et al., 2008). However, these methods are time-consuming and laborious, and cannot verify the existence of class IIa bacteriocin directly. In order to improve on these screening methods and acquire class IIa bacteriocins against Gram-positive and Gram-negative bacteria, previous studies have employed a traditional agar well diffusion assay and PCR assay (Macwana and Muriana, 2012; Suwanjinda et al., 2007; Więckowicz et al., 2011; Yi et al., 2010); the results showed that this approach was specific and efficient, but had some limitations. With the development of a modern economy and industrial and technological advances, fewer of the ethnic minorities of China engage in a nomadic life-style. Consequently, the rich microbial resources of traditional Chinese fermented products could soon be lost. Therefore, the aim of this study was to obtain novel class IIa bacteriocinogenic LAB from traditional Chinese fermented food in order to develop microbial resources from these products as a matter of urgency. In this study, we retained and improved the previously reported PCR-based assay; however, the primers developed here were designed according to the sequence alignment of all class IIa bacteriocin-encoding genes in the National Center for Biotechnology Information (NCBI) database and contained the binding sites located within the prebacteriocin-coding region. Moreover, the amplicon sizes in this study were 80–200 bp, which avoided difficulties inherent to amplification of large fragments by PCR, and the annealing temperature was 49–56 °C, which prevented
generation of false positives due to a low annealing temperature. The accuracy of our results was verified by sequencing. 2. Materials and methods 2.1. Strains and growth conditions One hundred and twenty-three LAB were isolated from 5 types of Chinese traditional fermentation foods (kumiss made by the Kazakh herdsmen from Xinjiang, yak yoghurt made by herdsman from the Tibetan Autonomous Prefecture in Qinghai, fermented vegetable juice from Lanzhou, yak yoghourt made by the herdsman from the Subei Mongol Autonomous County in Gansu province, and yak yoghourt made by herdsman from Gannan Tibetan Autonomous Prefecture in Gansu province). The samples were serially diluted in sterile 0.9% (w/v) NaCl solution, plated onto De Man, Rogosa, and Sharpe (MRS) agar, and incubated at 37 °C for 48 h. Colonies with LAB characteristics were isolated and purified using the streak plate method. Purified strains were preliminary identified as coccus, bacilli, and bifidobacteria by Gram-staining, the catalase test, fructose-6-phosphate ketone Table 1 Bacterial strains used in this study. Micro-organism
Collection
Medium
Bacteriocin-producing strains used as reference Lactobacillus plantarum
ATCC14917
MRS
Indicators Listeria monocytogenes Escherichia coli Bacillus subtilis
ATCC19111 ATCC 25922 ATCC 6633
BHI TSA TSA
Potential bacteriocin producer Enterococcus faecium Y31 Enterococcus avium Y33 Streptococcus thermophilus SP1.1 Weissella viridescens IN3521 Streptococcus thermophilus 94.3
Own collection Own collection Own collection Own collection Own collection
MRS MRS MRS MRS MRS
Shenggong, Shanghai, China
LB
Escherichia coli strain used for cloning Escherichia coli DH5a
ATCC, American Type Culture Collection (Rockville, MD, USA). Own, Institute of Food Science and Technology (Harbin Institute Technology, China).
W. Liu et al. / Journal of Microbiological Methods 100 (2014) 121–127
123
Table 2 Sequences of the degenerate oligodeoxyribonucleotide primers used for PCR amplification of class IIa bacteriocin-encoding genes. Oligonucleotide designation
Sequence (5′ to 3′)
Tm (°C)
Length (bp)
Product (bp)
Annealing temperature (°C)
Targeted bacteriocins
Clade1-1F
TGGGGTAAGGCTACCACT TG CCCTTTATTGATGCCAGCTC ATGGGGTTACTTGTGGCA AA CCCTTTATTGATGCCAGCTC AGTGGGAACTAGAATAAGC CAGTCAACAGAGCAGGA TTGTCTAGCTGGCATCGGTA GGACCATGATTAACCCAA CC GCTGGGTTAACTGGGGAGA ATGTCCCATACCTGCCAAAC CGCGTTCATATGGTAATG GT ATGTCCCATACCTGCCAAAC ATTGGGCCAAGGCAACTA CT TTCATGAACAATTTGCTTAG CATT TGGAAAATATTATGGAAA TGGAGTG CCTGGAATTGCTCCACCTAA GAGACACAACTTATCTAT GGGGGTA CCTGGAATTGCTCCACCTAA GGAAATTTAAATGCGCTG GA TTTCCGGAACGAGACTTTTG ACAACCCACGAGGAACTG AC TGATTTCAGCCATTGTTTGG GCAAATTATCGCGAATAC GA GCGGTTATCCTCAATTTCCA CGGTGTACACTGTGGAAA ACAT TTTATTCCAGCCAGCGTTTC GCTTCGCTGGCTTATTTACG AGCTTGAATCGCCTTCGTT
55
20
113
49
Bacteriocin 423, pediocin AcH, sakacin, leucocin A, mesentericin Y105
50 60.23
20 20
151
56
59.67 45.9 45.1 59.44 58.96
20 19 17 20 20
165
42
156
55
Bacteriocin MC4-1, hiracin JM79
60.06 59.68 58.39
19 20 20
86
56
Carnobacteriocin B2, carnobacteriocin BM1, enterocin P
128
55
59.68 60.88
20 20
114
56
60.03
24
60.30
25
123
56
60.07 59.70
20 25
158
56
60.07 60.04
20 20
153
56
60.22 60.01
20 20
91
56
59.52 58.79
20 20
145
55
59.90 59.82
20 20
115
56
60.21 60.01 59.97
20 20 19
114
56
Clade1-1R Clade1-2F Clade1-2R Clade1-3F Clade1-3R Clade2F Clade2R Clade3-1F Clade3-1R Clade3-2F Clade3-2R Clade4-1F Clade4-1R Clade4-2F Clade4-2R Clade4-3F Clade4-3R Clade5-1F Clade5-1R Clade5-2F Clade5-2R Clade5-3F Clade5-3R Clade5-4F Clade5-4R Clade5-5F Clade5-5R
enzyme phosphate test, microscopy, and the morphology and structure of the colony and individual bacteria. All presumptive LAB were assayed for antimicrobial activity. L. monocytogenes ATCC19111, Escherichia coli ATCC 25922, and Bacillus subtilis ATCC 6633 were used as indicator strains. All LAB were cultured at 37 °C in MRS broth without agitation. E. coli ATCC 25922 and B. subtilis ATCC 6633 were cultured in tryptic soy broth (TSB) or tryptic soy agar (TSA), containing 0.3% soya peptone (Aoboxing, Beijing, China), 1.7% tryptone (Oxoid LTD., Basingstoke,
Sakacin A, divercin V41, enterocin A
Enterocin CRL35, mundticin KS, Sakacin X, piscicolin 126, Sakacin P (formerly bavaricin A)
England), 0.25% glucose, 0.5% NaCl, and 0.25% K2HPO4 (pH 7.3), with agitation. L. monocytogenes ATCC19111 was grown in brain heart infusion broth (BHI) or brain heart infusion agar (BHIA) (Hope Biotech, Qingdao, China). All strains were stored in media in the presence of 20% glycerol (v/v) at −80 °C. E. coli DH5α (Shenggong, Shanghai, China) was grown at 37 °C in Luria–Bertani (LB) medium. LB-amp-agar plates (1.5% agar, containing 50 μL/mL of ampicillin; Sigma) with X-Gal (4 μL/mL) and IPTG (Sigma) were used to select DH5α transformant cells containing the
Table 3 Antimicrobial activity of lactic acid bacterial strains assessed in this study. Strains
ATCC14917 Y31 Y33 Sp1.1 94.3 IN3521 IN3821 IN3922 IN3423
Indicator strains Listeria monocytogenes ATCC19111
Escherichia coli ATCC 25922
Bacillus subtilis ATCC 6633
+ ++ ++ ++ ++ ++ ++ + ++
+ ++ + + + + ++ +++ ++
+ +++ +++ +++ +++ +++ ++ +++ +++
Mean values (n = 3) for each experiment. ++ = inhibition zone diameter up to 4 mm. +++ = inhibition zone diameter over 6 mm. + = inhibition zone diameter up to 2 mm. Inhibition zone diameter did not include Oxford cup diameter.
124
W. Liu et al. / Journal of Microbiological Methods 100 (2014) 121–127
of LAB strains was eliminated by adjusting the pH value of the CFSs to 6.0 with 4 M NaOH. The MRS broth (adjusted to pH 6.0 with 4 M NaOH), the CFSs of Lactobacillus plantarum ATCC14917 (adjusted to pH 6.0 with 4 M NaOH), and either lactic acid or acetic acid (pH 6.0) were used as controls. Catalase (50 U/mL, Sigma) was added to the CFSs (adjusted to pH 6.0 with 4 M NaOH), and incubated at 37 °C for 12 h, to eliminate the effect of hydrogen peroxide, CFSs without catalase and L. plantarum ATCC14917 with catalase were used as controls (Gurban oglu Gulahmadov et al., 2006). Bacteriocin activity was expressed as the diameter of zone of inhibition (not including the well) which was measured by a vernier caliper. Strains with the largest zones of inhibition were selected for the following studies. To determine the possible protein nature of the above detected antimicrobial substances, the CFSs (pH 6.0, with catalase) were respectively incubated at 37 °C overnight with pepsin (Sigma), trypsin (Sigma) or protease K (Sigma) at a final concentration of 3 mg/mL individually. CFSs without enzyme treatment and L. plantarum ATCC14917-fermented supernatants with enzyme treatment were used as controls. Diameters of inhibition zones were measured using L. monocytogenes ATCC19111, E. coli ATCC 25922, and B. subtilis ATCC 6633 as indicators (Gao et al., 2010). 2.3. Multiple sequence alignment of class IIa bacteriocin-coding genes and primer design
Fig. 2. PCR amplification of bacteriocin-encoding genes from lactic acid bacteria. a. Agarose gel electrophoresis of PCR fragments from strains ATCC14917, IN3521, SP1.1, 94.3, Y31, and Y33 generated with primer set Clade4-2F/Clade4-2R. Lane M: 50-bp ladder marker, lane 1: ATCC 14917, lane 2: IN 3521, lane 3: SP1.1, lane 4: 94.3, lane 5: Y31, lane 6: Y33, and lane 7: negative control. b. Agarose gel electrophoresis of PCR fragments from strains ATCC14917, IN3521, SP1.1, 94.3, Y31, and Y33 amplified using primer set Clade4-3F/ Clade4-3R. Lane M: 50-bp ladder marker, lane 1: IN3521, lane 2: Y31, lane 3: SP1.1, lane 4: 94.3, lane 5: ATCC14917, lane 6: Y33, and lane 7: negative control.
recombinant plasmid pUCm-T (Shenggong, Shanghai, China). All bacterial strains used in this study are shown in Table 1. 2.2. Screening bacteriocin-producing LAB active against Gram-positive and Gram-negative bacteria by AWDA The AWDA was used to assay the antibacterial activity of the cellfree supernatants (CFSs) of all LAB, as described by Gong et al. (2010), with some modification. Ten millilitres of 1.5% agar (Biotopped Science & Technology Co. Ltd., Beijing, China) was poured into a sterile plate as the first layer of a double-plate. The agar was allowed to dry. Later, Oxford-cups (6 mm in diameter) were put on the first agar layer. A second layer of semi-solid TSA medium (10 mL of 0.7% w/v) containing 200 μL of indicator strain cultured overnight was poured. The inoculated TSA soft agar was rapidly dispensed onto the agar plate and solidified on the Oxford-cups. BHIA was used instead of TSA for L. monocytogenes ATCC19111. The Oxford-cups were removed and wells (6 mm in diameter) were formed. After drying for 30 min in a laminar flow hood, each well was filled with 80 μL of CFS from LAB strains eliminating the effect of organic acid and hydrogen peroxide, and then incubated at 37 °C for 24 h. The influence of organic acid on the antimicrobial activity of CFSs
Nucleotide sequences of 44 bacteriocin-coding genes were obtained from NCBI (http://www.ncbi.nlm.nih.gov/). The phylogenetic relationships among class IIa bacteriocins were obtained using the neighbourjoining method with MEGA5 software, and the consistency of the data was tested by bootstrapping the alignments 1000 times. Using the multiple sequence alignment of the class IIa bacteriocin-coding genes, we manually designed the primers used in this study (Table 2). 2.4. Metagenomic DNA extraction of bacteriocin-producing LAB Total DNA was extracted using the Bacterial DNA kit (Omega Biotechnology, Norcross, USA) according to the manufacturer's instructions, with minor modifications. Briefly, after adding 20 μL of a 50 mg/mL lysozyme solution to the bacterial pellet, samples were centrifuged at 5000 ×g for 5 min. Then, 200 μL of DNA buffer, 40 mg of glass powder, and 25 μL protease K solution were added, and mixed by vortexing 4–5 times for a total time of 80 min. To recover DNA, samples were cleaned up using the HiBind® DNA Mini column, which was centrifuged at 13,000 ×g for 2 min. Thirty microliters of preheated (65 °C) elution buffer was then added to the column and the elution was repeated twice. 2.5. PCR amplification and cloning of bacteriocin-encoding genes from potential LAB Genomic DNA of the target bacteriocin-producing LAB was amplified in 25 μL reaction mixtures containing 10 × Taq Buffer (Fermentas International Inc. Ltd., Ontario, Canada), 10 mM of each deoxynucleoside triphosphates (dNTPs; TaKaRa Bio Inc., Shiga, Japan), 20 mM of each primer (Table 2), and 0.5 U of ExTaq polymerase (Fermentas). Two microliters of genomic DNA (100 ng/μL) was used as template.
Table 4 BLAST results of sequences of the amplified product of strain Y31. Accession number in GenBank
Protein
Identity (%)
Max score
E-value
ZP_06675109.1 ZP_06682229.1 ABI29856.1 ACI25619.1 ZP_19522307.1
Enterocin P precursor Enterocin P precursor Enterocin P protein EntP [Enterococcus mundtii] Bacteriocin enterocin-P
100 100 100 98 95
92.0 92.0 89.7 90.1 89.7
1e−2 5e−22 7e−22 8e−22 1e−21
W. Liu et al. / Journal of Microbiological Methods 100 (2014) 121–127
125
Table 5 BLAST results of sequences of the amplified product of strain Y33. Accession number in GenBank
Protein
Identity (%)
Max score
E-value
WP_002319312.1 WP_002291094.1 ABI29856.1 WP 021108959.1 ZP_19522307.1
Enterocin P precursor Bacteriocin enterocin-P Enterocin P protein Bacteriocin [Enterococcus faecium CRL 1879] EntP [Enterococcus mundtii]
100 100 100 98 98
92.0 92.0 89.7 90.5 90.1
2e−22 2e−22 8e−22 9e−22 1e−21
Amplification conditions were as follows: initial denaturation for 5 min at 94 °C, 30 cycles each consisting of denaturation for 45 s at 94 °C, annealing for 45 s at 49–56 °C (gradient), and elongation for 1 min at 72 °C, followed by a final extension step for 5 min at 72 °C. PCR was performed in a 2720 Thermal cycler (AB Applied Biosystems, Foster, Canada). The resulting fragments were subjected to agarose gel electrophoresis (2.5%) and were purified with the Omega Gel Extraction Kit (Omega Biotechnology) according to the instructions supplied by the manufacturer. Fragments were cloned into pUCm-T vector (Sangon Biotech Co. Ltd., Shanghai, China) as described by Sambrook and Russell (2001), then subjected to DNA sequencing analysis (Sangon Biotech Co. Ltd). Homologies of the obtained sequences were searched in the NCBI database using BLAST (http://blasr.ncbi.nih.gov/Blast.cgi). DNA ligase, restriction enzymes, and primers (are shown in Table 2) used were obtained from Sangon Biotech Co., Ltd. (Shanghai, China). 2.6. Strain identification Strains producing class IIa bacteriocin were determined using the API 20 STREP system or API 50 CHL system (bioMérieux, Marcy l'Etoile, France). The sugar fermentation pattern so obtained was analysed with the API Streptococcus or Lactobacillus Plus software (bioMérieux). The strains were identified up to species level by 16S rDNA sequence analysis. The 16S rDNA gene was amplified using genus-specific primers 5′-AGAGTTTGATCCTGGCTCAG-3′ and 5′-ACGGTTACCTTGTTACGACTT3′. The PCR products were then sequenced for the 16S rDNA (Sangon Biotech Co. Ltd., Shanghai, China). BLAST was used for homology searches in the databases (http://www.ncbi.nlm.nih.gov/BLAST). DNAMAN software (version 4.0) was used to obtain a bootstrap consensus tree (1000 copies) by multiple sequence alignment with the neighbour-joining method. 3. Results and discussion
strains. The CFSs (eliminating organic acid) of 14 strains had distinct antimicrobial activity against L. monocytogenes ATCC19111, E. coli ATCC 25922, and B. subtilis ATCC 6633. After catalase treatment, all 14 strains retained their antibacterial activity. When the CFSs of these 14 strains were treated with protease K, pepsin, and trypsin, the antibacterial activity of 8 strains was either decreased or abolished. The antimicrobial activities of these 8 LAB are shown in Table 3; L. plantarum ATCC14917, a strain previously reported as producing class IIa bacteriocin (Van Reenen et al., 2003), was used as a positive control. Generally, bacteriocins from lactic acid bacteria are regarded to have no antibacterial activity against Gram-negative bacteria (Kang and Lee, 2005). However, the Gram-negative strain E. coli ATCC 25922 was sensitive to bacteriocins produced by these eight LAB. Similar reports have showed that some bacteriocins produced by LAB, especially class II bacteriocins, could inhibit a limited number of Gram-negative bacteria. Bacteriocins bacST202Ch and bacST216Ch, produced by L. plantarum, have been reported to have antibacterial activity against E. coli and Salmonella spp. (Todorov et al., 2010). Sakacin C2, produced by Lactobacillus sake C2, has also been reported to inhibit the growth of Gram-negative bacteria E. coli ATCC 25922 (Gao et al., 2010). 3.2. Amplification of class IIa bacteriocin-encoding genes The bacteriocin-encoding genes of the 8 targeted LAB strains (Table 3) were amplified by PCR, using 14 pairs of primers (Table 2), to verify the class IIa bacteriocins produced by these strains. The results showed that primer sets Clade4-2F/Clade4-2R and Clade4-3F/Clade43R could amplify sequences from L. plantarum ATCC14917 and 5 of the targeted LAB strains at 56 °C, viz., IN3521, SP1.1, 94.3, Y31, and Y33 (Fig. 2a and b). The target product size of primer set Clade4-2F/ Clade4-2R was 123 bp, and strains ATCC14917, IN3521, SP1.1, 94.3, Y31, and Y33 yielded fragments between 120 bp and 140 bp. The target
The current screening process for class IIa bacteriocin-producing LAB strains includes screening for LAB that produce bacteriocins against L. monocytogenes, the extraction of crude protein, separation and purification of the bacteriocin, and determination of the N-terminal amino acid sequence. These procedures are costly in terms of manpower, materials, and time. The AWDA is a commonly used analytical approach, although the drawbacks of the method include a lack of specificity and limited sensitivity. The use of PCR using bacteriocin-specific primers has been reported repeatedly (Knoll et al., 2008; Suwanjinda et al., 2007; Więckowicz et al., 2011; Yi et al., 2010); however, until now this approach has not been used for screening class IIa bacteriocins against Gram-negative bacteria. In order to develop a rapid, facile, and accurate screening method, we here combined the microbiological screening method (AWDA) with the YGNGV-motif-based assay in order to obtain LAB strains that produce class IIa bacteriocins against Gram-positive and Gram-negative bacteria. 3.1. Screening bacteriocin-producing LAB by AWDA In this study, we used AWDA to obtain LAB that produce bacteriocin against Gram-positive and Gram-negative bacteria; 123 LAB were detected that produced antimicrobial peptides against different indicator
Fig. 3. PCR amplification of 16S rDNA genes from bacteriocin-producing lactic acid bacteria. Agarose gel electrophoresis of PCR fragments from strains SP1.1, 94.3, IN 3521, Y31, and Y33 generated with 16S rDNA primers. Lane M: 2000-bp ladder marker, lane 1: SP1.1, lane 2: 94.3, lane 3: IN3521, lane 4: Y31, lane 5: Y33, and lane 6: negative control.
126
W. Liu et al. / Journal of Microbiological Methods 100 (2014) 121–127
Fig. 4. Phylogenetic trees derived from 16S rDNA sequence of five bacteriocin-producing lactic acid bacterial strains. Numbers at the nodes indicated the bootstrap values on neighbourjoining analyses of 1000 resampled data sets. Bar 0.001 represents sequence divergence.
product size of primer set Clade4-3F/Clade4-3R was 158 bp, and strains ATCC14917, IN3521, SP1.1, 94.3, Y31, and Y33 yielded fragments between 150 bp and 200 bp. Therefore, strains IN3521, SP1.1, 94.3, Y31, and Y33 were regarded to contain class IIa bacteriocin structural genes. Previously (Yi et al., 2010), our group has successfully amplified class IIa bacteriocin-encoding genes by designing a degenerate reverse primer with a binding site located within the HPK (histidine protein kinase)-coding region; however, large amplicons (ca. 3 kb) were variably amplified, with large discrepancies, ranging from 400 bp up to 800 bp, depending on the templates used in PCR. Such discrepancies may lead to false positives. Although we obtained some positive results, the sequences of the amplification products were not analysed. Subsequently, our method was developed further by others (Więckowicz et al., 2011), using primers based on all reference bacteriocin gene sequences deposited in the NCBI database. The advantages of their approach were that both novel and known class IIa bacteriocinencoding genes could be determined rapidly; however, the Tm value of the primers used in that study ranged from 30 to 58 °C; that is, the annealing temperature of primers was 25–53 °C, while the scope of the proper annealing temperature was 40–60 °C. Low annealing temperatures can easily lead to false positives, unnecessarily increasing workload. On the other hand, merely identifying the presence of a bacteriocin-encoding gene does not imply that the bacteriocin possesses antibacterial activity, because such genes may not be expressed under fermentation conditions, which will be affected by the medium and variation in the interaction with target cells. Thus, further approaches are required to identify bacteriocins with antibacterial activity. Moreover, some authors did not consider the antibacterial activity of bacteriocins against any specific Gram-negative microorganism. We here first took advantage of the AWDA to screen LAB producing bacteriocin against L. monocytogenes ATCC19111 and a specific microorganism E. coli ATCC 25922 (Gram-negative bacteria); subsequently, class IIa bacteriocin-encoding genes of the bacteriocin-producing LAB strains were amplified, using the novel primers and sequenced. Thus, the method we present here avoided the disadvantages of the above methods (appropriate primers, product sizes, annealing temperatures, and verifying expression of bacteriocin from an organism harbouring a class IIa bacteriocin-encoding gene), while capitalizing on their advantages. 3.3. Sequence analysis of amplicons of class IIa bacteriocin structural genes The amplification products of the 5 target strains were cloned and sequenced. Homology searches of public databases were performed
using the BLASTX programme (http://www.ncbi.nlm.nih.Gov/BLAST). Sequence analysis of strain Y31 and Y33 amplicons revealed a high maximum identity (90–100%) with class IIa bacteriocin-encoding gene sequences in the GenBank database, while those of the strains SP1.1, IN3521, and 94.3 demonstrated low identity. The E-values of the sequences from strains Y31 and Y33 were also low, indicating that these sequences were significantly related to class IIa bacteriocinencoding genes. The bacteriocin from strain Y31 was 100% identical to the enterocin P precursor from Enterococcus faecium E1039 (max score: 92.0, E-value: 1e− 22; Table 4), while that from Y33 was 100% identical to the enterocin P precursor from E. faecium E980 (max score: 92.0, E-value: 2e−22; Table 5). 3.4. Identification of isolates with antimicrobial activity Based on the sugar fermentation reactions using the API 20 Strep system (Streptococcus) or API 50 CHL system (Lactobacillus), the sugar fermentation pattern of strain Y31 was 99% related to an E. faecium strain, strain Y33 was 99% related to an Enterococcus avium strain, strain IN3521 was 99% related to a Weissella viridescens strain, Sp1.1 was 99% related to a Streptococcus thermophilus strain, and 94.3 was 99% related to a S. thermophilus strain. Approximately 1.5 kb fragments of the 16S rDNA were amplified from these strains (Fig. 3); the 16S rDNA sequences of strains Y31, Y33, IN3521, SP1.1, and 94.3 revealed 99% homology to the 16S rDNA sequence of E. faecium strain ATCC 19434 (Accession number: DQ 411813.1), E. avium strain ATCC 14025 (Accession number: DQ 411811.1), W. viridescens strain IMAU FB098 (Accession number: JQ 805716.1), S. thermophilus strain IMAU: 80847 (Accession number: HM 059007.1), and S. thermophilus strain ATCC 19528 (Accession number: NR 042778.1) respectively. Given these results, strains Y31, Y33, IN3521, SP1.1, and 94.3 were confirmed to be E. faecium, E. avium, W. viridescens, S. thermophilus, and S. thermophilus, respectively. Phylogenetic trees derived from the 16S rDNA sequence of these 5 strains are shown in Fig. 4. 4. Conclusions To our knowledge, this is the first report of class IIa bacteriocinogenic LAB derived from 5 types of Chinese homemade fermented food using a traditional microbiological test and a YGNGV-motif-based assay. We here demonstrated that our developed approach is simple, fast, and accurate, requiring only two steps, viz., the AWDA and YGNGV-motifbased assay. We identified 2 strains, viz., E. faecium Y31 and E. avium
W. Liu et al. / Journal of Microbiological Methods 100 (2014) 121–127
Y33, as class IIa bacteriocinogenic LAB strains. Given the antibacterial spectrum of bacteriocins produced by these 2 strains, these bacteriocins may have application as bio-preservatives in the food industry. In addition, this study lays the basis for a correlation of the presences of class IIa bacteriocin-encoding genes and antibacterial activity against Gram-negative bacteria. In future, a novel one-step approach may be provided for identifying class IIa bacteriocins inhibiting specific Gramnegative bacteria. Further studies are required for improving the production of such bacteriocins in order to facilitate their use as biopreservatives in the food industry. Conflicts of interest The authors have no conflicts of interest to declare. Compliance with ethics requirements This study complies with the research ethics and it does not contain any studies with human or animal subjects. Acknowledgements This work was financially supported by the Research Fund for the Doctoral Program of Higher Education of China (No. 20112302110051). References Aunpad, R., Na-Bangchang, K., 2007. Pumilicin 4, a novel bacteriocin with anti-MRSA and anti-VRE activity produced by newly isolated bacteria Bacillus pumilus strain WAPB4. Curr. Microbiol. 55, 308–313. Birri, D.J., Brede, D.A., Forberg, T., Holo, H., Nes, I.F., 2010. Molecular and genetic characterization of a novel bacteriocin locus in Enterococcus avium isolates from infants. Appl. Environ. Microbiol. 76, 483–492. Budde, B.B., Rasch, M., 2001. A comparative study on the use of flow cytometry and colony forming units for assessment of the antibacterial effect of bacteriocins. Int. J. Food Microbiol. 63, 65–72. De Vuyst, L., Vandamme, E.J., 1994. Antimicrobial Potential of Lactic Acid Bacteria. Eijsink, V.G., Skeie, M., Middelhoven, P.H., Brurberg, M.B., Nes, I.F., 1998. Comparative studies of class IIa bacteriocins of lactic acid bacteria. Appl. Environ. Microbiol. 64, 3275–3281. Eijsink, V.G., Axelsson, L., Diep, D.B., Håvarstein, L.S., Holo, H., Nes, I.F., 2002. Production of class II bacteriocins by lactic acid bacteria; an example of biological warfare and communication. Antonie Van Leeuwenhoek 81, 639–654. Falguni, P., Shilpa, V., Mann, B., 2010. Production of proteinaceous antifungal substances from Lactobacillus brevis NCDC 02. Int. J. Dairy Technol. 63, 70–76. Gao, Y., Jia, S., Gao, Q., Tan, Z., 2010. A novel bacteriocin with a broad inhibitory spectrum produced by Lactobacillus sake C2, isolated from traditional Chinese fermented cabbage. Food Control 21, 76–81. Gilliland, S., 1985. Role of Starter Culture Bacteria in Food Preservation. Gong, H., Meng, X., Wang, H., 2010. Plantaricin MG active against Gram-negative bacteria produced by Lactobacillus plantarum KLDS1. 0391 isolated from “Jiaoke”, a traditional fermented cream from China. Food Control 21, 89–96. Gurban oglu Gulahmadov, S., Batdorj, B., Dalgalarrondo, M., Chobert, J.-M., Alekper oglu Kuliev, A., Haertlé, T., 2006. Characterization of bacteriocin-like inhibitory substances (BLIS) from lactic acid bacteria isolated from traditional Azerbaijani cheeses. Eur. Food Res. Technol. 224, 229–235. Jacobsen, C.N., Rosenfeldt Nielsen, V., Hayford, A., Møller, P., Michaelsen, K., Paerregaard, A., Sandström, B., Tvede, M., Jakobsen, M., 1999. Screening of probiotic activities of forty-seven strains of Lactobacillus spp. by in vitro techniques and evaluation of the colonization ability of five selected strains in humans. Appl. Environ. Microbiol. 65, 4949–4956.
127
Joerger, M., Klaenhammer, T., 1990. Cloning, expression, and nucleotide sequence of the Lactobacillus helveticus 481 gene encoding the bacteriocin helveticin J. J. Bacteriol. 172, 6339–6347. Kang, J., Lee, M., 2005. Characterization of a bacteriocin produced by Enterococcus faecium GM‐1 isolated from an infant. J. Appl. Microbiol. 98, 1169–1176. Kim, Y.S., Cha, H.J., 2006. High-throughput and facile assay of antimicrobial peptides using pH-controlled fluorescence resonance energy transfer. Antimicrob. Agents Chemother. 50, 3330–3335. Knoll, C., Divol, B., Du Toit, M., 2008. Genetic screening of lactic acid bacteria of oenological origin for bacteriocin-encoding genes. Food Microbiol. 25, 983–991. Kouakou, P., Ghalfi, H., Dortu, C., Evrard, P., Thonart, P., 2010. Combined use of bacteriocin‐producing strains to control Listeria monocytogenes regrowth in raw pork meat. Int. J. Food Sci. Technol. 45, 937–943. Lee, N.K., Han, E.J., Han, K.J., Paik, H.D., 2013. Antimicrobial effect of bacteriocin KU24 produced by Lactococcus lactis KU24 against methicillin-resistant Staphylococcus aureus. J. Food Sci. 78, M465–M469. Lemos Miguel, M.A., Dias de Castro, Â.C., Ferreira Gomes Leite, S., 2008. Inhibition of vancomycin and high-level aminoglycoside-resistant enterococci strains and Listeria monocytogenes by bacteriocin-like substance produced by Enterococcus faecium E86. Curr. Microbiol. 57, 429–436. Macwana, S.J., Muriana, P.M., 2012. A ‘bacteriocin PCR array’ for identification of bacteriocin-related structural genes in lactic acid bacteria. J. Microbiol. Methods 88, 197–204. Nes, I.F., Holo, H., 2000. Class II antimicrobial peptides from lactic acid bacteria. Pept. Sci. 55, 50–61. Nes, I.F., Diep, D.B., Håvarstein, L.S., Brurberg, M.B., Eijsink, V., Holo, H., 1996. Biosynthesis of bacteriocins in lactic acid bacteria. Antonie Van Leeuwenhoek 70, 113–128. Nuding, S., Fellermann, K., Wehkamp, J., Mueller, H.A., Stange, E.F., 2006. A flow cytometric assay to monitor antimicrobial activity of defensins and cationic tissue extracts. J. Microbiol. Methods 65, 335–345. O'sullivan, L., Ross, R., Hill, C., 2002. Potential of bacteriocin-producing lactic acid bacteria for improvements in food safety and quality. Biochimie 84, 593–604. Paul Ross, R., Morgan, S., Hill, C., 2002. Preservation and fermentation: past, present and future. Int. J. Food Microbiol. 79, 3–16. Pimentel-Filho, N.D.J., Mantovani, H.C., Carvalho, A.F., Dias, R.S., Vanetti, M.C.D., 2014. Efficacy of bovicin HC5 and nisin combination against Listeria monocytogenes and Staphylococcus aureus in fresh cheese. Int. J. Food Sci. Technol. 49, 416–422. Sambrook, J., Russell, D.W., 2001. Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press, New York. Schillinger, U., Lücke, F.K., 1989. Antibacterial activity of Lactobacillus sake isolated from meat. Appl. Environ. Microbiol. 55, 1901–1906. Simon, L., Fremaux, C., Cenatiempo, Y., Berjeaud, J.-M., 2001. Luminescent method for the detection of antibacterial activities. Appl. Microbiol. Biotechnol. 57, 757–763. Suwanjinda, D., Eames, C., Panbangred, W., 2007. Screening of lactic acid bacteria for bacteriocins by microbiological and PCR methods. Biochem. Mol. Biol. Educ. 35, 364–369. Todoriki, K., Mukai, T., Sato, S., Toba, T., 2001. Inhibition of adhesion of food‐borne pathogens to Caco-2 cells by Lactobacillus strains. J. Appl. Microbiol. 91, 154–159. Todorov, S., Ho, P., Vaz-Velho, M., Dicks, L., 2010. Characterization of bacteriocins produced by two strains of Lactobacillus plantarum isolated from Beloura and Chouriço, traditional pork products from Portugal. Meat Sci. 84, 334–343. Valat, C., Champiat, D., N'Guyen, T.T.T., Loiseau, G., Raimbault, M., Montet, D., 2003. Use of ATP bioluminescence to determine the bacterial sensitivity threshold to a bacteriocin. Luminescence 18, 254–258. Van Belkum, M.J., Stiles, M.E., 2000. Nonlantibiotic antibacterial peptides from lactic acid bacteria. Nat. Prod. Rep. 17, 323–335. Van Reenen, C., Chikindas, M., Van Zyl, W., Dicks, L., 2003. Characterization and heterologous expression of a class IIa bacteriocin, plantaricin 423 from Lactobacillus plantarum 423, in Saccharomyces cerevisiae. Int. J. Food Microbiol. 81, 29–40. Virolainen, N.E., Pikkemaat, M.I.G., Elferink, J.A., Karp, M.T., 2008. Rapid detection of tetracyclines and their 4-epimer derivatives from poultry meat with bioluminescent biosensor bacteria. J. Agric. Food Chem. 56, 11065–11070. Voulgari, K., Hatzikamari, M., Delepoglou, A., Georgakopoulos, P., Litopoulou-Tzanetaki, E., Tzanetakis, N., 2010. Antifungal activity of non-starter lactic acid bacteria isolates from dairy products. Food Control 21, 136–142. Więckowicz, M., Schmidt, M., Sip, A., Grajek, W., 2011. Development of a PCR‐based assay for rapid detection of class IIa bacteriocin genes. Lett. Appl. Microbiol. 52, 281–289. Yi, H., Zhang, L., Tuo, Y., Han, X., Du, M., 2010. A novel method for rapid detection of class IIa bacteriocin-producing lactic acid bacteria. Food Control 21, 426–430. Zouhir, A., Hammami, R., Fliss, I., Hamida, J.B., 2010. A new structure-based classification of gram-positive bacteriocins. Protein J. 29, 432–439.
