YPREP 4643

No. of Pages 8, Model 5G

6 February 2015 Protein Expression and Purification xxx (2015) xxx–xxx 1

Contents lists available at ScienceDirect

Protein Expression and Purification journal homepage: www.elsevier.com/locate/yprep 5 6 3 4 7 8 9 10 11 12 13 1 2 5 7 16 17 18 19 20 21 22 23 24 25 26

Purification, cloning, expression, and biochemical characterization of a monofunctional catalase, KatP, from Pigmentiphaga sp. DL-8 Weiliang Dong a, Ying Hou a,b, Shuhuan Li a, Fei Wang c, Jie Zhou a, Zhoukun Li a, Yicheng Wang a, Fei Huang a, Lei Fu a, Yan Huang a, Zhongli Cui a,⇑ a b c

Key Lab of Agricultural Environmental Microbiology, Ministry of Agriculture, College of Life Science, Nanjing Agriculture University, 210095 Nanjing, China College of Food and Bioengineering, Henan University of Science and Technology, 471003 Luoyang, China College of Bioscience and Bioengineering, Jiangxi Agriculture University, 330045 Nanchang, China

a r t i c l e

i n f o

Article history: Received 24 November 2014 and in revised form 29 January 2015 Available online xxxx Keywords: Monofunctional catalase Enzyme purification Pigmentiphaga sp. Recombinant Characterization

a b s t r a c t Catalases are essential components of the cellular equipment used to cope with oxidative stress. The monofunctional catalase KatP was purified from Pigmentiphaga sp. using ammonium sulfate precipitation (ASP), diethylaminoethyl ion exchange chromatography (IEC), and hydrophobic interaction chromatography (HIC). The purified catalase formed polymer with an estimated monomer molecular mass of 54 kDa, which were resolved by sodium dodecyl sulfate–polyacrylamide gel electrophoresis (SDS–PAGE) and zymogram analysis. KatP exhibited a specific catalytic activity of 73,000 U/mg, which was higher than that of catalase-1 of Comamonas terrigena N3H (55,900 U/mg). Seven short tryptic fragments of this catalase were obtained by electrospray ionization quadrupole time-of-flight mass spectrometry (ESI-Q-TOF MS/MS), and the gene, katP, was cloned by PCR amplification and overexpressed in Escherichia coli BL21 (DE3). Based on the complete amino acid sequence, KatP was identified as a clade 3 monofunctional catalase. The specific activities of recombinant KatP for hydrogen peroxide (690,000 U/mg) increased 9-fold over that of the parent strain. The Km and Vmax of recombinant KatP were 9.48 mM and 81.2 mol/min mg, respectively. The optimal pH and temperature for KatP were 7.0 and 37 °C, respectively, and the enzyme displayed abroad pH-stable range of 4.0–11.0. The enzyme was inhibited by Zn2+, Cu2+, Cr2+, and Mn2+, whereas Fe3+ and Mg2+ stimulated KatP enzymatic activity. Interestingly, the catalase activity of recombinant KatP displayed high stability under different temperature and pH conditions, suggesting that KatP is a potential candidate for the production of catalase. Ó 2015 Published by Elsevier Inc.

28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47

48 49

Introduction

50

Reactive oxygen species (ROS)1 that form as metabolic byproducts represent a serious problem for all organisms utilizing molecular oxygen as the final electron acceptor. ROS originate from partial reduction of molecular oxygen to superoxide (O2), hydrogen peroxide (H2O2), and hydroxyl radicals (OH), which can cause damage to macromolecules such as proteins, lipids, and nucleotides, thus leading to growth arrest and cell death [1–3]. Among several potentially harmful ROS, hydrogen peroxide is probably one of the most abundant, regularly occurring in the cells as well as their microenvironment [4]. Hydrogen peroxide is formed intracellularly

51 52 53 54 55 56 57 58 59

⇑ Corresponding author. Tel./fax: +86 025 84396753. E-mail address: [email protected] (Z. Cui). 1 Abbreviation used: ASP, ammonium sulfate precipitation; IEC, ion exchange chromatography; HIC, hydrophobic interaction chromatography; SDS–PAGE, sodium dodecyl sulfate–polyacrylamide gel electrophoresis; ROS, reactive oxygen species; H2O2, hydrogen peroxide; TAIL, thermal asymmetric interlaced.

as by-product in reactions catalyzed by numerous oxidases, mainly those carried out by flavoenzymes [5]. Catalase (EC 1.11.1.6), which catalyzes the decomposition of hydrogen peroxide into oxygen and water, is widely distributed in animals, plants and microorganisms [6]. The reaction mechanism of these oxidoreductases has been studied in detail [7], and is based on the heterolytic cleavage of the peroxidic bond present in hydrogen peroxide and also some organic peroxides. A highly reactive reaction intermediate termed compound I is formed from ferricatalase in a rapid reaction with peroxides. In addition to hydrogen peroxide, various one and two electron donors can also be used for the reduction of compound I back to ferricatalase, thus representing the peroxidatic mode of the catalase reaction [7]. Catalases from a variety of microbial species were heterologously overexpressed in Escherichia coli. The purified typical monofunctional catalase-1 sample from Comamonas terrigena N3H exhibited a specific catalytic activity of 55,900 U/mg, with a broad optimum pH between 6 and 10 [4]. An alkali-tolerant high-activity

http://dx.doi.org/10.1016/j.pep.2015.01.011 1046-5928/Ó 2015 Published by Elsevier Inc.

Please cite this article in press as: W. Dong et al., Purification, cloning, expression, and biochemical characterization of a monofunctional catalase, KatP, from Pigmentiphaga sp. DL-8, Protein Expr. Purif. (2015), http://dx.doi.org/10.1016/j.pep.2015.01.011

60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77

YPREP 4643

No. of Pages 8, Model 5G

6 February 2015 2 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100

W. Dong et al. / Protein Expression and Purification xxx (2015) xxx–xxx

catalase from a thermophilic bacterium was overexpressed and purified in E. coli with a specific activity of 3667 U/mg at 25 °C [8]. The specific activity of the purified catalase from Bacillus sp. TE124 was 35,200 U/mg, with a broad optimum pH between 7.0 and 10.5 [9]. The native PktA purified from Psychrobacter sp. T-3 showed a single protein band in SDS–PAGE, and a specific activity of 220,000 U/mg of protein [10]. The enzyme is widely applied in several sectors such as the food, dairy, textile, pulp and paper industries [11]. Its degradation of hydrogen peroxide in the textile industry is crucial to prevent problems in subsequent dyeing steps [12]. These applications in the industrial processes require a large amount of enzyme at low cost. Although many methods have been explored for enhancing the production of catalase by microorganisms, including mutagenesis [13], induction by H2O2 and pectin [14,15], and genetic engineering [16], the resulting microorganisms have remained unable to efficiently produce catalase, which leads to high costs. To our knowledge, the current study is the first to purify a clade 3 monofunctional catalase, KatP, from Pigmentiphaga sp. DL-8. The genes encoding KatP were cloned and expressed in E. coli BL21 (DE3). The specific activities of recombinant KatP for hydrogen peroxide (690,000 U/mg) increased 9-fold over that of the parent strain (73,000 U/mg) and improve its application.

101

Materials and methods

102

Bacterial cultivation and crude extract preparation

103

A strain DL-8 with higher catalase activity was identified by the 16S rRNA sequence and designated as Pigmentiphaga sp. (GenBank Accession No. KJ155792). It was subsequently conserved in the China Center for Type Culture Collection (CCTCC No. M2014057). The strain was precultured in Luria-Bertani medium (LB: containing 10.0 g/L tryptone, 5.0 g/L yeast extract and 10.0 g/L NaCl, pH 7.0), harvested by centrifugation at 6000g at 4 °C for 5 min, washed, and resuspended in 50 mL sodium phosphate buffer (PBS; 20 mM; pH 8.0). The 5.32 g of wet weight cells were disrupted by sonication for 20 min (Sonicator 201 M, Kubota, Japan); cell suspensions were then centrifuged at 12,000 rpm for 20 min at 4 °C. The supernatants obtained from this step were referred to as crude extracts. Protein concentrations were determined using the Bradford method using bovine serum albumin as the standard [17]; protein concentrations during purification studies were then calculated from the standard curve. The eluted fractions from the chromatographic separations were monitored at 280 nm.

104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119

120

Catalase purification

121

All purification steps were performed at temperatures 64 °C to avoid any possible enzyme denaturation. The cell extracts were fractionated using ammonium sulfate, and the precipitate of 60– 80% saturation was harvested by centrifugation at 12,000 rpm for 30 min. Precipitates were dissolved in 50 mL of 20 mM PBS (pH 8.0) containing 2 M ammonium sulfate and then centrifuged (4 °C, 12,000 rpm for 20 min) to discard the undissolved fractions. The enzyme was then applied to a Butyl-650 M hydrophobic interaction chromatography (Toyopearl, Japan, 20 mL) column by applying a linear gradient of 4–0 M ammonium sulfate in 20 mM PBS (pH 8.0). The active fractions were dialyzed against the same buffer for 12 h and then applied to a DEAE-Toyopearl650 M (Toyopearl, Japan, 20 ml) column. The adsorbed enzyme was eluted with a linear gradient of NaCl from 0 to 500 mM in 20 mM PBS (pH 8.0) at a flow rate of 1 mL min1. The fractions containing catalase activity were collected and concentrated [18].

122 123 124 125 126 127 128 129 130 131 132 133 134 135 136

Assays for catalase activity

137

The catalase activity was determined using a Shimadzu spectrophotometer. Unless indicated otherwise, the assays were performed at 37 °C for 3 min in 2 mL of 20 mM PBS buffer (pH 7.0, containing 50 mM H2O2), and 8% H2SO4 was added to terminate the enzyme reaction. Aliquots of enzyme preparation were added to the reaction mixture (total volume, 3 mL), and the decrease in absorbance due to the conversion of hydrogen peroxide was monitored at 240 nm. An extinction coefficient of 43.6 M1 cm1 at 240 nm was used to calculate the specific activity [19]. One unit of catalase activity is defined as the amount of activity required to convert 1 lmol of hydrogen peroxide to water and oxygen per minute. All determinations were performed in three replicates, and the control experiment without catalase was carried out under the same conditions. R Version 3.1.1 (Vanderbilt University, USA) was used for the statistical analysis. The one-way ANOVA test was used, and a P value of 0.05 was deemed significant.

138

Gel electrophoresis of DNA and protein

155

DNA was electrophoresed on 0.75% agarose gels and visualized by staining with ethidium bromide. The loading buffer contained 60 mM Tris–HCl (pH 6.8), 10% (v/v) glycerol, 5 mM EDTA, and 0.01% bromophenol blue. The proteins were electrophoresed on 10% polyacrylamide gels containing 0.1% SDS under reducing conditions and visualized by staining with Coomassie Brilliant Blue R-250 [20].

156

Zymogram analysis of catalase

163

After electrophoresis, the gel was cut into two parts. One part was stained with 0.1% Coomassie Brilliant Blue R-250 and was used to analyze the size of catalase, and the other was washed twice with 2.5% (v/v) Triton X-100 for 30 min to remove the SDS. After washing, the gel was incubated with 0.1 M PBS buffer (pH 7.0) for 1 h at 4 °C to renature catalase, and was then stored in 20 mM PBS buffer (pH 7.0) at 4 °C for zymogram analysis. Gel sections with renatured catalase were incubated in 20 mM PBS agar plates containing 50 mM H2O2. After incubation at 37 °C for 5 min, the surface of the gel represented by bubbles indicated the existence of catalase. The stained gels were then compared with zymogram analysis, and the molecular weight of the catalase was determined [21].

164

Mass spectrometry analysis

177

Using the electrospray ionization quadrupole time-of-flight mass spectrometer (ESI-Q-TOF MS/MS) technique, an array of peptide masses from the enzymatic digest of the protein isolated from a native gradient gel was recorded (Bo-Yuan Biological Technology Co. Ltd.). These masses were then compared to theoretical mass values in the Mascot website databases (http:// www.matrixscience.com) to reveal amino acids sequences of peptide fragments.

178

Gene cloning, expression, and purification of the recombinant KatP

186

Genomic DNA was extracted from Pigmentiphaga sp. DL-8 cells and purified as described previously to serve as the PCR template [22]. Oligonucleotide primers were designed to amplify the katP gene (Table 1). Primers KatPF and KatPR were used to amplify internal 1232 bp of the katP gene. The 50 -nucleotide and 30 -nucleotide sequence was amplified by thermal asymmetric interlaced (TAIL)-PCR using the specific primer pairs, F-SP2 and F-SP1, and

187

Please cite this article in press as: W. Dong et al., Purification, cloning, expression, and biochemical characterization of a monofunctional catalase, KatP, from Pigmentiphaga sp. DL-8, Protein Expr. Purif. (2015), http://dx.doi.org/10.1016/j.pep.2015.01.011

139 140 141 142 143 144 145 146 147 148 149 150 151 152 153 154

157 158 159 160 161 162

165 166 167 168 169 170 171 172 173 174 175 176

179 180 181 182 183 184 185

188 189 190 191 192 193

YPREP 4643

No. of Pages 8, Model 5G

6 February 2015 3

W. Dong et al. / Protein Expression and Purification xxx (2015) xxx–xxx Table 1 Oligonucleotide primers used in PCR. Sequence (50 –30 )

Design basis

Position in katP gene

KatP-F

CATATGAGCGACAAGACTTCCCT

Forward primer for katP

1–20

KatP-R

AAGCTTCTAGTGGTGGTGGTGGTG AGGTGGGCCTTGTACTGGGCCT GNGARAARGTNCCNGARMG ACNGGNSWNCKNACNCCNCC GGCCACGCGTCGACTAGT ACNNNNNNNNNNGATAT GGCCACGCGTCGACTAGT ACNNNNNNNNNNACGCC GGCCACGCGTCGACTAGTAC CCGGAGGAAAGCTGGGAGGT CGACTGGTCGATACCGTGGT GCATCTCCGTCCTGCAGCCT CCCTTGGCGTGGGGCTGGCG

Reverse primer for katP

1439–1455

Forward degenerate primer for katP Reverse degenerate primer for katP Arbitrary primer for Tail PCR

150–169 1362–1382 None

Arbitrary primer for Tail PCR

None

Arbitrary primer for Tail PCR Specific primer for Tail PCR Specific primer for Tail PCR Specific primer for Tail PCR Specific primer for Tail PCR

None 1201–1220 1327–1346 258–277 166–185

Primer

KatPF KatPR ARB1 ARB2 ARB3 F-SP1 F-SP2 R-SP1 R-SP2

Table 2 Bacterial strains and plasmids. Strains and plasmids Strains Pigmentiphaga sp. DL-8 E. coli DH5a BL21 (DE3) Plasmids pMD19-T pMD 19-T-katP pET-29a(+) pET-29a(+)-katP

Resource reference

Genotype or phenotype

Lab stock

Catalase+, Ampr, Smr

Lab stock Lab stock

Host strain for cloning vectors Host strain for expressing vectors

TaKaRa This study Lab stock This study

T–A clone vectors, Ampr pMD19-T derivative carrying katP Expression vector, Kmr pET-29a(+) derivative carrying katP

215

R-SP2 and R-SP1, and the arbitrary primers, ARB1, ARB2, and ARB3 as described previously [23]. The complete gene was PCRamplified using the following primers: KatPF, containing an Nde I site (underlined) at the initiation site of the katP gene; and KatPR, containing a Hind III site (underlined) after the stop codon and a 6 His tag before the stop codon. The PCR products were digested using NdeI and Hind III and inserted into the Nde I-Hind III sites of pET29a(+) to obtain the plasmid pET29a-katP. pET29a-katP was then transformed into E. coli BL21 (DE3) (Table 2). The transformed cells were grown in LB medium containing 50 lg/mL kanamycin at 37 °C until they reached mid-log phase; they were then induced with 0.2 mM IPTG at 18 °C for 24 h. Crude enzyme extracts of E. coli BL21 (DE3) were prepared using ultrasonic disruption as described above. The recombinant KatP with a 6 His tag was purified with Ni2+-NTA resin (Qiagen, Valencia, CA, USA) [24]. After elution of non-target proteins with 25 mM imidazole in 20 mM PBS (pH 7.0), the target fusion protein was eluted with 100–300 mM imidazole in 20 mM PBS (pH 7.0). The fractions containing recombinant KatP were collected and dialyzed against 20 mM PBS (pH 7.0) overnight at 4 °C to remove imidazole.

216

Amino acid sequences analysis

217

The deduced amino acid sequence of Pigmentiphaga sp. DL-8 was blasted in the PDB database (http://www.rcsb.org/pdb/ home/home.do). Fourteen amino acid sequences of catalases from different families were chosen for alignment by Bioedit Version 7.0.9.0. The phylogenetic relationships of the 14 sequences were generated by using CLUSTALX version 1.8 and the software packages MEGA version 4.1. Unrooted phylogenetic trees were constructed using neighbor joining [25], and they were evaluated by bootstrap resampling (1000 replications).

194 195 196 197 198 199 200 201 202 203 204 205 206 207 208 209 210 211 212 213 214

218 219 220 221 222 223 224 225

Kinetic parameters of the recombinant KatP (Km and Vmax)

226

The effect of H2O2 concentration (5–30 mM) on catalase activity was evaluated in 20 mM of PBS buffer (pH 7.0) at 20 °C. The kinetic parameters (Michaelis–Menten constant, Km, and maximal reaction velocity, Vmax) were estimated by linear regression from double-reciprocal plots according to Lineweaver and Burk [26].

227

Effects of pH and temperature on the recombinant KatP activity and stability

232

The optimal reaction pH was assessed in several buffers of varying pH at 37 °C. The following buffers were used: 20 mM citrate buffer, pH 3.0–6.0; 20 mM PBS, pH 6.0–8.0; 20 mM Tris–HCl buffer, pH 8.0–8.8; and 20 mM glycine–NaOH buffer, pH 8.8–11.0. The optimal reaction temperatures were determined using the optimal pH at temperatures from 20 to 70 °C. To measure pH stability, the enzyme was incubated at 4 °C for 24 h in different buffers, and the residual activity was determined using the enzyme assay conditions described earlier. The thermal stability of KatP was assessed by incubating the enzyme preparations at different temperatures. Aliquots were removed at specific time intervals, and the activity remaining was measured using the enzyme assay conditions described earlier. Non-heated enzyme was used as a control (100%).

234

Effect of metal ions on the recombinant KatP activity

248

The effects of potential inhibitors or activators on the enzymatic activity of KatP were determined by adding 1 mM of various metal salts (Cu2+, K+, Fe2+, Co2+, Ni2+, Zn2+, Ca2+, Mg2+, Cr3+ and Mn2+) to the reaction mixture that had been pre-incubated for 10 min at 37 °C. Enzyme activity without any additive was used as a control and defined as 100%.

249

Nucleotide sequence accession number

255

The sequence for the catalase gene, katP, has been deposited in the GenBank database under the accession number KM925018.

256

Results

258

Purification of KatP from Pigmentiphaga sp. DL-8

259

The catalase KatP is a constitutive enzyme in Pigmentiphaga sp. DL-8. When cultivated in LB media, DL-8 showed high KatP activity (up to 5500 U/mg) without the addition of any inductive compounds. A summary of the purification process for KatP is shown

260

Please cite this article in press as: W. Dong et al., Purification, cloning, expression, and biochemical characterization of a monofunctional catalase, KatP, from Pigmentiphaga sp. DL-8, Protein Expr. Purif. (2015), http://dx.doi.org/10.1016/j.pep.2015.01.011

228 229 230 231

233

235 236 237 238 239 240 241 242 243 244 245 246 247

250 251 252 253 254

257

261 262 263

YPREP 4643

No. of Pages 8, Model 5G

6 February 2015 4

W. Dong et al. / Protein Expression and Purification xxx (2015) xxx–xxx

Table 3 Purification of catalase KatP from DL-8 and recombinant KatP from E. coli.

Purification step from DL-8 Crude extract of DL-8 Ammonium sulfate precipitation Hydrophobic chromatography DEAE-sepharose chromatography

Total protein (mg)

Total activity (U)

Specific activity (U mg1)

Purification fold

Yield (%)

177 49 11 0.9

970,000 740,000 470,000 66,000

5500 15,000 44,000 73,000

1.0 2.7 7.9 13.3

100 76 48 7

199,000,00 126,000,00

95,000 690,000

1.0 7.3

100 64

Purification step from E. coli harboring pET-29a(+)-katP Crude extract 209 Ni2+-NTA resin 18

Fig. 1. Zymogram analysis and molecular weight measurements of the KatP by SDS–PAGE. Lane 1 and lane 4 protein molecular weight markers; lane 2 purified KatP from DL-8; lane 3 catalase activity zymogram analysis; lane 5 boiled purified KatP from DL-8.

277

in Table 3. After the three-step purification process, there was a 13.3-fold increase in purification of KatP, with a 6.5% recovery. The purified sample of catalase exhibited a specific catalytic activity of 73,000 U/mg, which is higher than of catalase-1 in C. terrigena N3H (55,900 U/mg) [4]. SDS–PAGE was then used to analyze the purified KatP to verify its purity and determine its molecular weight. As shown in Fig. 1, the protein band had a molecular weight of more than 97 kDa with catalase activity formed numbers of bubbles based on SDS–PAGE with protein refolding. While boiled enzyme without catalase activity formed a band with a molecular weight of 50 kDa (Fig. 1). Thus, we proposed that the purified catalase was homopolymer and disulfide bond was not completely broken in the non boiling.

278

MS peptide sequence

279

The peptide mass fingerprint from LC–MS/MS were used as a query against the NCBI Protein database (MASCOT search), and the results are represented in Table 4. After inspection of these masses and the respective deduced sequences, it was possible to

264 265 266 267 268 269 270 271 272 273 274 275 276

280 281 282

employ Blast searches to localize the sequences to that of related bacterial catalases. The sequence was, in turn, identically matched to Halomonas stevensii (gi|515481285), Rhodanobacter fulvus (gi|494141011), Micrococcus luteus (gi|516058700) and Mycobacterium sp. (gi|517427750).

283

Cloning and expression of the katP gene

288

The short amino acid sequences in Table 4 were used to design primers to amplify the katP gene from the genome of strain DL-8. The primers KatPF and KatPR were used to amplify the internal 1232 bp of katP, while the terminal ends of the nucleotide sequence were amplified by TAIL-PCR. Based on the 50 and 30 information obtained from these reactions, oligonucleotides for the complete nucleotide sequence were designed, which was then PCR-amplified using genomic DNA as the template. The cloned katP gene was 1458 bp in length, encoding a 485-amino acid protein with a calculated molecular mass of 54 kDa. The overexpression of KatP in E. coli BL21 was successful. The expressed and purified recombinant KatP was analyzed using SDS–PAGE and the recombinant KatP was eluted with concentration of 300 mM imidazole by Ni2+-NTA resin (Fig. 2). The specific activities of recombinant KatP for hydrogen peroxide (690,000 U/mg) increased 9-fold over that of the parent strain (Table 3). It is worth mentioning that 10% SDS–PAGE analysis revealed that recombinant KatP formed two bands with molecular mass of approximately 54 kDa (monomer) and 200 kDa (polymer) (Fig. 2). The monomer protein band did not exhibit any catalase and peroxidase activity. The catalase activity of polymer protein band was revealed by activity staining, however, the purified protein did not exhibit any peroxidase activity (data not shown). Collectively, this data indicates that the KatP from Pigmentiphaga sp. DL-8 formed polymer with catalase activity, and the monomer molecular mass of 54 kDa without catalase activity.

289

Sequence analysis

315

The corresponding protein was searched against the GenBank database using the BLASTP program (http://blast.ncbi.nlm.nih.

316

Table 4 Results of peptide mass of fingerprint analysis. ID

Protein

Strain

Peptide

Molecular weight

gi|498504818

Hypothetical protein

Pandoraea sp. SD 6–2

gi|515481285

Catalase

Halomonas stevensii

gi|494141011

Catalase

Rhodanobacter fulvus

gi|397688910

Hypothetical protein

Pseudomonas stutzeri

gi|516058700 gi|516659072 gi|517427750

Catalase Hypothetical protein Catalase

Micrococcus luteus Oligella urethralis Mycobacterium sp.

R.FSTVAGESGSPDTWR.D R.IGTNFHQLPVNRPK.V R.DVMDDAQR.E R.FSTVAGESGSPDTWR.D R.DLFEAIAR.G R.FSTVAGESGSPDTWR.D R.DLFEAIAR.G R.IGTNFHQLPVNRPK.V R.KDDDDFGQAGTLVR.E K.FYTTEGNYDLVGNNTPVFFVR.D R.IGTNFHQLPVNQPR.A

1595.74 1619.89 964.39 1595.74 933.49 1595.72 933.49 1619.88 1535.72 2452.17 1619.85

Please cite this article in press as: W. Dong et al., Purification, cloning, expression, and biochemical characterization of a monofunctional catalase, KatP, from Pigmentiphaga sp. DL-8, Protein Expr. Purif. (2015), http://dx.doi.org/10.1016/j.pep.2015.01.011

284 285 286 287

290 291 292 293 294 295 296 297 298 299 300 301 302 303 304 305 306 307 308 309 310 311 312 313 314

317

YPREP 4643

No. of Pages 8, Model 5G

6 February 2015 5

W. Dong et al. / Protein Expression and Purification xxx (2015) xxx–xxx

Fig. 2. Analysis of the expression and purification of recombinant KatP. Lane 1 protein molecular weight marker; lane 2 300 mM imidazole eluted sample; lane 3 200 mM imidazole eluted sample; lane 4 100 mM imidazole eluted sample; lane 5 50 mM imidazole eluted sample; lane 6 the flow through sample; lane 7 total protein of BL21 (DE3) harboring pET-29a(+)-katP induced by 0.2 mM IPTG; lane 8 total protein of BL21 (DE3) harboring pET-29a(+) as a control; lane 9 catalase activity zymogram analysis.

318 319 320 321 322 323 324 325 326 327 328 329 330 331 332 333 334 335 336 337 338 339 340

gov). The searches revealed that the most likely match was a clade 3 of a monofunctional catalase from Micrococcus lysodeikticus (70% identity). KatP contained the Leu in site 301, which was a significant feature of clade 3 of the monofunctional catalase [27]. Multiple sequence alignments of 14 related sequences belonging to different catalase families from PDB databases were presented in Fig. 3. Bacterial monofunctional catalases are divided into small and large monofunctional catalases that are approximately 55–69 kDa and 79–84 kDa in size, respectively. In addition to an active site, catalases also have NADPH and water molecule (H2O) binding sites, which are capable of dividing a monofunctional catalase into a small monofunctional catalase (typical catalase) and large monofunctional catalase (atypical catalase) [42]. According to the amino acid residues of bovine liver catalase sites (GenBank accession No. P00432) and alignment analysis of the amino acid sequence, the active sites of the catalases from Pigmentiphaga sp. DL-8 consisted of H59, N132, and S97. Its sites proximal to the heme-binding side were composed of P319, R348, Y341, M333, and H345, while sites distal to the heme-binding side contained N132, F136, and F144. The function of catalase-bound NADPH in bovine and human catalase is to both prevent and reverse the accumulation of compound II, an inactive form of catalase that is generated slowly when

Fig. 4. Lineweaver–Burk plot of the recombinant KatP from Pigmentiphaga sp. DL-8.

catalases are exposed to hydrogen peroxide [43]. Amino acid residues involved in NADPH binding sites of the catalase were H177, D185, and R186. In the bovine catalase, a water molecule has been considered to possibly be involved in the redox mechanism of NADPH [44], and the amino acid residues involved in such procedures were K216, M195, and H218 (data not shown).

341

Kinetic analysis of the recombinant KatP

347

The kinetic parameters of the recombinant catalase were analyzed using a Lineweaver–Burk plot (Fig. 4). The Km and Vmax for KatP at 37 °C were 9.48 mM and 81.2 mol/min mg, respectively.

348

Effects of pH and temperature on enzyme activity and stability of recombinant KatP

351

The effects of temperature and pH on the catalase activity of KatP were assayed using purified enzyme. Recombinant KatP exerted high levels of activity at a pH range of 6.0–7.0, with an optimum pH of 7.0 (Fig. 5a). Little activity was detected at a pH’s below 3.0 or above 11.0, but KatP retained >60% activity after storage at a pH range of 4.0–11.0 for 24 h (Fig. 5b). The enzyme was active at 5–70 °C, with an optimum temperature of 37 °C (Fig. 5c). The thermal stability of the purified enzyme was assessed

353

Micrococcus lysodeikticus MLC (1GWE)

100

Pigmentiphaga sp. DL-8 KatP

56

Enterococcus faecalis EFC (1SI8)

85

Clade 3

Helicobacter pylori HPC (1QWL) Proteus mirabilis PMC (2CAG)

97 100

99

Monofunctional

Vibrio salmonicida VSC (2ISA) Pseudomonas syringae CatF(1M7S)

92

Exiguobacterium oxidotolerans EKTA (2J2M) Penicillium vitale PVC (2IUM)

62 99

catalase Clade 1

Clade2

Neurospora crassa CAT-1 (1SY7) Mycobacterium tuberculosis MtCP (1SJ2) Haloarcula marismortui HmCPx (1ITK)

100 52

Catalaseperoxidase

Burkholderia pseudomallei KatG (1MWV) Lactobacillus plantarum LPC (1JKU) Mn-catalase

100

Thermusther mophilus TTC (2V8U)

0.2

Fig. 3. Phylogenetic tree of KatP and related catalase constructed by the neighbor-joining method. Numbers at branching points represent values from 1000 replicates. KatP was aligned with the following proteins from the PDB database, with their preferred structure indicated: 1GWE, 1SI8, 1QWL, 2CAG, 2ISA, clade 3 of monofunctional catalase [28–32]; 2IUM, 1SY7, clade 2 of monofunctional catalase [33,34]; 1M7S, 2J2M, clade 1 of monofunctional catalase [35,36]; 1SJ2, 1ITK, 1MWV, catalase-peroxidase [37–39]; and 1JKU, 2V8U, Mn-catalase [40,41].

Please cite this article in press as: W. Dong et al., Purification, cloning, expression, and biochemical characterization of a monofunctional catalase, KatP, from Pigmentiphaga sp. DL-8, Protein Expr. Purif. (2015), http://dx.doi.org/10.1016/j.pep.2015.01.011

342 343 344 345 346

349 350

352

354 355 356 357 358 359 360

YPREP 4643

No. of Pages 8, Model 5G

6 February 2015 6

W. Dong et al. / Protein Expression and Purification xxx (2015) xxx–xxx

Fig. 5. Effects of pH and temperature on enzyme activity and stability of the recombinant KatP. (a) Determination of the optimal pH. Assays were carried at 37 °C for 3 min in buffers of varying pH. (b) pH stability. Activity was measured under optimal conditions (20 mM PBS, pH 7.0, 37 °C, 7 min) after incubation of the purified enzyme with buffers of varying pH at 4 °C for 24 h. (c) Determination of the optimal temperature. Activity was measured in 20 mM PBS, pH 7.0, at 5–70 °C for 3 min. (d) Thermal stability. Activity was measured under optimal conditions after incubation of the enzyme at indicated temperatures for 35 h.

361 362 363 364 365 366 367 368

by incubating KatP for 35 h in the absence of substrate at 20–70 °C (Fig. 5d). KatP was stable and retained >50% residual activity for 10 h at temperatures 60 °C. This suggests that KatP is a mesophilic catalase enzyme. One-way ANOVA analysis of the data demonstrated significant variation for catalase activity at different pH values and temperatures (P < 0.05).

369

Effect of metal ions on the enzymatic activity of the recombinant KatP

370

Metal ions play an important role in the activity of enzymes. As shown in Table 5, treatment by 1 mM of either Fe3+ or Mg2+ strongly stimulated KatP enzyme activity, whereas treatment with Fe2+, K+, Ni2+, or Ca2+ had little effect on the enzyme activity, treatment with Mn2+ or Zn2+ strongly inhibited enzyme activity, And treatment with Cu2+ or Cr2+ completely inhibited KatP activity. One-way ANOVA analysis of the data demonstrated significant variation for catalase activity in different metal ions (P < 0.05).

371 372 373 374 375 376 377

Table 5 Effect of metal ions on enzyme activity of KatP. Metal ions

Concentration (mM)

Relative activity (%)

No addition Fe3+(FeCl3) Mg2+(MgCl2) Cu2+(CuCl2) Ca2+(CaCl2) Ni2+(NiCl2) K1+(KCl) Zn2+(ZnCl2) Cr2+(CrCl2) Mn2+(MnCl2) Fe2+(FeCl2)

0 1 1 1 1 1 1 1 1 1 1

100.00 ± 0.5 140.00 ± 5.2 109.00 ± 3.8 7.00 ± 3.6 94.00 ± 1.9 81.00 ± 4.8 99.00 ± 5.8 40.00 ± 2.9 3.00 ± 6.9 50.00 ± 1.8 95.00 ± 2.7

Discussion

378

In this study, a clade 3 of the monofunctional catalase, KatP, was purified from Pigmentiphaga sp. for the first time. The 13.3-fold increase in purification achieved in this study was lower than that in other reports. A literature survey revealed that the fold purification ranged from 54.1-fold for a catalase from Vibrio rumoiensis S1T [45] to 1538-fold for a catalase from Methanosarcina barkeri [46]. The purified sample of the catalase, KatP, exhibited a specific catalytic activity of 73,000 U/mg, which was higher than that for catalase-1 from both C. terrigena N3H (55,900 U/mg) [4] and Bacillus sp. TE124 (35,200 U/mg) [9]. The low fold purification obtained from the above procedure was accompanied by a high purity of catalase production, which was conducive to the use of mass spectrometric analysis. The protein had a large molecular weight approximately 200 kDa and a subunit size of approximately 54 kDa. Thus, we proposed that the purified monofunctional catalase was a homotetramer based on molecular weight and amino acid sequences. The subunit number and native enzyme sizes for this monofunctional enzyme were similar to those of bacteria (i.e., Vibrio rumoiensis S1T, with 230 kDa and 57.3 kDa, respectively [45], a halophilic bacterium, with 240 kDa and 68 kDa, respectively [46], Deinococcus radiodurans, with 240 kDa and 65 kDa, respectively [47]). However, we could not prove the formation of tetramer following denaturing electrophoresis. In future studies, we will attempt to address these issues. Rapid advances in protein analytics, fueled by the addition of MS and sequence databases, have made it possible for protein chemists to both identify new proteins and design primers for genetic cloning [48,49]. This paper describes the design and construction of a system for the high level production of Pigmentiphaga sp. DL-8 KatP in E. coli BL21 (DE3). The specific activities of recombinant KatP on hydrogen peroxide (690,000 U/mg) increased 9-fold

379

Please cite this article in press as: W. Dong et al., Purification, cloning, expression, and biochemical characterization of a monofunctional catalase, KatP, from Pigmentiphaga sp. DL-8, Protein Expr. Purif. (2015), http://dx.doi.org/10.1016/j.pep.2015.01.011

380 381 382 383 384 385 386 387 388 389 390 391 392 393 394 395 396 397 398 399 400 401 402 403 404 405 406 407 408 409 410

YPREP 4643

No. of Pages 8, Model 5G

6 February 2015 W. Dong et al. / Protein Expression and Purification xxx (2015) xxx–xxx

445

over that of the parent strain (73,000 U/mg). Furthermore, the enzyme displayed broad ranges of both pH stability (pH 4.0– 11.0) and thermal stability (20–50 °C), and matched the behavior of other typical catalases. The catalase from Serratia marcescens SYBC08, was found to be stable in the broad pH range from pH 5.0 to 11.0 [50]. The catalase activity of strain 2–1 was stable over the wide temperature and pH ranges of 30–60 °C and 5.0–11.0, respectively [51]. The catalase derived from strain DL-8 was more stable at high temperatures than that from M. luteus, which is widely used for waste water treatment under wide pH or temperature conditions [51]. Catalase is primarily responsible for the metabolism of hydrogen peroxide, and is an essential antioxidant enzyme that is evolutionarily preserved from bacteria to animals [52]. Amino acid residues of the catalase, KatP, in the active sites (H59, N132, and S97), NADPH binding sites (H177, D185, and R186), heme proximal sites (P319, R348, Y341, and M333), heme distal sites (N132, F136, and F144), and sites interacting with water molecules (K216 and M195) were all well conserved in typical monofunctional catalases. The Met in Proteus mirabilis PR could produce some steric hindrance, impairing the accessibility of large substrates or inhibitors to the iron of the active site. Thus, the result of replacing Met with Val was a significantly greater sensitivity to aminotriazole, a specific inhibitor of catalases in P. mirabilis PR [53]. Other replacements of the residues from KatP (i.e., R52K, H149R, and I138V) further support a degree of specificity in their catalytic behaviors. In summary, a high efficient catalase was obtained by using Pigmentiphaga sp. DL-8 in this study. Amino acid sequences and biochemical characterization of KatP confirmed that the cloning gene was the encoding gene of the typical monofunctional enzyme. The KatP had highly conserved catalytic behaviors, and we identified several residue mutations that may warrant further research to verify their effects on these catalytic behaviors. Moreover, the catalase from strain DL-8 was stable at high temperatures, which are widely used for industrial catalase production.

446

Acknowledgments

447

454

This work was financially supported by the 863 Project (Grant No. 2013AA102804), the Natural Science Foundation of Jiangsu Province (No. BK2012029), the Natural Science Foundation of China (No. 31270095), the National Science and Technology Support Program (No. 2012BAD14B02), the Natural Science Foundation of China (No. 31400098), Graduate Culture and Innovation Project of Jiangsu Province (No. KYLX_0514) and the China Postdoctoral Science Foundation (No. 2013M541685).

455

Appendix A. Supplementary data

456 457

Supplementary data associated with this article can be found, in the online version, at http://dx.doi.org/10.1016/j.pep.2015.01.011.

458

References

411 412 413 414 415 416 417 418 419 420 421 422 423 424 425 426 427 428 429 430 431 432 433 434 435 436 437 438 439 440 441 442 443 444

448 449 450 451 452 453

459 460 461 462 463 464 465 466 467 468 469 470 471 472 473

[1] J.G. Scandalios, The rise of ROS, Trends Biochem. Sci. 27 (2002) 483–486. [2] B.S. Berlett, E.R. Rtadtman, Protein oxidation in aging, disease, and oxidative stress, J. Biol. Chem. 272 (1997) 20313–20316. [3] J.A. Imlay, Pathways of oxidative damage, Annu. Rev. Microbiol. 57 (2003) 395–418. [4] M. Zámocky, J. Godobíková, J. Ganperík, F. Koller, B. Poleka, Expression, purification, and sequence analysis of catalase-1 from the soil bacterium Comamonas terrigena N3H, Protein Expr. Purif. 36 (2004) 115–123. [5] J. Basran, N. Bhanji, A. Basran, D. Nietlispach, S. Mistry, R. Meskys, N.S. Scruton, Mechanistic aspects of the covalent flavo protein dimethylglycine oxidase of Arthrobacter globiformis studied by stopped flow spectrophotometry, Biochemistry 41 (2002) 4733–4743. [6] M. Zámocky, F. Koller, Understanding the structure and function of catalases: clues from molecular evolution and in vitro mutagenesis, Prog. Biophys. Mol. Biol. 72 (1999) 19–66.

7

[7] P. Nicholls, I. Fita, P.C. Loewen, Enzymology and structure of catalases, Adv. Inorg. Chem. 51 (2001) 51–90. [8] S. Ebara, Y. Shigemori, Alkali-tolerant high-activity catalase from a thermophilic bacterium and its overexpression in Escherichia coli, Protein Expr. Purif. 57 (2008) 255–260. [9] J. Ni, S. Tokuyama, A. Sogabe, Y. Kawamura, Y. Tahara, Cloning and high expression of catalase gene from Bacillus sp. TE124, J. Biosci. Bioeng. 4 (2001) 422–424. [10] H. Kimoto, H. Matsuyama, I. Yumoto, K. Yoshimune, Heme content of recombinant catalase from Psychrobacter sp. T-3 altered by host Escherichia coli cell growth conditions, Protein Expr. Purif. 59 (2008) 357–359. [11] V. Calandrelli, A. Gambacorta, I. Romano, V. Carratore, A novel thermo-alkali stable catalase–peroxidase from Oceanobacillus oncorhynchi subsp. Incaldaniensis: purification and characterization, World J. Microbiol. Biotechnol. 24 (2008) 2269–2275. [12] E. Akertek, L. Tarhan, Characterization of immobilized catalases and their application in pasteurization of milk with H2O2, Appl. Biochem. Biotechnol. 50 (1995) 291–303. [13] J. Fiedurek, A. Gromada, Screening and mutagenesis of molds for improvement of simultaneous production of catalase and glucose oxidase, Enzyme Microb. Technol. 20 (1997) 344–347. [14] Z.Z. Hua, G.L. Yan, G.C. Du, J. Chen, Study and improvement of the conditions for production of a novel alkali stable catalase, Biotechnol. J. 2 (2007) 326–333. [15] H.S. Ko, H. Fujiwara, Y. Yokoyama, N. Ohno, Inducible production of alcohol oxidase and catalase in a pectin medium by Thermoascus aurantiacus IFO 31693, J. Biosci. Bioeng. 99 (2005) 290–292. [16] X.L. Shi, M.Q. Feng, Y.J. Zhao, X. Guo, Overexpression, purification and characterization of a recombinant secretary catalase from Bacillus subtilis, Biotechnol. Lett. 373 (2008) 1316–1323. [17] M.M. Bradford, A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding, Anal. Biochem. 72 (1976) 248–254. [18] F. Wang, H. Ying, J. Zhou, Z.K. Li, Y. Huang, Z.L. Cui, Purification of an amide hydrolase DamH from Delftia sp. T3–6 and its gene cloning, expression, and biochemical characterization, Appl. Microbiol. Biotechnol. 17 (2014) 7491–7499. [19] A.G. Hildebraunt, I. Roots, Reduced nicotinamide adenine dinucleotide phosphate (NADPH)-dependent formation and breakdown of hydrogen peroxide during mixed function oxidation reactions in liver microsomes, Arch. Biochem. Biophys. 171 (1975) 385–397. [20] U.K. Laemmli, Cleavage of structural proteins during the assembly of the head of bacteriophage T4, Nature 227 (1970) 680–685. [21] S. Bano, S.A.U. Qader, A. Aman, M.N. Syed, A. Azhar, Purification and characterization of novel-amylase from Bacillus subtilis KIBGE HAS, AAPS PharmSciTech. 12 (2011) 255–261. [22] J. Sambrook, D. Russell, Molecular Cloning, a Laboratory Manual, Cold Spring Harbor Laboratory, 2001. [23] R. Terauchi, G. Kahl, Rapid isolation of promoter sequences by TAIL-PCR: the 50 -flanking regions of Pal and Pgi genes from yams, Mol. Gen. Genet. 263 (2000) 554–560. [24] R. Janknecht, G. Martynoff, J. Lou, R.A. Hipskind, A. Nordheim, H.G. Stunnenberg, Rapid and efficient purification of native histidine-tagged protein expressed by recombinant Vaccinia virus, Proc. Natl. Acad. Sci. 88 (1991) 8972–8976. [25] K. Tamura, J. Dudley, M. Nei, S. Kumar, MEGA4: molecular evolutionary genetics analysis (MEGA) software version 4.0, Mol. Biol. Evol. 24 (2007) 1596–1599. [26] J.E. Dowd, D.S. Riggs, A comparison of estimates of Michaelis–Menten kinetic constants from various linear transformations, J. Biol. Chem. 240 (1965) 863– 869. [27] P. Chelikani, I. Fita, P.C. Loewen, Diversity of structures and properties among catalases, Cell. Mol. Life Sci. 61 (2004) 192–208. [28] G.N. Murshudov, A.I. Grebenko, J.A. Brannigan, The structures of Micrococcus lysodeikticus catalase, its ferryl intermediate (compound II) and NADPH complex, Acta Crystallogr. D 58 (2002) 1972–1982. [29] K.O. Håkansson, M. Brugna, L. Tasse, The three-dimensional structure of catalase from Enterococcus faecalis, Acta Crystallogr. D 60 (2004) 1374–1380. [30] P.C. Loewen, X. Carpena, C. Rovira, A. Ivancich, R. Perez-Luque, R. Haas, S. Odenbreit, P. Nicholls, I. Fita, Structure of Helicobacter pylori catalase, with and without formic acid bound at 1.6 A resolution, Biochemistry 43 (2004) 3089– 3103. [31] P. Andreoletti, A. Pernoud, G. Sainz, P. Gouet, H.M. Jouve, Structural studies of Proteus mirabilis catalase in its ground state, oxidized state and in complex with formic acid, Acta Crystallogr. D 59 (2003) 2163–2168. [32] E.K. Riise, M.S. Lorentzen, R. Helland, A.O. Smalås, H.K. Leiros, N.P. Willassen, The first structure of a cold-active catalase from Vibrio salmonicida at 1.96 A reveals structural aspects of cold adaptation, Acta Crystallogr. D 63 (2007) 135–148. [33] M. Alfonso-Prieto, A. Borovik, X. Carpena, G. Murshudov, W. Melik-Adamyan, I. Fita, C. Rovira, P.C. Loewen, The structures and electronic configuration of compound I intermediates of Helicobacter pylori and Penicillium vitale catalases determined by X-ray crystallography and QM/MM density functional theory calculations, J. Am. Chem. Soc. 14 (2007) 4193–4205. [34] A. Díaz, E. Horjales, E. Rudiño-Piñera, R. Arreola, W. Hansberg, Unusual Cys-Tyr covalent bond in a large catalase, J. Mol. Biol. 342 (2004) 971–985. [35] X. Carpena, M. Soriano, M.G. Klotz, H.W. Duckworth, L.J. Donald, A.W. Melik, I. Fita, P.C. Loewen, Structure of the clade 1 catalase, CatF of Pseudomonas syringae, at 1.8 A resolution, Proteins 50 (2003) 423–436.

Please cite this article in press as: W. Dong et al., Purification, cloning, expression, and biochemical characterization of a monofunctional catalase, KatP, from Pigmentiphaga sp. DL-8, Protein Expr. Purif. (2015), http://dx.doi.org/10.1016/j.pep.2015.01.011

474 475 476 477 478 479 480 481 482 483 484 485 486 487 488 489 490 491 492 493 494 495 496 497 498 499 500 501 502 503 504 505 506 507 508 509 510 511 512 513 514 515 516 517 518 519 520 521 522 523 524 525 526 527 528 529 530 531 532 533 534 535 536 537 538 539 540 541 542 543 544 545 546 547 548 549 550 551 552 553 554 555 556 557 558 559

YPREP 4643

No. of Pages 8, Model 5G

6 February 2015 8 560 561 562 563 564 565 566 567 568 569 570 571 572 573 574 575 576 577 578 579 580 581 582 583 584 585 586 587

W. Dong et al. / Protein Expression and Purification xxx (2015) xxx–xxx

[36] I. Hara, N. Ichise, K. Kojima, H. Kondo, S. Ohgiya, H. Matsuyama, I. Yumoto, Relationship between the size of the bottleneck 15 A from iron in the main channel and the reactivity of catalase corresponding to the molecular size of substrates, Biochemistry 46 (2007) 11–22. [37] T. Bertrand, N.A. Eady, J.N. Jones, Jesmin J.M. Nagy, B. Jamart-Grégoire, E.L. Raven, K.A. Brown, Crystal structure of Mycobacterium tuberculosis catalaseperoxidase, J. Biol. Chem. 279 (2004) 38991–38999. [38] Y. Yamada, T. Fujiwara, T. Sato, N. Igarashi, N. Tanaka, The 2.0 A crystal structure of catalase-peroxidase from Haloarcula marismortui, Nat. Struct. Biol. 9 (2002) 691–695. [39] X. Carpena, S. Loprasert, J. Mongkolsuk, P.C. Switala, I. Loewen Fita, Catalaseperoxidase KatG of Burkholderia pseudomallei at 1.7 A resolution, J. Mol. Biol. 327 (2003) 475–489. [40] V.V. Barynin, M.M. Whittaker, S.V. Antonyuk, V.S. Lamzin, P.M. Harrison, P.J. Artymiuk, J.W. Whittaker, Crystal structure of manganese catalase from Lactobacillus plantarum, Structure 9 (2001) 725–738. [41] S. Antonyuk, V. Melik-Adamyan, A. Popov, V. Lamzin, P. Hempstead Harr, Three-dimensional structure of the enzyme dimanganese catalase from Thermus thermophilus at 1 Å resolution, Crystallogr. Rep. 45 (2000) 105–116. [42] M. Zamocky, F. Koller, Understanding the function of catalases: clues from molecular evolution and invitro mutagenesis, Prog. Biophys. Mol. Biol. 72 (1999) 19–66. [43] H.N. Kirkman, S. Galiano, G.F. Gaetani, The function of catalase-bound NADPH, J. Biol. Chem. 262 (1987) 660–666. [44] I. Fita, M.G. Rossmann, The NADPH binding site on beef liver catalase, Proc. Natl. Acad. Sci. 82 (1985) 1604–1608. [45] I. Yumoto, D. Ichihashi, H. Iwata, A. Istokovics, N. Ichise, H. Matsuyama, H. Okuyama, K. Kawasaki, Purification and characterization of a catalase from the

[46]

[47]

[48]

[49]

[50]

[51]

[52]

[53]

facultatively psychrophilic bacterium Vibrio rumoiensis S1T exhibiting high catalase activity, J. Bacteriol. 182 (2000) 1903–1909. N.J. Brown-Peterson, M.L. Salin, Purification and characterization of a mesohalic catalase from the halophilic bacterium Halobacterium halobium, J. Bacteriol. 177 (1995) 378–384. I. Kobayashi, T. Tamura, H. Sghaier, I. Narumi, S. Yamaguchi, K.U. Meda, K. Inagaki, Characterization of monofunctional catalase KatA from radio resistant bacterium Deinococcus radiodurans, J. Biosci. Bioeng. 101 (2006) 315–321. M.Z. Sun, S.Q. Liu, F. Yang, F.T. Greenaway, Y.F. Xu, A novel phospholipase A2 from Agkistrodon Blomhoffii ussurensis venom: purification, proteomic, functional and structural characterizations, Biochimie 91 (2009) 558–567. C. Vafiadi, E. Topakas, P. Biely, P. Christakopoulos, Purification, characterization and mass spectrometric sequencing of a thermophilic glucuronoyl esterase from Sporotrichum thermophile, FEMS Microbiol. Lett. 296 (2009) 178–184. H.W. Zeng, Y.J. Cai, X.R. Liao, F. Zhang, D.B. Zhang, Production, characterization, cloning and sequence analysis of a monofunctional catalase from Serratia marcescens SYBC08, J. Basic Microbiol. 50 (2010) 1–10. M. Nakayama, T. Nakajima-Kambe, H. Katayama, K. Higuchi, High catalase production by Rhizobium radiobacter strain 2–1, J. Biosci. Bioeng. 106 (2008) 554–558. G.S. Gerhard, E.J. Kauffman, M.A. Grundy, Molecular cloning and sequence analysis of the Daniorerio catalase gene, Comp. Biochem. Physiol. B 127 (2000) 447–457. H.M. Jouve, C. Lasauniere, J. Pelmont, Properties of a catalase from a peroxide resistant mutant of Proteus mirabilis, Can. J. Biochem. Cell Biol. 61 (1983) 1219–1227.

Please cite this article in press as: W. Dong et al., Purification, cloning, expression, and biochemical characterization of a monofunctional catalase, KatP, from Pigmentiphaga sp. DL-8, Protein Expr. Purif. (2015), http://dx.doi.org/10.1016/j.pep.2015.01.011

588 589 590 591 592 593 594 595 596 597 598 599 600 601 602 603 604 605 606 607 608 609 610 611 612 613 614 615