Environment Health Techniques Characterization of chitinase from Stenotrophomonas maltophilia
1
Research Paper Purification, characterization, and gene cloning of a chitinase from Stenotrophomonas maltophilia N4 Urszula Jankiewicz1 and Maria Swiontek Brzezinska2 1 2
Department of Biochemistry, Warsaw University of Life Sciences, SGGW, Warsaw, Poland Department of Environmental Microbiology and Biotechnology, Institute of Ecology and Environmental Protection, Nicolaus Copernicus University, Torun, Poland
The Stenotrophomonas maltophilia synthesises high-activity chitinase in response to chitin or chitosan induction. The enzyme was purified 8.5 fold and subjected to characterisation. The optimum hydrolysis conditions for this enzyme when using colloidal chitin as substrate were pH 5.6 and temperature of 45 °C. The enzyme demonstrated high thermal stability at 45 °C within 2 h. The studied chitinase exhibited high activity towards colloidal chitin, glycol chitin and chitosan, while it did not hydrolyse glycosidic bonds in carboxymethylcellulose. The enzyme exhibited the highest activity, equalling 90 U/ml, towards Nitrophenyl b-D-N,N0 ,N00 -triacetylchitotriose and activity of 37 U/ml towards 4-Nitrophenyl N,N0 -diacetyl-b-D-chitobioside. The Km value in the presence of the two former substrates was:1.2 and 3.9 mM, respectively, which classifies the studied enzyme as an endochitinase. Cysteine and 2-mercaptoethanol stimulated to a small degree the activity of the chitinase which may indicate the involvement of cysteine residues in the catalysis mechanism. The full length of the nucleotide sequence of this chitinase gene is 2106 bp, which amounts to 702 amino acids. Abbreviations: PMSF – Phenylmethanesulfonyl f luoride; EDTA – Ethylenediaminetetraacetic acid; CMC – Carboxymethylcellulose; DNS–3 5 – Dinitrosalicylic acid Keywords: Stenotrophomonas maltophilia / Chitinase / Substrate specificity / Characterization / Gene cloning Received: September 12, 2014; accepted: November 9, 2014 DOI 10.1002/jobm.201400717
Introduction Chitin is a high-molecular-weight polysaccharide composed of b-N-acetyl-D-glucosamine (GlcNAc) residues linked by b-1,4-glycosidic bonds. Due to its mechanical resilience, chitin is the primary exoskeleton component of insects, crustaceans, certain molluscs and nematodes, as well as that of most fungal cell walls [1–3]. Enzymatic decomposition of chitin is a gradual process that involves chitinolytic enzymes belonging to the O-glycoside hydrolases subclass. So far, 115 families of glycoside hydrolases have been classified, three of which encompass chitinolytic enzymes: families 18, 19, and 20 [4, 5]. Due to the position of the hydrolysed bond, chitinases Correspondence: Urszula Jankiewicz, Department of Biochemistry, Warsaw University of Life Sciences-SGGW, Nowoursynowska 159, 02– 776 Warsaw, Poland E-mail: [email protected] Phone: þ48 22 5932560 Fax: þ48 22 5932562 ß 2014 WILEY-VCH Verlag GmbH & Co. KGaA,Weinheim
(EC.3.2.1.14) can be generally separated into endochitinases, which hydrolyse random bonds located in the chitin chain, detaching N-acetyl-chitin oligosaccharides, and exochitinases, which detach the disaccharide, chitobiose from the reducing or non-reducing end of the chitin chain. Furthermore, chitobiase and b-Nacetylglucosaminidase, which are currently included in the common b-N-acetylhexosaminidase group (EC.3.2.1.52), are also considered enzymes that participate in chitin hydrolysis [6–8]. Chitinolytic enzymes are synthesised by numerous organisms, in which they fulfil various roles, depending on the physiology and needs of their natural producers [9–13]. Chitinolytic microorganisms, such as bacteria and hypha fungi, utilise chitin as a source of nutrients. The presence of the –NHCOCH3 acetamide group at the second carbon in the sugar residue ring makes chitin a source of both carbon and nitrogen for many microorganisms [7].
www.jbm-journal.com
J. Basic Microbiol. 2014, 54, 1–9
2
Urszula Jankiewicz and Maria Swiontek Brzezinska
Secretion of chitinolytic enzymes by bacteria is considered to be one of the more important mechanisms of biocontrol, which other bacterial metabolites, e.g., 1,3-glucanases, proteases, antibiotics or siderophores can also participate in [14]. Elimination of plant pests using biological agents is a perfect complement to commonly utilised chemical agents. For these reasons, chitinases are the subject of numerous studies, due to potential use in industry and in biological protection of plants [3, 15]. The chitinolytic bacteria include Stenotrophomonas maltophilia. Thanks to its ability to release chitinases and proteases, this bacterium can be used to curtail the growth of organisms harmful to plant cultivation, including moulds and nematodes The results of studies that substantially document fungiand nematodicidal properties of several chitinolytic strains belonging to this bacteria species have already been presented in the literature [16–18]. For this reason, the presented study focuses on the characteristics of chitinase synthesised by one of the strains of bacteria belonging to S. maltophilia. This bacterium has been selected for study due to its strong antagonism towards phytopathogenic Fusarium solani. The goal of the presented study was to optimise the growth medium composition for the purpose of acquiring high-activity chitinase, as well as characterise the purified enzyme, e.g. in terms of optimum conditions of action, substrate specificity, reaction to surfactants and other chemicals. Studies have also been undertaken with the goal of cloning the chitinase-coding gene of these bacteria.
Materials and methods Identification of microorganism The chitinase source in the presented study was the S. maltophilia isolated from the rhizosphere area of a cereal crop plant. The bacterial isolate was identified on the basis of morphological and biochemical traits according to Bergey’s Manual of Determinative Bacteriology [19]. Additionally, identification of the studied strain was confirmed by analysis of the 16 S rRNA gene sequence. Amplification of the 16 S rRNA gene was performed using 27 F and 1492 R universal primers [20], the matrix in PCR was genomic DNA isolated from bacteria cells during the late logarithmic growth phase using the Genomic DNA Purification Kit (Fermentas). The obtained nucleotide sequences were compared with sequences deposited in the available GenBank/EMBL/DDBJ databases using the BLAST program. ß 2014 WILEY-VCH Verlag GmbH & Co. KGaA,Weinheim
Bacteria cultivation conditions The bacterial culture was incubated for four days with shaking (120 rpm) at 28 °C. Bacterial cultures were grown and maintained in medium composed of (g/litre): KH2PO 4, 3; K2HPO 4, 3; MgSO4, 0.5; NaCl, 2; FeCl3, 0.005; soy peptone 2.5; yeast extract 1.5; colloidal chitin 6 g, the pH of the medium was adjusted to 6.8. The following growth media were used for substrate optimization: (g/litre): KH2PO4, 3; K2HPO4, 3; MgSO4, 0.5; NaCl, 2; FeCl3, 0.005; soy peptone 2.5; yeast extract 1.5, enriched with: 0.3, 0.6 and 1.0%, respectively, of chitosan (Sigma, Aldrich; 75% deacylated chitin from shrimp shell), colloidal chitin, glycol chitin, or chitin from shrimp shells in coarse flakes (Sigma) or powder form (Roth, from crab shells). Colloidal chitin was prepared according to Lee et al. [21] glycol chitin according to Trudel and Asselin [22]. Electrophoresis and zymography SDS–PAGE and zymogram analysis: Sodium dodecyl sulfate–polyacrylamide gel electrophoresis (SDS–PAGE) was carried out according to Laemmli [23].The supernatants were separated in 8% polyacrylamide gel containing 0.1% of glycol chitin. After electrophoresis, the gel was incubated at 40 °C in 0.1 M sodium acetate buffer pH 5.6 containing 0.2% Triton X-100 for 3 h. Finally, the gel was submerged for 30 min in a 0.01% solution of Congo Red dye, then transferred to 1 M NaCl solution. Enzyme activity determination Chitinase activity was determined with colloidal chitin as substrate. The incubation mixture contained 0.3 ml of suitably diluted enzyme and 0.3 ml of 1% colloidal chitin in 50 mM sodium acetate buffer pH 5.6 was used in the reaction mixture. The amount of reducing sugars released after a 90-min hydrolysis was determined using the spectrophotometric method with DNS [24]. A calibration curve was prepared for five concentrations of N-acetylglucosamine. One unit of chitinase activity (U) was defined as the amount of enzyme which yields 1 mmol of reducing sugar as N-acetyl-D-glucosamine (GlcNAc) equivalent per hour. The spectrum of substrates utilized by the enzyme was studied using the spectrophotometric method of activity determination with DNS. Purification of the enzyme The source of the studied chitinase was a clear supernatant obtained after centrifuging (12000g 10 min) and filtering 4-day cultures of S. maltophilia N4 bacteria. All
www.jbm-journal.com
J. Basic Microbiol. 2014, 54, 1–9
Characterization of chitinase from Stenotrophomonas maltophilia
stages of the enzyme purification were carried out at 4 °C. Precipitation with acetone: 5 volumes of cold acetone were added to the cooled supernatant. After thorough stirring, samples were left for 15 min in ice and subsequently centrifuged (16000g, 20 min). After drying, the protein precipitate was dissolved in 20 mM TrisHCl buffer, pH 6.8, and subsequently dialysed overnight in an identical buffer. The preparation was applied to a DEAE chromatographic ion-exchange bed, equilibrated, in 20 mM Tris-HCl buffer, pH 6.8. Proteins bonded to the bed were eluted in an NaCl gradient: 0.0–0.5 NaCl. Fractions where enzyme activity was detected were concentrated 20-fold (VIVASPIN 20, Sartorius stedim) and filtered using molecular sieve chromatography on a Superdex 200 bed. Separation of proteins was performed in 50 mM Tris-HCl buffer pH 6.8. Active fractions were dialyzed overnight and used for characterizing the enzyme. Determination of protein content Protein concentration was determined using the method of Bradford [25] with bovine serum albumin as a standard. Biochemical characterization of purified enzyme Effects of metal ions and EDTA: Before substrate was added to the incubation mixture, the enzyme was kept with the studied ions and EDTA for 30 min. at room temperature. Effects of other chemical compounds were tested by way of the standard method, utilising colloidal chitin as substrate. Enzyme kinetics were studied using colloidal, glycol chitin and chitosan as substrates (1–35 mg/ml), suspended in 50 mM sodium acetate buffer. Standard procedure utilizing a Lineweaver-Burke plot was applied to determine the Km value. Kinetic properties, as well as the enzyme substrate specificity were also determined using synthetic substrates, p-nitrophenyl derivatives of N-acetylglucosamine (Chitinase Assay Kit, CS0980, Sigma-Aldrich). One unit of chitinase activity (U) was defined as the amount of enzyme which yields 1 mmol of p-nitrophenol per minute per 10 ml of purified enzyme. Cloning the SM4 chitinase-coding gene of S. maltophilia N4 The chitinase-coding gene was amplified using genomic DNA of S. maltophilia and two oligomeric primers of the following sequence: F: 5’TTACCATGGGCTACGACCCGATTGTG and R: 5’CGCAAGCTTTTACTTCAGGCCATCACTG. ß 2014 WILEY-VCH Verlag GmbH & Co. KGaA,Weinheim
3
The primers were designed on the basis of a nucleotide sequence (available in GenBank: YP_006183343) encoding chitinase in S. maltophilia D457 (GenBank: HE798556). The following PCR conditions were applied: an initial denaturation step at 94 °C for 2 min followed by 30 cycles of 94 °C for 45 s, 59 °C for 2 min, and 72 °C for 2.15 min; the final extension step was performed at 72 °C for 9 min. The chitinase gene amplification reaction was carried out using the following set of reagents: Phusion Hot Start Flex 2x Master Mix (M0536G, BioLabs). After purification, the PCR product was ligated into the pJET cloning vector (CloneJET PCR cloning Kit, 1232, Thermo Scientific). Chemocompetent cells of Escherichia coli DH5a were used for the transformation. Transformants were grown in LB medium with ampicillin (50 mg/ml). Plasmids isolated from E. coli transformants were sequenced in the DNA Sequencing laboratory (Biochemistry and Biophysics Institute of the Polish Academy of Sciences). The nucleotide sequence and deduced amino acid sequence were analyzed using Blast server. The obtained nucleotide sequence of the 16 S rRNA gene and the nucleotide sequence of chitinase Sm4 gene were deposited in DDBJ under accession numbers AB667906 and AB973459, respectively. All results presented in this paper in the form of numerical values are means from three independent repetitions. The mean error, reflecting maximal deviation of the results of measurements from the mean, did not exceed 5%.
Results The studied isolate was subjected to identification by classical methods, including microscopic observation of stained preparations and API tests. These results were confirmed by analysis of the nucleotide sequence of the 16 S rRNA coding gene, acquired in the course of our research. This sequence was compared with data deposited in the available GenBank/EMBL/DDBJ databases using the BLAST program. The obtained results allowed to classify this bacterial strain as S. maltophilia and it was given the strain name S. maltophilia N4. The highest chitinase activity was achieved on the fourth day of cultivation, after which a slow decline in subsequent days of the experiment was observed. The differences in chitinolytic activity were demonstrated in 4-day cultures of the S. maltophilia N4 strain, cultivated in liquid mineral media, enriched with soy peptone, yeast extract and various forms and concentrations of chitin and chitosan (Fig. 1). Each of the utilized polysaccharide
www.jbm-journal.com
J. Basic Microbiol. 2014, 54, 1–9
4
Urszula Jankiewicz and Maria Swiontek Brzezinska
Figure 1. Effect on different substrates on chitinase production by Stenotrophomonas maltophilia N4.
component of media stimulated chitinase activity of the N4 strain. The maximum activity of 2.1 U/ml was achieved during cultivation of bacteria on a medium containing a 1.0% addition of colloidal chitin (CC). A high activity was also achieved in bacteria cultures cultivated in media with added powdered crab shells (CP), as well as shrimp shells in coarse flakes (CF) and chitosan (CT) form. Lower activity results were acquired after adding glycol chitin (GC) to the media. Chitinase activity was also dependent on the concentration of added polysaccharides; the lowest activity was determined when their concentration in the substrate was 0.3%, higher concentration of polysaccharide components resulted in higher activity of the tested enzyme. However, no significant differences were noted between the concentration of 0.6 and 1.0% of these components in the medium. Regardless of the substrate in a culture medium a single a single zone of clearing was observed by zymogram after electrophoresis (Fig. 2). Thus, bacteria cultures on media containing 1.0% CC were used for further testing. On the other hand, activity several times lower was observed in mineral media without additions of chitin or chitosan, and only enriched with peptone and yeast extract, than in other samples. An enzymatic preparation obtained from 4-day cultures of bacteria on a medium with 1.0% colloidal chitin was subjected to a three-stage purification
Figure 2. Chitinase activity was detected by zymogram analysis after renaturation of the proteins in the polyacrylamide gel with glycol chitin. ß 2014 WILEY-VCH Verlag GmbH & Co. KGaA,Weinheim
procedure, as in Table 1. After application of molecular sieve chromatography a more than 8-fold purified preparation was obtained, which was then used for characterization of the enzyme. The purification process resulted in the extraction of one major protein band as visualized by electrophoresis (data not presented) with weight approx. 50 kDa. Temperature and pH optima were determined (Fig. 3 and Fig. 4) using colloidal chitin as a substrate. The enzyme demonstrated activity in a broad range of pH values, from 3.6 to 7.8, with a peak at pH 5.6. The temperature optimum was determined at 45 °C, although a broad range of temperatures where the enzyme maintains activity can be observed here as well. A relatively high activity of ca. 60% was achieved already at 30 °C, similarly to 55 °C. After a 2-h incubation of the enzyme at 40 °C, the enzyme maintained thermal stability at the level of 100%, but an equally long incubation at 45 °C resulted in a 20% drop in activity (Fig 5). However, a 2-h enzyme incubation at 55 °C resulted in an almost complete loss of chitinase activity. The effects of various chemical compounds, including detergents, on the activity of purified chitinase were tested (Table 2) using colloidal chitin as substrate. Metal ions: Mg, Ca did not affect the activity of the studied enzyme, Zn ions inhibited the activity in 10%, Cu ions in 20%. The other ions: NH4þ and Hg2þ inhibited the activity of the enzyme to a greater degree. SDS turned out to be a strong inhibitor of the enzyme activity, PMSF a partial one. The presence of cysteine, 2-merkaptoethanol, EDTA, Triton X-100, Tween 20 and Tween 80 slightly stimulates the activity of this enzyme The other utilized compounds had no significant effect on the studied chitinase activity. The activity of this enzyme in relation to various saccharide substrates was also studied (Table 2). The highest activity (3.7 U ml 1) of the enzyme was determined for colloidal chitin, a somewhat lower value (3.1 U ml 1) for chitosan. Flaked chitin turned out to be a difficult substrate to acquire. The studied enzyme only demonstrated a very limited capability to hydrolyze b (1!3) and b (1!6) glycoside bonds in laminarin, and a complete lack of activity towards b-1,4-glycoside bonds in CMC. Glycol chitosan was not a good substrate for this chitinase either. In the course of the study, the Km constant values were obtained for colloidal chitin, glycol chitin and for chitosan (Table 3). In order to determine the specificity of the characterised chitinase relative to the position of the decomposed b-1,4-glycosidic bond in the substrate molecule, synthetic substrates - derivatives of p-nitrophenol were
www.jbm-journal.com
J. Basic Microbiol. 2014, 54, 1–9
Characterization of chitinase from Stenotrophomonas maltophilia
5
Table 1. Purification of chitinase Sm4 from S. maltophilia N4. Purification step
Total activity (U)
Cell free supernatant
Total protein (mg) 288
Specific activity (U/mg)
3700 Acetone precipitation
Purification fold
12.85
Recovery (%) 100
1 220
13.18
2900 DEAE cellulose
41
37.63
1543 Gel filtration
41.7 2.93
9
108.89
980
Figure 3. Effect of temperature on chitinase Sm4 activity.
26.49 8.47
used (Table 4). The enzyme displayed the highest activity, equalling 90 U/ml and Km 1.05mM, towards 4-Nitrophenyl b-D-N,N0 ,N00 -triacetylchitotriose the endochitinase activity - detecting substrate, and ca. 3 times lower activity towards 4-Nitrophenyl N,N0 -diacetyl-b-D-chitobioside - the substrate suitable for exochitinase activity detection: chitobiosidase activity. However, activity towards 4-Nitrophenyl N-acetyl-b-D-glucosaminide a substrate for N-acetylglucosaminidases, was not detected. The primers used in the PCR enabled the amplification of the chitinase gene with length 2106 bp. The deduced amino acid sequence is 99% identical with the chitinase sequence (GenBank: EVT71138) of S. maltophilia 5BA-I-2. Domains typical of glycoside hydrolase family 18 were identified in the area of the obtained sequence, starting from the N-terminus of the protein: 52–92 aa: ChiA1_BD -chitin-binding domain of Chi A1-like proteins; 108–182 aa: CARDB cell adhesion related domain; 204–291 aa: FN3, Fibronectin type III domain; 303–688 aa: GH18_chitinase, glycosyl hydrolases, family 18 type II chitinases hydrolyze chitin.
ß 2014 WILEY-VCH Verlag GmbH & Co. KGaA,Weinheim
78.4 1.13
Discussion The chitinase of S. maltophilia is a highly interesting object of research for many reasons, including the possibility of its utilization in the biological protection of plants. Thus it appears important to characterise the proteins that are most likely to lead the way in biological combating of phytopathogenic moulds and nematodes, both of which are plant pests. The acquired results indicate that chitinase synthesis capability by these bacteria is induced by the presence of polysaccharide substrate in the growth medium, which was proven by the fact that only low activity of chitinase was detected in bacteria cultures cultivated on growth media free of chitin or its derivatives. Inductivity of chitinase synthesis under the effects of N-acetylglucosamine polymers is a phenomenon characteristic of most enzymes described so far [26, 27], although Thompson et al. [28] reports a constitutive chitinase.
Figure 4. Effect of pH on the chitinase activity Sm4: The purified enzyme was incubated with the substrate using 50 mM sodium acetate (pH 3.6–5.8) buffer, Na-phosphate buffer (5.8–8.0) and TrisHCl buffer (6.8 –8.8). www.jbm-journal.com
J. Basic Microbiol. 2014, 54, 1–9
6
Urszula Jankiewicz and Maria Swiontek Brzezinska
Figure 5. Thermal stability of purified chitinase Sm4 from S. maltophilia.
The highest activity of this enzyme was acquired on the fourth, and similar on the fifth day of cultivating the bacteria in media with colloidal chitin, which coincided with results acquired earlier for S. maltophilia MUJ [16], Vibrio campbellii [29] and Bacillus MY75 [30]. On the other hand, the highest activity for Paenibacillus sp. [31] was detected as late as on the sixth day of cultivation, for Serratia marcescens NK1 even on the 7th day of cultivation [32].The zymogram indicates that these bacteria synthesise one form of chitinase, exhibiting activity towards chitin as substrate. This result was confirmed after activity assays using synthetic substrates. Under the conditions of the experiment, no second activity of chitinase in cultures of this bacteria strain was detected. On the other hand, Suma and Podile [17] cloned two chitinases of the S. maltophilia bacterium, including one of type A, therefore similar to
the studied enzyme, and another one, devoid of the chitin-binding domain. Some bacterial species, mostly actinomycetes, produce considerably more isoforms of chitinases, e.g. the culture fluid of Streptomyces exfoliates MT9 was found to contain 6 chitinases with different molecular mass [33]. The optimum values of pH and temperature for the studied enzyme: pH 5.6 and 45 °C are similar to results described by [16, 17] for bacteria of this species. The majority of the bacterial chitinases described so far have higher activities under acidic reaction [3, 34], although alkaline [35, 36] and neutral [37] chitinases have been discovered as well. Most of the bacterial chitininases described in the literature have a similar or higher temperature optimum [3, 38]. An important quality, a condition for the application potential of enzymatic proteins, is their thermal stability. The studied Sm4 chitinase retained thermal stability of about 80% of initial stability after a 2-h incubation at 45 °C. However, after an identical incubation time at 40 °C, the enzyme retained almost 100% of activity. Many of the chitinases described thus far are thermally stable proteins, e.g. Nawani and Kapadnis [32] report a thermally stable chitinase synthesised by S. marcescens NK1, which maintained almost 50% of activity after 24 h of incubation at 50 °C. High thermal stability is also exhibited by chitinases from B. licheniformis [39] or Citrobacter freundii [40]. Surfactants such as Tween-20, Tween-80 or Triton X-100 had little activating effect on the activity of the studied chitinase, which may be related to easier access of enzyme to the substrate.
Table 2. Effect of various compounds on chitinase Sm4 activity. Relative activity (%) Reagents
Concentration (1 mM)
None (control) Zn2þ Mg2þ Ca2þ NH4þ Hg2þ Cu2þ EDTA cysteine 2-M EtOH SDS Triton X-100 Tween 20 Tween 80 Urea PMSF
ß 2014 WILEY-VCH Verlag GmbH & Co. KGaA,Weinheim
Concentration (5 mM) 100 94 100 103 67 20 87 107 105 105 38 104 100 100 100 75
www.jbm-journal.com
100 90 100 100 30 10 80 110 100 110 25 100 105 110 100 64
J. Basic Microbiol. 2014, 54, 1–9
Characterization of chitinase from Stenotrophomonas maltophilia
7
Table 3. Substrate preference of chitinase Sm4. Substrates
Activity (U ml 1)
Relative activity (%)
Km (mg ml 1)
Colloidal chitin Chitin powder Chitin f lakes Glycol chitin Chitosan (75% deacylated) Laminarin Glycol chitosan CM-cellulose
3.7 1.2 0.4 1.1 3.1 0.3 0.0 0.0
100.0 32.5 10.8 29.8 83.8 8.0 0.0 0.0
0.5 0.87 nd 1.09 0.8 nd nd nd
Nd –not determined
Similar results have been presented for the chitinase from B. cereus [41]. The presence of 2-mercaptoethanol and cysteine had stimulation effect on the activity of this enzyme, which suggests that cysteine residues are crucial for the catalysis mechanism of this enzyme. The inhibited activity of this enzyme in the presence of PMSF, an inhibitor of cysteine and serine enzymes, additionally confirms this conclusion. Other results were presented for bifunctional chitinases/lysozymes by Pseudomonas aeruginosa K-187 [42]. A metal ion-chelating compound (EDTA) had no inhibitory effect on the enzyme activity, which suggests a lack of relation between the catalysis mechanism of this enzyme A similar phenomenon occurred for chitinases A from B. thuringiensis and from Serratia sp. KCK [43, 44]. The enzyme exhibited wide substrate specificity towards chitin and its derivatives, while it did not hydrolyse the 1,4-glycosidic bond in CMC, which may be an indication of its specificity towards glycosidic bonds formed by glucosamine residues. In turn, chitinase of Serratia. sp. KCK [44], while exhibiting similar substrate preferences to the tested enzyme, since it hydrolysed colloidal and glycol chitin, as well as chitosan, it also hydrolysed glycosidic bonds in cellulose and its derivatives. Chitinase from B. lichenifornis [39] also exhibited activity towards chitosan, as well as flaked chitin and powdered chitin. Another substrate specificity was observed in recombinant chitinase of Bacillus sp. DAU101 [45]. This
enzyme did not display activity towards glycol chitin or, similarly to Sm4, towards CMC. The value of the Km constant, determined in the course of research for the studied chitinase towards colloidal chitin, was two times higher than that presented by Kudan and Pichyangkura [39] for chitinase of B. licheniformis SK-1. A chitinase of significantly lower affinity to colloidal chitin was characterised for the Paenibacillus pasadenensis NCIM 5434 bacterium [36]. The high activity of studied chitinase towards the 4-Nitrophenyl b-D-N,N0 ,N00 -triacetylchitotriose substrate suggests it is an endochitinase. The acquired Km values are additional confirmation of the studied chitinase’s high affinity for this substrate. Similar observations were made for the endochitinase synthesized by Pseudomonas aeruginosa 385 [28], where the enzyme also displayed activity towards 4-Nitrophenyl b-D-N,N0 ,N00 -triacetylchitotriose and 4-Nitrophenyl N,N0 -diacetyl-b-D-chitobioside. Kinetic parameters determined by the authors of these studies also indicated that it is an endochitinase. The fact that the Sm4 chitinase belongs to endochitinases is in agreement with the previously described results for chitinase by other S. maltophilia bacteria [16, 17]. The complete gene encoding the chitinase of S. maltophilia, strain N4 was obtained in the course of the study. Its nucleotide sequence contains, after translation into an amino acid sequence, conserved functional domains typical of glycoside hydrolase family 18.
Table 4. Substrate specifity and kinetic parameters for chitinase S. maltophilia N4. Substrate
Activity (U) 0
00
4-Nitrophenyl b-D-N,N ,N -triacetylchitotriose Nitrophenyl N,N0 -diacetyl-b-D-chitobioside 4-Nitrophenyl N-acetyl-b-D-glucosaminide
ß 2014 WILEY-VCH Verlag GmbH & Co. KGaA,Weinheim
90 37 0
www.jbm-journal.com
Km (mM) 1.2 3.9 0
J. Basic Microbiol. 2014, 54, 1–9
8
Urszula Jankiewicz and Maria Swiontek Brzezinska
Acknowledgment The project was funded by the National Science Centre of Poland, decision no. UMO-2011/01/B/NZ9/00230.
[16] Jankiewicz, U., Swiontek Brzezinska, M., Saks, E., 2012. Identification and characterization of a chitinase of Stenotrophomonas maltophilia, a bacterium that is antagonistic towards fungal phytopathogens. J. Biosci. Bioeng., 113, 30–35. [17] Suma, K., Podile, A. R., 2013. Chitinase A from Stenotrophomonas maltophilia shows transglycosylation and antifungal activities. Bioresour. Technol., 133, 213–220.
References [1] Neville, A.C., Parry, D.A., Woodhead-Galloway, J., 1976. The chitin crystallite in arthropod cuticle. J. Cell Sci., 21, 73–82. [2] Zhang, M., Haga, A., Sekiguchi, H., Hirano, S., 2000. Structure of insect chitin isolated from beetle larva cuticle and silkworm (Bombyx mori) pupa exuvia. Int. J. Biol. Macromol., 27, 99–105. [3] SwiontekBrzezinska, M., Jankiewicz, U., Burkowska, A., Walczak, M., 2014. Chitinolytic microorganisms and their possible applicationinenvironmental protection. Curr. Microbiol., 68, 71–81.
[18] Huang, X., Liu, J., Ding, J., He, Q., et al., 2009. The investigation of nematocidal activity in Stenotrophomonas maltophilia G2 and characterization of a novel virulence serine protease. Can. J. Microbiol., 55, 934–942. [19] Holt, J. Krieg, G., N.R., Sneath, P.H.A., Staley, J.T., Williams, S.T., 1994. Bergey’s Manual of Determinative Bacteriology. 9th ed., Williams and Wilkins Press, Baltimore [20] Watanabe, K., Kodama, Y., Harayama, S., 2001. Design and evaluation of PCR primers to amplify bacterial 16S ribosomal DNA fragments used for community fingerprinting. J. Microbiol. Methods, 44, 253–262.
[4] Henrissat, B., 1999. Classification of chitinase modules, in: Jolles, P., Muzzarelli, R.A. (Eds.), Chitin and Chitinases. Burkhauser Basel, Switzerland, 137–156.
[21] Lee, H.S., Han, D.S., Choi, S.J., Choi, S., et al., 2000. Purification, characterization and primary structure of a chitinase from Pseudomonas sp. YHS-A2. Appl. Microbiol. Biotechnol., 54, 397–405.
[5] Patil, R.S., Ghormade, V., Deshpande, M.V., 2000. Chitinolytic enzymes: an exploration. Enzyme Microb. Technol., 26, 473–483.
[22] Trudel, J., Asselin, A., 1989. Detection of chitinase activity after polyacrylamide gel electrophoresis. Anal. Biochem., 178, 362–366.
[6] Saks, E., Jankiewicz, U., 2010. Chitinolytic activity of bacteria (in Polish). Adv. Biochem., 56, 1–8.
[23] Laemmli, U.K., 1970. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature, 227, 680–685.
[7] Cohen-Kupiec, R, Chet, I., 1998. The molecular biology of chitin digestion. Curr. Opin. Biotechnol., 9, 270–277. [8] Davies, G., Henrissat, B., 1995. Structures and mechanisms of glycosyl hydrolases. Structure, 3, 853–859. [9] Adams, D.J., 2004. Fungal cell wall chitinases and glucanases. Microbiol., 150, 2029–2035. [10] Mikitani, K., Sugasaki, T., Shimada, T., Kobayashi, M., Gustafsson, J., 2000. The chitinase gene of the silkworm, Bombyx mori, contains a novel Tc-like transposable element. J. Biol. Chem., 275, 37725–37732. [11] Sahai, A.S., Manocha, M.S., 2006. Chitinases of fungi and plants: their involvement in morphogenesis and hostparasite interaction. FEMS Microbiol. Rev., 11, 317–338. [12] Chen, L., Shen, Z., Wu J., 2009. Expression, purification and in vitro antifungal activity of acidic mammalian chitinase against Candida albicans, Aspergillus fumigatus and Trichophyton rubrum strains. Clin. Exp. Dermatol., 34, 55– 60. [13] Hawtin, R.E., Zarkowska, T., Arnold, K., Thomas, C.J., et al., 1997. Liquefaction of Autographa californica nucleopolyhedrovirus-infected insects is dependent on the integrity of virus-encoded chitinase and cathepsin genes. Virology, 24, 243–253.
[24] Miller, G.L., 1959. Use of dinitrosalicylic acid reagent for determination of reducing sugar. Anal. Chem., 31, 426– 428. [25] Bradford, M.M., 1976. A rapid and sensitive method for the quantization of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem., 72, 248–254. [26] Li, X., Roseman, S., 2004. The chitinolytic cascade in Vibrios is regulated by chitin oligosaccharides and a twocomponent chitin catabolic sensor/kinase. PNAS, 101, 627–631. [27] Ulhoa, C.J., Peberdy, J.F., 1991. Regulation of chitinase synthesis in Trichoderma harzianum. J. Gen. Microbiol., 137, 2163–2169. [28] Thompson, S.E., Smith, M., Wilkinson, M.C., Peek, K., 2001. Identification and characterization of a chitinase antigen from Pseudomonas aeruginosa strain 385. Appl. Environ. Microbiol., 67, 4001–4008. [29] Suginta, W., Robertson, P.A., Austin, B., Fry, S.C., Fothergill-Gilmore, L.A., 2000. Chitinases from Vibrio: activity screening and purification of chiA from Vibrio carchariae. J. Appl. Microbiol., 89, 76–84.
[14] Jankiewicz, U., Kołtonowicz, M., 2012. The involvement of Pseudomonas bacteria in induced systemic resistance in plants. Appl. Biochem. Microbiol., 48, 244–249.
[30] Xiao, L., Xie, C.C., Cai, J., Lin, Z.J., et al., Identification and characterization of a chitinase-produced Bacillus showing significant antifungal activity. Curr. Microbiol., 2009, 58, 528–533.
[15] Neeraja, C., Anil, K., Purushotham, P., Suma, K., et al., 2010. Biotechnological approaches to develop bacterial chitinases as a bioshield against fungal diseases of plants. Critical Rev. Biotechnol., 30, 231–241.
[31] Meena, S., Gothwal, R.K., Saxena, J., Mohan M.K., et al., Chitinase production by a newly isolated thermotolerant Paenibacillus sp. BISR-047. Ann. Microbiol., 2014, 64, 787– 797.
ß 2014 WILEY-VCH Verlag GmbH & Co. KGaA,Weinheim
www.jbm-journal.com
J. Basic Microbiol. 2014, 54, 1–9
Characterization of chitinase from Stenotrophomonas maltophilia
9
[32] Nawani, N.N., Kapadnis, B.P., 2001. One-step purification of chitinase from Serratia marcescens NK1, a soil isolate. J. Appl. Microbiol., 90, 803–808.
[39] Kudan, S., Pichyangkura, R., 2009. Purification and characterization of thermostable chitinase from Bacillus licheniformis SK-1. Appl. Biochem. Biotechnol., 157, 23–35.
[33] Choudhary, B., Nagpure, A., Gupta, R.K., 2014. Fungal cell wall lytic enzymes, antifungal metabolite (s) production, and characterization from Streptomyces exfoliates MT9 for controlling fruit-rotting fungi. J. Basic Microbiol., 10.1002/jobm.201400380.
[40] Meruvu, H., Donthireddy, S.R., 2014. Purification and characterization of an antifungal chitinase from Citrobacter freundii str. nov. haritD11. Appl. Biochem. Biotechnolol., 172, 196–205.
[34] Nagpure, A., Gupta, R.K., 2013. Purification and characterization of an extracellular chitinase from antagonistic Streptomyces violaceusniger. J. Basic Microbiol., 53, 429– 439.
[41] Liang, T.W., Chen, Y.Y., Pan, P.S., Wang, S.L., 2014. Purification of chitinase/chitosanase from Bacillus cereus and discovery of an enzyme inhibitor. Int. J. Biol. Macromol., 63, 8–14.
[35] Swiontek Brzezinska, M., Jankiewicz, U., Lisiecki, K., 2013. Optimization of cultural conditions for the production of antifungal chitinase by Streptomyces sporovirgulis. Appl. Biochem. Microbiol., 49, 154–159.
[42] Wang, S.L., Chang, W.T., 1997. Purification and characterization of two bifunctional chitinases/lysozymes extracellularly produced by Pseudomonas aeruginosa K-187 in a shrimp and crab shell powder medium. Appl. Environ. Microbiol., 63, 380-386.
[36] Loni, P.P., Patil, J.U., Phugare, S.S., Bajekal, S.S., 2014. Purification and characterization of alkaline chitinase from Paenibacillus pasadenensis NCIM 5434. J. Basic Microbiol., 54, 1080–1089.
[43] Liu, D., Cai, J., Xie, C.C., Liu, C., et al., 2010. Purification and partial characterization of a 36-kDa chitinase from Bacillus thuringiensis subsp. Colmeri , and its biocontrol potential. Enzyme Microb. Technol., 46, 252–256.
[37] Yuli, P.E., Suhartono, M.T., Rukayadi, Y., Hwang, J.K., et al., Characteristics of thermostable chitinase enzymes from the Indonesian Bacillus sp. 13.26, Enzyme Microb. Technol., 2004. 35, 147–153.
[44] Kim H.S., Timmis, K.N., Golyshin P.N., 2007. Characterization of a chitinolytic enzyme from Serratia sp. KCK isolated from kimchi juice. Appl. Microbiol. Biotechnol., 75, 1275–1283.
[38] Nagpure, A., Choudhary, B., Gupta, R.K., 2014. Mycolytic enzymes produced by Streptomyces violaceusniger and their role in antagonism towards wood-rotting fungi. J. Basic Microbiol., 54, 397–407.
[45] Lee, Y.S., Park, I.H., Yoo, J.S., Chung, S.Y. et al., 2007. Cloning, purification, and characterization of chitinase from Bacillus sp. DAU101 Bioresour. Technol., 98 2734– 2741.
ß 2014 WILEY-VCH Verlag GmbH & Co. KGaA,Weinheim
www.jbm-journal.com
J. Basic Microbiol. 2014, 54, 1–9
1
Research Paper Purification, characterization, and gene cloning of a chitinase from Stenotrophomonas maltophilia N4 Urszula Jankiewicz1 and Maria Swiontek Brzezinska2 1 2
Department of Biochemistry, Warsaw University of Life Sciences, SGGW, Warsaw, Poland Department of Environmental Microbiology and Biotechnology, Institute of Ecology and Environmental Protection, Nicolaus Copernicus University, Torun, Poland
The Stenotrophomonas maltophilia synthesises high-activity chitinase in response to chitin or chitosan induction. The enzyme was purified 8.5 fold and subjected to characterisation. The optimum hydrolysis conditions for this enzyme when using colloidal chitin as substrate were pH 5.6 and temperature of 45 °C. The enzyme demonstrated high thermal stability at 45 °C within 2 h. The studied chitinase exhibited high activity towards colloidal chitin, glycol chitin and chitosan, while it did not hydrolyse glycosidic bonds in carboxymethylcellulose. The enzyme exhibited the highest activity, equalling 90 U/ml, towards Nitrophenyl b-D-N,N0 ,N00 -triacetylchitotriose and activity of 37 U/ml towards 4-Nitrophenyl N,N0 -diacetyl-b-D-chitobioside. The Km value in the presence of the two former substrates was:1.2 and 3.9 mM, respectively, which classifies the studied enzyme as an endochitinase. Cysteine and 2-mercaptoethanol stimulated to a small degree the activity of the chitinase which may indicate the involvement of cysteine residues in the catalysis mechanism. The full length of the nucleotide sequence of this chitinase gene is 2106 bp, which amounts to 702 amino acids. Abbreviations: PMSF – Phenylmethanesulfonyl f luoride; EDTA – Ethylenediaminetetraacetic acid; CMC – Carboxymethylcellulose; DNS–3 5 – Dinitrosalicylic acid Keywords: Stenotrophomonas maltophilia / Chitinase / Substrate specificity / Characterization / Gene cloning Received: September 12, 2014; accepted: November 9, 2014 DOI 10.1002/jobm.201400717
Introduction Chitin is a high-molecular-weight polysaccharide composed of b-N-acetyl-D-glucosamine (GlcNAc) residues linked by b-1,4-glycosidic bonds. Due to its mechanical resilience, chitin is the primary exoskeleton component of insects, crustaceans, certain molluscs and nematodes, as well as that of most fungal cell walls [1–3]. Enzymatic decomposition of chitin is a gradual process that involves chitinolytic enzymes belonging to the O-glycoside hydrolases subclass. So far, 115 families of glycoside hydrolases have been classified, three of which encompass chitinolytic enzymes: families 18, 19, and 20 [4, 5]. Due to the position of the hydrolysed bond, chitinases Correspondence: Urszula Jankiewicz, Department of Biochemistry, Warsaw University of Life Sciences-SGGW, Nowoursynowska 159, 02– 776 Warsaw, Poland E-mail: [email protected] Phone: þ48 22 5932560 Fax: þ48 22 5932562 ß 2014 WILEY-VCH Verlag GmbH & Co. KGaA,Weinheim
(EC.3.2.1.14) can be generally separated into endochitinases, which hydrolyse random bonds located in the chitin chain, detaching N-acetyl-chitin oligosaccharides, and exochitinases, which detach the disaccharide, chitobiose from the reducing or non-reducing end of the chitin chain. Furthermore, chitobiase and b-Nacetylglucosaminidase, which are currently included in the common b-N-acetylhexosaminidase group (EC.3.2.1.52), are also considered enzymes that participate in chitin hydrolysis [6–8]. Chitinolytic enzymes are synthesised by numerous organisms, in which they fulfil various roles, depending on the physiology and needs of their natural producers [9–13]. Chitinolytic microorganisms, such as bacteria and hypha fungi, utilise chitin as a source of nutrients. The presence of the –NHCOCH3 acetamide group at the second carbon in the sugar residue ring makes chitin a source of both carbon and nitrogen for many microorganisms [7].
www.jbm-journal.com
J. Basic Microbiol. 2014, 54, 1–9
2
Urszula Jankiewicz and Maria Swiontek Brzezinska
Secretion of chitinolytic enzymes by bacteria is considered to be one of the more important mechanisms of biocontrol, which other bacterial metabolites, e.g., 1,3-glucanases, proteases, antibiotics or siderophores can also participate in [14]. Elimination of plant pests using biological agents is a perfect complement to commonly utilised chemical agents. For these reasons, chitinases are the subject of numerous studies, due to potential use in industry and in biological protection of plants [3, 15]. The chitinolytic bacteria include Stenotrophomonas maltophilia. Thanks to its ability to release chitinases and proteases, this bacterium can be used to curtail the growth of organisms harmful to plant cultivation, including moulds and nematodes The results of studies that substantially document fungiand nematodicidal properties of several chitinolytic strains belonging to this bacteria species have already been presented in the literature [16–18]. For this reason, the presented study focuses on the characteristics of chitinase synthesised by one of the strains of bacteria belonging to S. maltophilia. This bacterium has been selected for study due to its strong antagonism towards phytopathogenic Fusarium solani. The goal of the presented study was to optimise the growth medium composition for the purpose of acquiring high-activity chitinase, as well as characterise the purified enzyme, e.g. in terms of optimum conditions of action, substrate specificity, reaction to surfactants and other chemicals. Studies have also been undertaken with the goal of cloning the chitinase-coding gene of these bacteria.
Materials and methods Identification of microorganism The chitinase source in the presented study was the S. maltophilia isolated from the rhizosphere area of a cereal crop plant. The bacterial isolate was identified on the basis of morphological and biochemical traits according to Bergey’s Manual of Determinative Bacteriology [19]. Additionally, identification of the studied strain was confirmed by analysis of the 16 S rRNA gene sequence. Amplification of the 16 S rRNA gene was performed using 27 F and 1492 R universal primers [20], the matrix in PCR was genomic DNA isolated from bacteria cells during the late logarithmic growth phase using the Genomic DNA Purification Kit (Fermentas). The obtained nucleotide sequences were compared with sequences deposited in the available GenBank/EMBL/DDBJ databases using the BLAST program. ß 2014 WILEY-VCH Verlag GmbH & Co. KGaA,Weinheim
Bacteria cultivation conditions The bacterial culture was incubated for four days with shaking (120 rpm) at 28 °C. Bacterial cultures were grown and maintained in medium composed of (g/litre): KH2PO 4, 3; K2HPO 4, 3; MgSO4, 0.5; NaCl, 2; FeCl3, 0.005; soy peptone 2.5; yeast extract 1.5; colloidal chitin 6 g, the pH of the medium was adjusted to 6.8. The following growth media were used for substrate optimization: (g/litre): KH2PO4, 3; K2HPO4, 3; MgSO4, 0.5; NaCl, 2; FeCl3, 0.005; soy peptone 2.5; yeast extract 1.5, enriched with: 0.3, 0.6 and 1.0%, respectively, of chitosan (Sigma, Aldrich; 75% deacylated chitin from shrimp shell), colloidal chitin, glycol chitin, or chitin from shrimp shells in coarse flakes (Sigma) or powder form (Roth, from crab shells). Colloidal chitin was prepared according to Lee et al. [21] glycol chitin according to Trudel and Asselin [22]. Electrophoresis and zymography SDS–PAGE and zymogram analysis: Sodium dodecyl sulfate–polyacrylamide gel electrophoresis (SDS–PAGE) was carried out according to Laemmli [23].The supernatants were separated in 8% polyacrylamide gel containing 0.1% of glycol chitin. After electrophoresis, the gel was incubated at 40 °C in 0.1 M sodium acetate buffer pH 5.6 containing 0.2% Triton X-100 for 3 h. Finally, the gel was submerged for 30 min in a 0.01% solution of Congo Red dye, then transferred to 1 M NaCl solution. Enzyme activity determination Chitinase activity was determined with colloidal chitin as substrate. The incubation mixture contained 0.3 ml of suitably diluted enzyme and 0.3 ml of 1% colloidal chitin in 50 mM sodium acetate buffer pH 5.6 was used in the reaction mixture. The amount of reducing sugars released after a 90-min hydrolysis was determined using the spectrophotometric method with DNS [24]. A calibration curve was prepared for five concentrations of N-acetylglucosamine. One unit of chitinase activity (U) was defined as the amount of enzyme which yields 1 mmol of reducing sugar as N-acetyl-D-glucosamine (GlcNAc) equivalent per hour. The spectrum of substrates utilized by the enzyme was studied using the spectrophotometric method of activity determination with DNS. Purification of the enzyme The source of the studied chitinase was a clear supernatant obtained after centrifuging (12000g 10 min) and filtering 4-day cultures of S. maltophilia N4 bacteria. All
www.jbm-journal.com
J. Basic Microbiol. 2014, 54, 1–9
Characterization of chitinase from Stenotrophomonas maltophilia
stages of the enzyme purification were carried out at 4 °C. Precipitation with acetone: 5 volumes of cold acetone were added to the cooled supernatant. After thorough stirring, samples were left for 15 min in ice and subsequently centrifuged (16000g, 20 min). After drying, the protein precipitate was dissolved in 20 mM TrisHCl buffer, pH 6.8, and subsequently dialysed overnight in an identical buffer. The preparation was applied to a DEAE chromatographic ion-exchange bed, equilibrated, in 20 mM Tris-HCl buffer, pH 6.8. Proteins bonded to the bed were eluted in an NaCl gradient: 0.0–0.5 NaCl. Fractions where enzyme activity was detected were concentrated 20-fold (VIVASPIN 20, Sartorius stedim) and filtered using molecular sieve chromatography on a Superdex 200 bed. Separation of proteins was performed in 50 mM Tris-HCl buffer pH 6.8. Active fractions were dialyzed overnight and used for characterizing the enzyme. Determination of protein content Protein concentration was determined using the method of Bradford [25] with bovine serum albumin as a standard. Biochemical characterization of purified enzyme Effects of metal ions and EDTA: Before substrate was added to the incubation mixture, the enzyme was kept with the studied ions and EDTA for 30 min. at room temperature. Effects of other chemical compounds were tested by way of the standard method, utilising colloidal chitin as substrate. Enzyme kinetics were studied using colloidal, glycol chitin and chitosan as substrates (1–35 mg/ml), suspended in 50 mM sodium acetate buffer. Standard procedure utilizing a Lineweaver-Burke plot was applied to determine the Km value. Kinetic properties, as well as the enzyme substrate specificity were also determined using synthetic substrates, p-nitrophenyl derivatives of N-acetylglucosamine (Chitinase Assay Kit, CS0980, Sigma-Aldrich). One unit of chitinase activity (U) was defined as the amount of enzyme which yields 1 mmol of p-nitrophenol per minute per 10 ml of purified enzyme. Cloning the SM4 chitinase-coding gene of S. maltophilia N4 The chitinase-coding gene was amplified using genomic DNA of S. maltophilia and two oligomeric primers of the following sequence: F: 5’TTACCATGGGCTACGACCCGATTGTG and R: 5’CGCAAGCTTTTACTTCAGGCCATCACTG. ß 2014 WILEY-VCH Verlag GmbH & Co. KGaA,Weinheim
3
The primers were designed on the basis of a nucleotide sequence (available in GenBank: YP_006183343) encoding chitinase in S. maltophilia D457 (GenBank: HE798556). The following PCR conditions were applied: an initial denaturation step at 94 °C for 2 min followed by 30 cycles of 94 °C for 45 s, 59 °C for 2 min, and 72 °C for 2.15 min; the final extension step was performed at 72 °C for 9 min. The chitinase gene amplification reaction was carried out using the following set of reagents: Phusion Hot Start Flex 2x Master Mix (M0536G, BioLabs). After purification, the PCR product was ligated into the pJET cloning vector (CloneJET PCR cloning Kit, 1232, Thermo Scientific). Chemocompetent cells of Escherichia coli DH5a were used for the transformation. Transformants were grown in LB medium with ampicillin (50 mg/ml). Plasmids isolated from E. coli transformants were sequenced in the DNA Sequencing laboratory (Biochemistry and Biophysics Institute of the Polish Academy of Sciences). The nucleotide sequence and deduced amino acid sequence were analyzed using Blast server. The obtained nucleotide sequence of the 16 S rRNA gene and the nucleotide sequence of chitinase Sm4 gene were deposited in DDBJ under accession numbers AB667906 and AB973459, respectively. All results presented in this paper in the form of numerical values are means from three independent repetitions. The mean error, reflecting maximal deviation of the results of measurements from the mean, did not exceed 5%.
Results The studied isolate was subjected to identification by classical methods, including microscopic observation of stained preparations and API tests. These results were confirmed by analysis of the nucleotide sequence of the 16 S rRNA coding gene, acquired in the course of our research. This sequence was compared with data deposited in the available GenBank/EMBL/DDBJ databases using the BLAST program. The obtained results allowed to classify this bacterial strain as S. maltophilia and it was given the strain name S. maltophilia N4. The highest chitinase activity was achieved on the fourth day of cultivation, after which a slow decline in subsequent days of the experiment was observed. The differences in chitinolytic activity were demonstrated in 4-day cultures of the S. maltophilia N4 strain, cultivated in liquid mineral media, enriched with soy peptone, yeast extract and various forms and concentrations of chitin and chitosan (Fig. 1). Each of the utilized polysaccharide
www.jbm-journal.com
J. Basic Microbiol. 2014, 54, 1–9
4
Urszula Jankiewicz and Maria Swiontek Brzezinska
Figure 1. Effect on different substrates on chitinase production by Stenotrophomonas maltophilia N4.
component of media stimulated chitinase activity of the N4 strain. The maximum activity of 2.1 U/ml was achieved during cultivation of bacteria on a medium containing a 1.0% addition of colloidal chitin (CC). A high activity was also achieved in bacteria cultures cultivated in media with added powdered crab shells (CP), as well as shrimp shells in coarse flakes (CF) and chitosan (CT) form. Lower activity results were acquired after adding glycol chitin (GC) to the media. Chitinase activity was also dependent on the concentration of added polysaccharides; the lowest activity was determined when their concentration in the substrate was 0.3%, higher concentration of polysaccharide components resulted in higher activity of the tested enzyme. However, no significant differences were noted between the concentration of 0.6 and 1.0% of these components in the medium. Regardless of the substrate in a culture medium a single a single zone of clearing was observed by zymogram after electrophoresis (Fig. 2). Thus, bacteria cultures on media containing 1.0% CC were used for further testing. On the other hand, activity several times lower was observed in mineral media without additions of chitin or chitosan, and only enriched with peptone and yeast extract, than in other samples. An enzymatic preparation obtained from 4-day cultures of bacteria on a medium with 1.0% colloidal chitin was subjected to a three-stage purification
Figure 2. Chitinase activity was detected by zymogram analysis after renaturation of the proteins in the polyacrylamide gel with glycol chitin. ß 2014 WILEY-VCH Verlag GmbH & Co. KGaA,Weinheim
procedure, as in Table 1. After application of molecular sieve chromatography a more than 8-fold purified preparation was obtained, which was then used for characterization of the enzyme. The purification process resulted in the extraction of one major protein band as visualized by electrophoresis (data not presented) with weight approx. 50 kDa. Temperature and pH optima were determined (Fig. 3 and Fig. 4) using colloidal chitin as a substrate. The enzyme demonstrated activity in a broad range of pH values, from 3.6 to 7.8, with a peak at pH 5.6. The temperature optimum was determined at 45 °C, although a broad range of temperatures where the enzyme maintains activity can be observed here as well. A relatively high activity of ca. 60% was achieved already at 30 °C, similarly to 55 °C. After a 2-h incubation of the enzyme at 40 °C, the enzyme maintained thermal stability at the level of 100%, but an equally long incubation at 45 °C resulted in a 20% drop in activity (Fig 5). However, a 2-h enzyme incubation at 55 °C resulted in an almost complete loss of chitinase activity. The effects of various chemical compounds, including detergents, on the activity of purified chitinase were tested (Table 2) using colloidal chitin as substrate. Metal ions: Mg, Ca did not affect the activity of the studied enzyme, Zn ions inhibited the activity in 10%, Cu ions in 20%. The other ions: NH4þ and Hg2þ inhibited the activity of the enzyme to a greater degree. SDS turned out to be a strong inhibitor of the enzyme activity, PMSF a partial one. The presence of cysteine, 2-merkaptoethanol, EDTA, Triton X-100, Tween 20 and Tween 80 slightly stimulates the activity of this enzyme The other utilized compounds had no significant effect on the studied chitinase activity. The activity of this enzyme in relation to various saccharide substrates was also studied (Table 2). The highest activity (3.7 U ml 1) of the enzyme was determined for colloidal chitin, a somewhat lower value (3.1 U ml 1) for chitosan. Flaked chitin turned out to be a difficult substrate to acquire. The studied enzyme only demonstrated a very limited capability to hydrolyze b (1!3) and b (1!6) glycoside bonds in laminarin, and a complete lack of activity towards b-1,4-glycoside bonds in CMC. Glycol chitosan was not a good substrate for this chitinase either. In the course of the study, the Km constant values were obtained for colloidal chitin, glycol chitin and for chitosan (Table 3). In order to determine the specificity of the characterised chitinase relative to the position of the decomposed b-1,4-glycosidic bond in the substrate molecule, synthetic substrates - derivatives of p-nitrophenol were
www.jbm-journal.com
J. Basic Microbiol. 2014, 54, 1–9
Characterization of chitinase from Stenotrophomonas maltophilia
5
Table 1. Purification of chitinase Sm4 from S. maltophilia N4. Purification step
Total activity (U)
Cell free supernatant
Total protein (mg) 288
Specific activity (U/mg)
3700 Acetone precipitation
Purification fold
12.85
Recovery (%) 100
1 220
13.18
2900 DEAE cellulose
41
37.63
1543 Gel filtration
41.7 2.93
9
108.89
980
Figure 3. Effect of temperature on chitinase Sm4 activity.
26.49 8.47
used (Table 4). The enzyme displayed the highest activity, equalling 90 U/ml and Km 1.05mM, towards 4-Nitrophenyl b-D-N,N0 ,N00 -triacetylchitotriose the endochitinase activity - detecting substrate, and ca. 3 times lower activity towards 4-Nitrophenyl N,N0 -diacetyl-b-D-chitobioside - the substrate suitable for exochitinase activity detection: chitobiosidase activity. However, activity towards 4-Nitrophenyl N-acetyl-b-D-glucosaminide a substrate for N-acetylglucosaminidases, was not detected. The primers used in the PCR enabled the amplification of the chitinase gene with length 2106 bp. The deduced amino acid sequence is 99% identical with the chitinase sequence (GenBank: EVT71138) of S. maltophilia 5BA-I-2. Domains typical of glycoside hydrolase family 18 were identified in the area of the obtained sequence, starting from the N-terminus of the protein: 52–92 aa: ChiA1_BD -chitin-binding domain of Chi A1-like proteins; 108–182 aa: CARDB cell adhesion related domain; 204–291 aa: FN3, Fibronectin type III domain; 303–688 aa: GH18_chitinase, glycosyl hydrolases, family 18 type II chitinases hydrolyze chitin.
ß 2014 WILEY-VCH Verlag GmbH & Co. KGaA,Weinheim
78.4 1.13
Discussion The chitinase of S. maltophilia is a highly interesting object of research for many reasons, including the possibility of its utilization in the biological protection of plants. Thus it appears important to characterise the proteins that are most likely to lead the way in biological combating of phytopathogenic moulds and nematodes, both of which are plant pests. The acquired results indicate that chitinase synthesis capability by these bacteria is induced by the presence of polysaccharide substrate in the growth medium, which was proven by the fact that only low activity of chitinase was detected in bacteria cultures cultivated on growth media free of chitin or its derivatives. Inductivity of chitinase synthesis under the effects of N-acetylglucosamine polymers is a phenomenon characteristic of most enzymes described so far [26, 27], although Thompson et al. [28] reports a constitutive chitinase.
Figure 4. Effect of pH on the chitinase activity Sm4: The purified enzyme was incubated with the substrate using 50 mM sodium acetate (pH 3.6–5.8) buffer, Na-phosphate buffer (5.8–8.0) and TrisHCl buffer (6.8 –8.8). www.jbm-journal.com
J. Basic Microbiol. 2014, 54, 1–9
6
Urszula Jankiewicz and Maria Swiontek Brzezinska
Figure 5. Thermal stability of purified chitinase Sm4 from S. maltophilia.
The highest activity of this enzyme was acquired on the fourth, and similar on the fifth day of cultivating the bacteria in media with colloidal chitin, which coincided with results acquired earlier for S. maltophilia MUJ [16], Vibrio campbellii [29] and Bacillus MY75 [30]. On the other hand, the highest activity for Paenibacillus sp. [31] was detected as late as on the sixth day of cultivation, for Serratia marcescens NK1 even on the 7th day of cultivation [32].The zymogram indicates that these bacteria synthesise one form of chitinase, exhibiting activity towards chitin as substrate. This result was confirmed after activity assays using synthetic substrates. Under the conditions of the experiment, no second activity of chitinase in cultures of this bacteria strain was detected. On the other hand, Suma and Podile [17] cloned two chitinases of the S. maltophilia bacterium, including one of type A, therefore similar to
the studied enzyme, and another one, devoid of the chitin-binding domain. Some bacterial species, mostly actinomycetes, produce considerably more isoforms of chitinases, e.g. the culture fluid of Streptomyces exfoliates MT9 was found to contain 6 chitinases with different molecular mass [33]. The optimum values of pH and temperature for the studied enzyme: pH 5.6 and 45 °C are similar to results described by [16, 17] for bacteria of this species. The majority of the bacterial chitinases described so far have higher activities under acidic reaction [3, 34], although alkaline [35, 36] and neutral [37] chitinases have been discovered as well. Most of the bacterial chitininases described in the literature have a similar or higher temperature optimum [3, 38]. An important quality, a condition for the application potential of enzymatic proteins, is their thermal stability. The studied Sm4 chitinase retained thermal stability of about 80% of initial stability after a 2-h incubation at 45 °C. However, after an identical incubation time at 40 °C, the enzyme retained almost 100% of activity. Many of the chitinases described thus far are thermally stable proteins, e.g. Nawani and Kapadnis [32] report a thermally stable chitinase synthesised by S. marcescens NK1, which maintained almost 50% of activity after 24 h of incubation at 50 °C. High thermal stability is also exhibited by chitinases from B. licheniformis [39] or Citrobacter freundii [40]. Surfactants such as Tween-20, Tween-80 or Triton X-100 had little activating effect on the activity of the studied chitinase, which may be related to easier access of enzyme to the substrate.
Table 2. Effect of various compounds on chitinase Sm4 activity. Relative activity (%) Reagents
Concentration (1 mM)
None (control) Zn2þ Mg2þ Ca2þ NH4þ Hg2þ Cu2þ EDTA cysteine 2-M EtOH SDS Triton X-100 Tween 20 Tween 80 Urea PMSF
ß 2014 WILEY-VCH Verlag GmbH & Co. KGaA,Weinheim
Concentration (5 mM) 100 94 100 103 67 20 87 107 105 105 38 104 100 100 100 75
www.jbm-journal.com
100 90 100 100 30 10 80 110 100 110 25 100 105 110 100 64
J. Basic Microbiol. 2014, 54, 1–9
Characterization of chitinase from Stenotrophomonas maltophilia
7
Table 3. Substrate preference of chitinase Sm4. Substrates
Activity (U ml 1)
Relative activity (%)
Km (mg ml 1)
Colloidal chitin Chitin powder Chitin f lakes Glycol chitin Chitosan (75% deacylated) Laminarin Glycol chitosan CM-cellulose
3.7 1.2 0.4 1.1 3.1 0.3 0.0 0.0
100.0 32.5 10.8 29.8 83.8 8.0 0.0 0.0
0.5 0.87 nd 1.09 0.8 nd nd nd
Nd –not determined
Similar results have been presented for the chitinase from B. cereus [41]. The presence of 2-mercaptoethanol and cysteine had stimulation effect on the activity of this enzyme, which suggests that cysteine residues are crucial for the catalysis mechanism of this enzyme. The inhibited activity of this enzyme in the presence of PMSF, an inhibitor of cysteine and serine enzymes, additionally confirms this conclusion. Other results were presented for bifunctional chitinases/lysozymes by Pseudomonas aeruginosa K-187 [42]. A metal ion-chelating compound (EDTA) had no inhibitory effect on the enzyme activity, which suggests a lack of relation between the catalysis mechanism of this enzyme A similar phenomenon occurred for chitinases A from B. thuringiensis and from Serratia sp. KCK [43, 44]. The enzyme exhibited wide substrate specificity towards chitin and its derivatives, while it did not hydrolyse the 1,4-glycosidic bond in CMC, which may be an indication of its specificity towards glycosidic bonds formed by glucosamine residues. In turn, chitinase of Serratia. sp. KCK [44], while exhibiting similar substrate preferences to the tested enzyme, since it hydrolysed colloidal and glycol chitin, as well as chitosan, it also hydrolysed glycosidic bonds in cellulose and its derivatives. Chitinase from B. lichenifornis [39] also exhibited activity towards chitosan, as well as flaked chitin and powdered chitin. Another substrate specificity was observed in recombinant chitinase of Bacillus sp. DAU101 [45]. This
enzyme did not display activity towards glycol chitin or, similarly to Sm4, towards CMC. The value of the Km constant, determined in the course of research for the studied chitinase towards colloidal chitin, was two times higher than that presented by Kudan and Pichyangkura [39] for chitinase of B. licheniformis SK-1. A chitinase of significantly lower affinity to colloidal chitin was characterised for the Paenibacillus pasadenensis NCIM 5434 bacterium [36]. The high activity of studied chitinase towards the 4-Nitrophenyl b-D-N,N0 ,N00 -triacetylchitotriose substrate suggests it is an endochitinase. The acquired Km values are additional confirmation of the studied chitinase’s high affinity for this substrate. Similar observations were made for the endochitinase synthesized by Pseudomonas aeruginosa 385 [28], where the enzyme also displayed activity towards 4-Nitrophenyl b-D-N,N0 ,N00 -triacetylchitotriose and 4-Nitrophenyl N,N0 -diacetyl-b-D-chitobioside. Kinetic parameters determined by the authors of these studies also indicated that it is an endochitinase. The fact that the Sm4 chitinase belongs to endochitinases is in agreement with the previously described results for chitinase by other S. maltophilia bacteria [16, 17]. The complete gene encoding the chitinase of S. maltophilia, strain N4 was obtained in the course of the study. Its nucleotide sequence contains, after translation into an amino acid sequence, conserved functional domains typical of glycoside hydrolase family 18.
Table 4. Substrate specifity and kinetic parameters for chitinase S. maltophilia N4. Substrate
Activity (U) 0
00
4-Nitrophenyl b-D-N,N ,N -triacetylchitotriose Nitrophenyl N,N0 -diacetyl-b-D-chitobioside 4-Nitrophenyl N-acetyl-b-D-glucosaminide
ß 2014 WILEY-VCH Verlag GmbH & Co. KGaA,Weinheim
90 37 0
www.jbm-journal.com
Km (mM) 1.2 3.9 0
J. Basic Microbiol. 2014, 54, 1–9
8
Urszula Jankiewicz and Maria Swiontek Brzezinska
Acknowledgment The project was funded by the National Science Centre of Poland, decision no. UMO-2011/01/B/NZ9/00230.
[16] Jankiewicz, U., Swiontek Brzezinska, M., Saks, E., 2012. Identification and characterization of a chitinase of Stenotrophomonas maltophilia, a bacterium that is antagonistic towards fungal phytopathogens. J. Biosci. Bioeng., 113, 30–35. [17] Suma, K., Podile, A. R., 2013. Chitinase A from Stenotrophomonas maltophilia shows transglycosylation and antifungal activities. Bioresour. Technol., 133, 213–220.
References [1] Neville, A.C., Parry, D.A., Woodhead-Galloway, J., 1976. The chitin crystallite in arthropod cuticle. J. Cell Sci., 21, 73–82. [2] Zhang, M., Haga, A., Sekiguchi, H., Hirano, S., 2000. Structure of insect chitin isolated from beetle larva cuticle and silkworm (Bombyx mori) pupa exuvia. Int. J. Biol. Macromol., 27, 99–105. [3] SwiontekBrzezinska, M., Jankiewicz, U., Burkowska, A., Walczak, M., 2014. Chitinolytic microorganisms and their possible applicationinenvironmental protection. Curr. Microbiol., 68, 71–81.
[18] Huang, X., Liu, J., Ding, J., He, Q., et al., 2009. The investigation of nematocidal activity in Stenotrophomonas maltophilia G2 and characterization of a novel virulence serine protease. Can. J. Microbiol., 55, 934–942. [19] Holt, J. Krieg, G., N.R., Sneath, P.H.A., Staley, J.T., Williams, S.T., 1994. Bergey’s Manual of Determinative Bacteriology. 9th ed., Williams and Wilkins Press, Baltimore [20] Watanabe, K., Kodama, Y., Harayama, S., 2001. Design and evaluation of PCR primers to amplify bacterial 16S ribosomal DNA fragments used for community fingerprinting. J. Microbiol. Methods, 44, 253–262.
[4] Henrissat, B., 1999. Classification of chitinase modules, in: Jolles, P., Muzzarelli, R.A. (Eds.), Chitin and Chitinases. Burkhauser Basel, Switzerland, 137–156.
[21] Lee, H.S., Han, D.S., Choi, S.J., Choi, S., et al., 2000. Purification, characterization and primary structure of a chitinase from Pseudomonas sp. YHS-A2. Appl. Microbiol. Biotechnol., 54, 397–405.
[5] Patil, R.S., Ghormade, V., Deshpande, M.V., 2000. Chitinolytic enzymes: an exploration. Enzyme Microb. Technol., 26, 473–483.
[22] Trudel, J., Asselin, A., 1989. Detection of chitinase activity after polyacrylamide gel electrophoresis. Anal. Biochem., 178, 362–366.
[6] Saks, E., Jankiewicz, U., 2010. Chitinolytic activity of bacteria (in Polish). Adv. Biochem., 56, 1–8.
[23] Laemmli, U.K., 1970. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature, 227, 680–685.
[7] Cohen-Kupiec, R, Chet, I., 1998. The molecular biology of chitin digestion. Curr. Opin. Biotechnol., 9, 270–277. [8] Davies, G., Henrissat, B., 1995. Structures and mechanisms of glycosyl hydrolases. Structure, 3, 853–859. [9] Adams, D.J., 2004. Fungal cell wall chitinases and glucanases. Microbiol., 150, 2029–2035. [10] Mikitani, K., Sugasaki, T., Shimada, T., Kobayashi, M., Gustafsson, J., 2000. The chitinase gene of the silkworm, Bombyx mori, contains a novel Tc-like transposable element. J. Biol. Chem., 275, 37725–37732. [11] Sahai, A.S., Manocha, M.S., 2006. Chitinases of fungi and plants: their involvement in morphogenesis and hostparasite interaction. FEMS Microbiol. Rev., 11, 317–338. [12] Chen, L., Shen, Z., Wu J., 2009. Expression, purification and in vitro antifungal activity of acidic mammalian chitinase against Candida albicans, Aspergillus fumigatus and Trichophyton rubrum strains. Clin. Exp. Dermatol., 34, 55– 60. [13] Hawtin, R.E., Zarkowska, T., Arnold, K., Thomas, C.J., et al., 1997. Liquefaction of Autographa californica nucleopolyhedrovirus-infected insects is dependent on the integrity of virus-encoded chitinase and cathepsin genes. Virology, 24, 243–253.
[24] Miller, G.L., 1959. Use of dinitrosalicylic acid reagent for determination of reducing sugar. Anal. Chem., 31, 426– 428. [25] Bradford, M.M., 1976. A rapid and sensitive method for the quantization of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem., 72, 248–254. [26] Li, X., Roseman, S., 2004. The chitinolytic cascade in Vibrios is regulated by chitin oligosaccharides and a twocomponent chitin catabolic sensor/kinase. PNAS, 101, 627–631. [27] Ulhoa, C.J., Peberdy, J.F., 1991. Regulation of chitinase synthesis in Trichoderma harzianum. J. Gen. Microbiol., 137, 2163–2169. [28] Thompson, S.E., Smith, M., Wilkinson, M.C., Peek, K., 2001. Identification and characterization of a chitinase antigen from Pseudomonas aeruginosa strain 385. Appl. Environ. Microbiol., 67, 4001–4008. [29] Suginta, W., Robertson, P.A., Austin, B., Fry, S.C., Fothergill-Gilmore, L.A., 2000. Chitinases from Vibrio: activity screening and purification of chiA from Vibrio carchariae. J. Appl. Microbiol., 89, 76–84.
[14] Jankiewicz, U., Kołtonowicz, M., 2012. The involvement of Pseudomonas bacteria in induced systemic resistance in plants. Appl. Biochem. Microbiol., 48, 244–249.
[30] Xiao, L., Xie, C.C., Cai, J., Lin, Z.J., et al., Identification and characterization of a chitinase-produced Bacillus showing significant antifungal activity. Curr. Microbiol., 2009, 58, 528–533.
[15] Neeraja, C., Anil, K., Purushotham, P., Suma, K., et al., 2010. Biotechnological approaches to develop bacterial chitinases as a bioshield against fungal diseases of plants. Critical Rev. Biotechnol., 30, 231–241.
[31] Meena, S., Gothwal, R.K., Saxena, J., Mohan M.K., et al., Chitinase production by a newly isolated thermotolerant Paenibacillus sp. BISR-047. Ann. Microbiol., 2014, 64, 787– 797.
ß 2014 WILEY-VCH Verlag GmbH & Co. KGaA,Weinheim
www.jbm-journal.com
J. Basic Microbiol. 2014, 54, 1–9
Characterization of chitinase from Stenotrophomonas maltophilia
9
[32] Nawani, N.N., Kapadnis, B.P., 2001. One-step purification of chitinase from Serratia marcescens NK1, a soil isolate. J. Appl. Microbiol., 90, 803–808.
[39] Kudan, S., Pichyangkura, R., 2009. Purification and characterization of thermostable chitinase from Bacillus licheniformis SK-1. Appl. Biochem. Biotechnol., 157, 23–35.
[33] Choudhary, B., Nagpure, A., Gupta, R.K., 2014. Fungal cell wall lytic enzymes, antifungal metabolite (s) production, and characterization from Streptomyces exfoliates MT9 for controlling fruit-rotting fungi. J. Basic Microbiol., 10.1002/jobm.201400380.
[40] Meruvu, H., Donthireddy, S.R., 2014. Purification and characterization of an antifungal chitinase from Citrobacter freundii str. nov. haritD11. Appl. Biochem. Biotechnolol., 172, 196–205.
[34] Nagpure, A., Gupta, R.K., 2013. Purification and characterization of an extracellular chitinase from antagonistic Streptomyces violaceusniger. J. Basic Microbiol., 53, 429– 439.
[41] Liang, T.W., Chen, Y.Y., Pan, P.S., Wang, S.L., 2014. Purification of chitinase/chitosanase from Bacillus cereus and discovery of an enzyme inhibitor. Int. J. Biol. Macromol., 63, 8–14.
[35] Swiontek Brzezinska, M., Jankiewicz, U., Lisiecki, K., 2013. Optimization of cultural conditions for the production of antifungal chitinase by Streptomyces sporovirgulis. Appl. Biochem. Microbiol., 49, 154–159.
[42] Wang, S.L., Chang, W.T., 1997. Purification and characterization of two bifunctional chitinases/lysozymes extracellularly produced by Pseudomonas aeruginosa K-187 in a shrimp and crab shell powder medium. Appl. Environ. Microbiol., 63, 380-386.
[36] Loni, P.P., Patil, J.U., Phugare, S.S., Bajekal, S.S., 2014. Purification and characterization of alkaline chitinase from Paenibacillus pasadenensis NCIM 5434. J. Basic Microbiol., 54, 1080–1089.
[43] Liu, D., Cai, J., Xie, C.C., Liu, C., et al., 2010. Purification and partial characterization of a 36-kDa chitinase from Bacillus thuringiensis subsp. Colmeri , and its biocontrol potential. Enzyme Microb. Technol., 46, 252–256.
[37] Yuli, P.E., Suhartono, M.T., Rukayadi, Y., Hwang, J.K., et al., Characteristics of thermostable chitinase enzymes from the Indonesian Bacillus sp. 13.26, Enzyme Microb. Technol., 2004. 35, 147–153.
[44] Kim H.S., Timmis, K.N., Golyshin P.N., 2007. Characterization of a chitinolytic enzyme from Serratia sp. KCK isolated from kimchi juice. Appl. Microbiol. Biotechnol., 75, 1275–1283.
[38] Nagpure, A., Choudhary, B., Gupta, R.K., 2014. Mycolytic enzymes produced by Streptomyces violaceusniger and their role in antagonism towards wood-rotting fungi. J. Basic Microbiol., 54, 397–407.
[45] Lee, Y.S., Park, I.H., Yoo, J.S., Chung, S.Y. et al., 2007. Cloning, purification, and characterization of chitinase from Bacillus sp. DAU101 Bioresour. Technol., 98 2734– 2741.
ß 2014 WILEY-VCH Verlag GmbH & Co. KGaA,Weinheim
www.jbm-journal.com
J. Basic Microbiol. 2014, 54, 1–9
