NSC 16036

No. of Pages 12

12 February 2015 Please cite this article in press as: Zou H et al. MicroRNA-29A/PTEN pathway modulates neurite outgrowth in PC12 cells. Neuroscience (2015), http://dx.doi.org/10.1016/j.neuroscience.2015.01.055 1

Neuroscience xxx (2015) xxx–xxx

3

MICRORNA-29A/PTEN PATHWAY MODULATES NEURITE OUTGROWTH IN PC12 CELLS

4 5

H. ZOU, a  Y. DING, a  K. WANG, a E. XIONG, b W. PENG, b F. DU, b Z. ZHANG, b J. LIU a* AND A. GONG b*

2

a

6 7

Department of Orthopedics, The Third Affiliated Hospital of Suzhou University, Changzhou 213003, China

8

b

9

studies have suggested that PTEN plays an important role in neural development and differentiation. PTEN is expressed in the brains of mice, starting at approximately postnatal day 0, preferentially in neurons, especially Purkinje neurons, olfactory mitral neurons, and large pyramidal neurons in the brains of adult mice (Lachyankar et al., 2000a). Loss of PTEN expression is associated with cerebellar dysplasia in human patients (Liaw et al., 1997). However, PTEN deletion does not seem to facilitate intrinsic regenerative outgrowth of adult peripheral axons (Christie et al., 2010). Rather, it enhances regeneration of axons after CNS injury (Park et al., 2008) and in adult cortico-spinal neurons after spinal cord injury (Liu et al., 2010). These studies highlight the importance of the role of PTEN in neuronal development and possibly axon outgrowth. A considerable amount of evidence supports the hypothesis that many cellular processes, including cell proliferation, apoptosis, and cytokine release, are regulated by miRNAs (Qureshi et al., 2012). It has been estimated that miRNAs, which constitute only 1% of the genes in the human genome, can regulate at least 20– 30% of all human genes (Gimm et al., 2000). Emerging evidence suggests that miRNAs not only increase proliferation and inhibit cell apoptosis in tumor cells in vitro but also promote chemotherapeutic drug resistance and tumor metastasis by down-regulating the expression of PTEN. Previous studies have confirmed that miRNAs can regulate the expression of PTEN in neural cells and promote axonal outgrowth (Li et al., 2013). Results showed that nerve growth factor (NGF) can normally induce differentiation of PC12 cells into a neuron-like phenotype and induce up-regulation of miR-92a-1, miR-29a, miR-29c, and miR-92b expression. MiR-29a is involved in the regulation of migration of hepatoma cells mediated by hepatitis B virus X protein (HBx) through modulation of Akt phosphorylation (Kong et al., 2011b). It is here proposed that the miR-29a/PTEN pathway exists and may be a regulatory factor on neurite outgrowth via regulating Akt pathway. However, the details underlying this mechanism are not known. In this study, results showed that miR-29a expression levels were higher during NGF-induced differentiation of PC12 cells than at other times. For this reason, PC12 cells with stable miR-29a expression were generated. Results demonstrated that alteration of miR-29a expression regulates neurite outgrowth by modulating PTEN expression and increasing Akt phosphorylation.

School of Medicine, Jiangsu University, Zhenjiang 212013, China

Abstract—PTEN serves as an intrinsic brake on neurite outgrowth, but the regulatory mechanism that governs its action is not clear. In the present study, miR-29a was found to increase neurite outgrowth by decreasing PTEN expression. Results showed that miR-92a-1, miR-29a, miR-92b, and miR29c expression levels increased during nerve growth factor (NGF)-induced differentiation of PC12 cells. Based on in silico analysis of possible miR-29a targets, PTEN mRNA may be a binding site for miR-29a. A protein expression assay and luciferase reporter assay showed that miR-29a could directly target the 30 -UTRs (untranslated regions) of PTEN mRNA and down-regulate the expression of PTEN. PC12 cells infected with lentiviral pLKO-miR-29a showed far higher levels of miR-29a and Akt phosphorylation level than those infected with control. This promoted neurite outgrowth of PC12 cells. Collectively, these results indicate that miR-29a is an important regulator of neurite outgrowth via targeting PTEN and that it may be a promising therapeutic target for neural disease. Ó 2015 IBRO. Published by Elsevier Ltd. All rights reserved.

Key words: miRNA, neurite outgrowth, miR-29a, PTEN, Akt. 10

11

INTRODUCTION

12

Deletion of the phosphatase and tensin homologs on chromosome ten (PTEN) anti-oncogene is among the most frequently mutations in high-grade brain tumors such as gliomas, glioblastoma, and medulloblastoma (Rasheed et al., 1997; Holand et al., 2011). Although the importance of PTEN in cancer etiology is clear, its role in the nervous system remains unclear (Stolarov et al., 2001; Weng et al., 2002; Musatov et al., 2004). Recent

13 14 15 16 17 18 19

*Corresponding authors. Address: Department of Orthopaedics, The Third Affiliated Hospital of Suzhou University, The First People’s Hospital of Changzhou, School of Medicine, No. 185 of Juqian Street, Changzhou 213000, China. Fax: +86-519-68870000 (J. Liu). Fax: +86-511-85038449 (A. Gong). E-mail addresses: [email protected] (J. Liu), [email protected] (A. Gong).   Hongjun Zou and Ya Ding contributed equally to this work. Abbreviations: HBx, hepatitis B virus X; MREs, miRNA response elements; NGF, nerve growth factor; UTR, untranslated region. http://dx.doi.org/10.1016/j.neuroscience.2015.01.055 0306-4522/Ó 2015 IBRO. Published by Elsevier Ltd. All rights reserved. 1

20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67

NSC 16036

No. of Pages 12

12 February 2015

2 68

H. Zou et al. / Neuroscience xxx (2015) xxx–xxx

EXPERIMENTAL PROCEDURES

69

Cell culture and treatments

70

To cause the PC12 cells to differentiate, cells were plated onto 6-well tissue culture plates at a relatively low density (2  103 cells cm2) in DMEM/F12 (Hyclone, Logan, UT, USA) medium with 5% FBS. After plating cells for 24 h, a concentrated stock of NGF (human recombinant NGF, Sigma, MO, USA) was added to the above culture medium to a final concentration of 50 ng/ml. Cells exposed to vehicle alone (5% FBS culture medium) were used as controls. To inhibit Akt signaling, the cells were pretreated with the PI3K inhibitor LY294002 at 20 lM for 2 h after being starved of FBS for 12 h.

71 72 73 74 75 76 77 78 79 80

81

Target prediction

82

Several freeware programs are available on the internet. These are commonly used to search for potential miRNA–mRNA binding sites. Three such software products were used here, TargetScan (http://www. targetscan.org/), PicTar (http://pictar.mdc-berlin.de), and microT (http://www.microrna.gr/microT). All three identified PTEN had relatively likely putative binding sites for miR-29a.

83 84 85 86 87 88 89

90 91 92 93 94 95

Real-time polymerase chain reaction [RT-PCR] (miRNA) Total RNA was extracted from 5  106 cells using Trizol (Life Technologies, Carlsbad, CA, USA) according to the manufacturer’s manual. We used the poly(A) tailing kit (New England Biolabs, MA, USA) for miRNAs

detection. The ingredients were as follows: 1-lg total RNA was mixed with 2 ll poly(A) buffer (10), 2 ll ATP (10 nM), 0.5 ll E coli poly(A) Polymerase I (E-PAP). The total volume was adjusted to 20 ll with RNase-free ddH2O. Single-stranded cDNA was obtained from RNA by reverse transcriptase (TAKARA, China). The ingredients were as follows: 0.5-lg total poly(A)-tailing RNA was mixed with 2 ll M-MLV buffer (5), 0.5 ll dNTP mixture (10 mM), 0.25 ll RNase inhibitor (40 U/ ll), 0.25 ll RTase M-MLV (RNase H-) (200 U/ll), and 1 ll adaptor(dT)15 (50 lM). The total volume was adjusted to 20 ll with RNase-free ddH2O. Reverse transcription process was performed at 42 °C for 60 min, followed by an inactivation reaction at 70 °C for 15 min. The PCR mixture contains 10 ll qPCR Master Mix (2) (Bio-Rad, USA) and 1 ll cDNA. The total volume was increased to 20 ll with ddH2O. The primer powder was fixed to the bottom of the 96-well plate. To each well 20 ll of PCR mixture was added. RT-PCR was performed using a CFX96ä Real-Time Instrument (BioRad). Real-Time PCR (RT-PCR) was conducted using the iQä SYBR Green q-PCR Super-mix (Bio-Rad) with the following primers (Table 1). Thermal cycle parameters were as follows: 95 °C for 5 min, 40 cycles at 95 °C for 15 s, 60 °C for 15 s, and 72 °C for 20 s, and 65–95 °C drawing dissociation curve. The expression of each gene was defined from the threshold cycle (Ct), and the melting temperatures (Tm) were recorded. Using the DDCt method analyzes relative changes in gene expression. Here, DDCt = (Cttarget-gene/miRNA  Ctref-genes/miRNA) PC12-NGF- (Cttarget-gene/miRNA  CtrefDDCt = target gene/ genes/miRNA) PC12. Fold change 2

Table 1. Primers for Q-PCR Primer

Sequence(50 –30 )

Base (bp)

rno-miR-29b-1 Forward rno-miR-29b-1 Reverse rno-miR-29b-2 Forward rno-miR-29b-2 Reverse rno-miR-29a Forward rno-miR-29a Reverse rno-miR-29c Forward rno-miR-29c Reverse rno-miR-32 Forward rno-miR-32 Reverse rno-miR-363 Forward rno-miR-363 Reverse rno-miR-25 Forward rno-miR-25 Reverse rno-miR-92b Forward rno-miR-92b Reverse rno-miR-92a-1 Forward rno-miR-92a-1 Reverse rno-miR-92a-2 Forward rno-miR-92a-2 Reverse PTEN Forward primer PTEN Reverse primer GAPDH Forward primer GAPDH Reverse primer u6 Forward u6 Reverse

GCCGCCTTTCATATGGTGGTTTAGATTT GCGAGCACAGAATTAATACGAC CTGGTTTCACATGGTGGCTTAG GCGAGCACAGAATTAATACGAC GCGCACTGATTTCTTTTGGTGTTCAG GCGAGCACAGAATTAATACGAC TGACCGATTTCTCCTGGTGTTC GCGAGCACAGAATTAATACGAC GCGCTATTGCACATTACTAAGTTGCA GCGAGCACAGAATTAATACGAC CGGGTGGATCACGATGCAATTT GCGAGCACAGAATTAATACGAC AGGCGGAGACACGGGCAATTGC GCGAGCACAGAATTAATACGAC AGGGACGGGACGCGGTGCAGTGTT GCGAGCACAGAATTAATACGAC AGGTTGGGATTTGTCGCAATGCT GCGAGCACAGAATTAATACGAC AGGTGGGGATTAGTGCCATTAC GCGAGCACAGAATTAATACGAC AAGGACGGACTGGTGTAA CCTGAGTTGGAGGAGTAGAT AACGGATTTGGTCGTATTG GGAAGATGGTGATGGGATT CTCGCTTCGGCAGCACA GCGAGCACAGAATTAATACGAC

28 22 22 22 26 22 22 22 26 22 22 22 22 22 24 22 23 22 22 22 18 20 19 19 17 22

Please cite this article in press as: Zou H et al. MicroRNA-29A/PTEN pathway modulates neurite outgrowth in PC12 cells. Neuroscience (2015), http://dx.doi.org/10.1016/j.neuroscience.2015.01.055

96 97 98 99 100 101 102 103 104

105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127

NSC 16036

No. of Pages 12

12 February 2015

H. Zou et al. / Neuroscience xxx (2015) xxx–xxx 128 129 130

miRNA expression level of PC12-NGFtarget gene/miRNA expression level of PC12. Each test was independently repeated four times (n = 4).

131

Real-time PCR (mRNA)

132

Total RNA (1-lg aliquots) was converted to cDNA using a reverse transcriptase kit (TAKARA). The resultant cDNA was diluted 1:5. The quantitative PCR procedures were carried out according to the manufacturer’s protocol and real-time PCR SYBR Green q-PCR Super-mix (Bio-Rad) for rat GAPDH, PTEN were used (Applied Sangon Biotech, China). The CFX96ä Real-Time Instrument was used for amplification and detection. The relative expression was calculated using the comparative Ct method. Relative mRNA levels were normalized to endogenous GAPDH mRNA expression for each sample (as previous description). The Ct value was obtained from the amplification plot with the aid of SDS software.

133 134 135 136 137 138 139 140 141 142 143 144 145

146

Western blot analysis

147

Western blot analysis was performed to detect PTEN, pAkt, NF-200, and GAP-43 protein expression in PC12 cell lines. The cultured cells were rinsed with cold PBS before treatment with RIPA lysis buffer at 4 °C for 10 min. Then the mixture was centrifuged at 4 °C at 12,000 r/min for 15 min. The supernatant was removed, and the protein concentration was measured using the RIPA method. A total of 40 lg of protein was loaded, separated by 10% SDS–PAGE and transferred to the PVDF membrane. The membrane was blocked with 5% non-fat milk power for 1 h at room temperature and then incubated overnight at 4 °C with primary antibodies antiPTEN, anti-p-Akt, anti-Akt, anti-NF-200, and anti-GAP43 (Cell Signal Technology, USA) at 1:1000, followed by a goat-anti-rabbit IgG-HRP secondary antibody (Thermo Pierce, USA). Protein levels were normalized to b-actin, using a mouse monoclonal anti-b-actin antibody (Thermo Pierce, USA).

148 149 150 151 152 153 154 155 156 157 158 159 160 161 162 163 164

165

Transfection of miRNA mimics and inhibitors

166

To determine the biological effects of each individual miRNAs on neurite outgrowth, functional analyses were performed on injury-induced miRNAs. Gain-of-function experiments were performed with pre-miRNA Precursor Molecules (Biomics Biotechnologies, China), which are also called miRNA mimics. Using transfection reagent, these small, chemically modified double-stranded RNA molecules were introduced into cells and be taken up into the RNA-induced silencing complex (RISC), thereby mimicking the activity of endogenous mature miRNAs. Loss-of-function analyses were performed with antimiRNA inhibitors. The miRNA inhibitors are chemically modified, single-stranded nucleic acids that bind specifically to complementary miRNAs. The binding between endogenous miRNA and miRNA inhibitors down-regulates the activity of endogenous miRNAs. For attenuation of endogenous miRNAs, neurons were transfected with miRNA inhibitors (mature

167 168 169 170 171 172 173 174 175 176 177 178 179 180 181 182 183

3

sequence: UAACCGAUUUCAGAUGGUGCUA) against rat miR-29a (mature sequence: UAGCACCAUCUGAAA UCGGUUA) and Caenorhabditis elegans miR-67 as control (cel-miR-67 mimic mature sequence: UCACA ACCUCCUAGAAAGAGUAGA; cel-miR-67 inhibitor mature sequence: UCUACUCUUUCUAGGAGGUUGU GA), which lacks homologs in mammals, served as a negative control. Briefly, 100 nM miRNA mimics and inhibitors were mixed with 100 ll of Nucleofector solution (Mirus) as listed in the manufacturers’ manual. All miRNA mimics and miRNA inhibitors were obtained from Biomics (China). Transient transfections of PC12 cells were performed using Lipofectamine 2000 according to the manufacturers’ protocol (Life Technologies, Carlsbad, CA, USA).

184

Expression plasmids

199

To obtain the miR-29a expressing lentiviral vector pLKOmiR-29a, a region of approximately 60 bp containing the miR-29a DNA sequences were obtained from Sangon Biotech with forward: ccggactgatttcttttggtgttcagctcgagct gaacaccaaaagaaatcagttttttg; reverse: aattcaaaaaactgattt cttttggtgtt-cagctcgagctgaacaccaaaagaaatcagt primers and cloned into EcoRI and Age I sites of the lentiviral pLKO.1-puro-vector, purchased by Addgene (Plasmid 8453). The pLKO.1-puro-sh-GFP was used as a control with the following primers: forward: ccgggcaagctgacc ctgaagttcatctcgagatga-acttcagggtcacgttgctttttg; reverse: aattcaaaaagcaagc tgaccctgaagttcatctcgagatgaactcagggt cacgttgc. Here, 3 FLAG-CMV-24-plasmid was purchased from Sigma, MO, USA. A region of approximately 1212 bp and 1928 bp containing the PTEN and PTEN + 30 -UTRs (miR-29a target sites) DNA sequence was amplified from PC12 cells genomic DNA using PCR methods (Ho et al., 1989)by using the following primers. The plasmids expressed PTEN and PTEN + 30 -UTRs in 3 FLAG-CMV-24-plasmid between the KpnI and BamH I sites via a ClonExpressä Muitis Kit with the following primers (Vazymeä, China): PTEN mRNA (total) forward: cggggtaccatgacagccatcatcaaaga; PTEN mRNA (total) reverse: cgcggatcctcagacttttgtaatttgtgaatgc; PTEN mRNA + 30 -UTRs forward P1: aattcatcgatagatctgata tcgatgacagccatcatcaaaga; PTEN mRNA + 30 -UTRs reverse P1: ggtattttatccctcttgataagtcagacttttgtaatttgtgaat gc; PTEN mRNA + 30 -UTRs forward P2: cttatcaagagggat aaaatacc; PTEN mRNA + 30 -UTRs reverse P2: ttctgagat gagtttttgttcggatccatctatctatgaccactttttttat.

200

Cell transfection and lentivirus infection

231

PC12 cells were plated on poly-D-lysine and transfected with 3 FLAG-vectors, 3 FLAG-PTEN and 3 FLAGPTEN-30 -UTR vectors using Lipofectamine 2000 in accordance with the manufacturers’ instructions. After 48 h, the cells were collected for further study. PC12 cells were infected with lentiviral pLKO-miR29a-vector (PC12-pLKO-miR-29a cells) and lentiviral pLKO-sh-GFP-vector (PC12-pLKO-sh-GFP cells) using polybrene (8 lg/ml) to medium the membrane surface charge. Subsequently, PC12-pLKO-miR-29a cells and

232

Please cite this article in press as: Zou H et al. MicroRNA-29A/PTEN pathway modulates neurite outgrowth in PC12 cells. Neuroscience (2015), http://dx.doi.org/10.1016/j.neuroscience.2015.01.055

185 186 187 188 189 190 191 192 193 194 195 196 197 198

201 202 203 204 205 206 207 208 209 210 211 212 213 214 215 216 217 218 219 220 221 222 223 224 225 226 227 228 229 230

233 234 235 236 237 238 239 240 241

NSC 16036

No. of Pages 12

12 February 2015

4 242 243

H. Zou et al. / Neuroscience xxx (2015) xxx–xxx

PC12-pLKO-sh-GFP cells were cultured with puromycin (8 lg/ml).

244

Luciferase reporter assay

245

miRNA response elements (MREs) or the whole 30 -UTRs of the target genes were cloned into the psiCHECK-2vector (Promega, USA) between the XhoI and NotI sites immediately 30 downstream of the Renilla luciferase gene. The top (sense) and bottom (antisense) strands of each MRE were designed to contain XhoI and NotI sites, respectively. After synthesis, these were annealed and ligated into the psiCheck-2-vector. A 789-bp segment containing the miR-29a MRE in the 30 -UTRs of PTEN, which was synthesized as mini-genes with and

246 247 248 249 250 251 252 253 254

without seven mismatches (AGCACCA was mutated to ATTATTA) in the seed region of the miR-29a MREs and sub-cloned into the psiCHECK-2 vector. A total of 80 ng of each psiCHECK-2 construct was co-transfected with 100 nM 29a mimic into HEK-293T cells in a 24-well plate using Lipofectamine 2000 (Invitrogen). After 48 h, the cell extract was extracted, and firefly and Renilla luciferase activities were measured using a dualluciferase reporter system (Promega) according to the manufacturer’s instructions.

255

Immunocytochemistry

265

PC12-pLKO-miR-29a cells and PC12-pLKO-sh-GFP cells at their third culture passage were seeded into the 24-well

266

Fig. 1. PC12 cell differentiation and prediction of miRNAs for PTEN. (A) Morphological changes in PC12 cells after NGF treatment. Phase-contrast images were photographed using a digital CCD camera equipped in an inverted microscope. (a) PC12 cells cultured without NGF displayed little visible neuritis. (b–d) PC12 cells were treated with 50 ng/ml NGF for 2, 4, and 6 days. As shown in the figure, both the length of neuritis and the number of neuritis-presenting cells increased gradually under the effect of NGF (Scar bar = 250 lm). (B) Concrete parameters of the matched miRNAs for PTEN. The miRNAs that an exact match to positions 2–8 of the mature miRNAs (the seed + position 8) followed by an A were selected for further study. This figure shows the amounts of each of the select miRs. (The site-type contribution reflects the average contribution of each site type. The 30 pairing contribution reflects consequential miRNA-target complementarity outside the seed region. The local AU content reflects the transcript AU content 30-nt upstream and downstream of predicted site. The position contribution reflects the distance to the nearest end of the annotated UTR of the target gene. The target site abundance contribution (TA) to context + score reflects the abundance of target sites of a miRNA family in the set of distinct 30 UTRs. The seed-pairing stability contribution (SPS) to context + score reflects the stability of a miRNA-target duplex, which is a function of the concentration of (A + U) in the seed region. The context + score for a specific site is the sum of the contribution of these six features. The context + score percentile rank is the relative number of sites for this miRNA with a less favorable context + score. The conserved branch length score is the sum of the phylogenetic branch lengths between species that contain a site. PCT has been calculated for all highly conserved miRNA families.). Please cite this article in press as: Zou H et al. MicroRNA-29A/PTEN pathway modulates neurite outgrowth in PC12 cells. Neuroscience (2015), http://dx.doi.org/10.1016/j.neuroscience.2015.01.055

256 257 258 259 260 261 262 263 264

267

NSC 16036

No. of Pages 12

12 February 2015

H. Zou et al. / Neuroscience xxx (2015) xxx–xxx 268 269 270 271 272 273 274 275 276 277 278 279 280 281 282 283 284 285 286 287 288 289 290

plate (1  104 cells/well) and cultured as described previously. After 72 h of neural induction culturing, the medium was removed, and the cells were washed three times with PBS. Subsequently, the PC12-pLKO-miR-29a cells and PC12-pLKO-sh-GFP cells were fixed with 4% paraformaldehyde for 2 h at room temperature. After three washes with PBS, the cells were permeabilized with 0.3% Triton X-100 in PBS for 10 min at room temperature. Then the cells were washed three times with PBS and blocked in 5% normal goat serum for 1 h at RT. PC12-pLKO-miR-29a cells and PC12-pLKO-shGFP cells were then incubated for 12 h with the primary antibodies at 4 °C. The primary antibodies were rabbit anti-GAP 43 (1:200, no: BA0878, BOSTER, China), mouse anti-neurofilament 200 KD (NF200 KD 1:200, no: ab77745, Abcam, UK). After incubation with the primary antibody, the cells were washed three times with PBS and incubated with a corresponding secondary antibody for 1 h at RT. The secondary antibodies were Cy3labeled goat-anti rabbit-IgG antibody and Cy3-labeled goat-anti mouse-IgG antibody (1:200, no: BA1032, Boster). Cell nuclei were stained with Hoechst 33342 (1:1000, no: H3570, Life Technologies). The control

5

group consisted of standard PC12 cells in culture without neural induction culture. Stained cells were observed using an inverted fluorescence microscope (Leica, Germany).

291

Analysis of neurite outgrowth of PC12 cells

295

Morphological analysis and quantification of PC12-pLKOmiR-29a cells with or without LY294002 and PC12-pLKOsh-GFP cells with neurite were performed under a fluorescent microscope. PC12 cells were labeled with CM-Dil (Invitrogen). CM-Dil was added to PC12 cell culture medium at a working concentration of 1 lM. PC12 cells were incubated in the culture medium with CM-Dil for 5 min at 37 °C, and then for an additional 15 min at 4 °C. More than 100 cells in at least ten randomly selected fields were counted. Cells with neurites greater than or equal to the length of their cell body were defined as positive for neurite outgrowth. The positive cells were counted and then the data were expressed as a percentage of the total cells in the field. The neurite length was identified and defined as the maximum neurite length per cell per field. The neurite length of neurite-bearing cells was measured using

296

Fig. 2. MiRNA expression during NGF-induced PC12 cell differentiation. (A–B) Real-time PCR analysis showed relative expression of individual members of nine miRNAs between the PC12 cells and PC12-NGF cells. The value of rno-miR-92a-2 in Fig. 2A and the value of rno-miR-29b-2 in Fig. 2B were used as a baseline values. All the other values were compared to each baseline. Mean ± SD (n = 4). (C) Changes in levels of miRNA expression during NGF-induced differentiation of PC12 cells. mean ± SD (n = 4). The student’s t-test was used here ⁄⁄P < 0.01 ⁄P < 0.05. (D–E) The PTEN expression at the mRNA (histogram) and protein level showed the same trend between the two kinds of cells, and b-actin was served as an internal control. PC12-NGF was used as a baseline. PC12 compared to this baseline and the Student’s t test was used here. Mean ± SD (n = 4). Student’s t-test was used here ⁄⁄P < 0.01. (F) The quantification of densitometric levels of PTEN. Mean ± SD (n = 4). Student’s t-test was used here ⁄⁄P < 0.01. Please cite this article in press as: Zou H et al. MicroRNA-29A/PTEN pathway modulates neurite outgrowth in PC12 cells. Neuroscience (2015), http://dx.doi.org/10.1016/j.neuroscience.2015.01.055

292 293 294

297 298 299 300 301 302 303 304 305 306 307 308 309 310 311 312

NSC 16036

No. of Pages 12

12 February 2015

6 313 314

H. Zou et al. / Neuroscience xxx (2015) xxx–xxx

Image J and recorded. These experiments were repeated three times and analyzed independently.

315

Statistical analysis

316

Data were obtained from three separate experiments described above and present as mean ± SEM. Oneway analysis of variance (ANOVA) with Fisher’s least significant difference (LSD) test and Student’s t-test were used to analyze the data. P < 0.05 was considered statistically significant.

317 318 319 320 321

322

RESULTS

323

PC12 cell differentiation and prediction of miRNAs for PTEN

324 325 326 327

NGF, epidermal growth factor (EGF), fibroblast growth factor (FGF), and KCl can all induce PC12 cell differentiation and neurite formation, and NGF can

cause significant neurite outgrowth (Pollock et al., 1990). In the absence of NGF, the cells are relatively round and have few visible neurites (Fig. 1Aa). When PC12 cells were cultured on six-well plates in DMEM/ F12 containing 5% FBS and 50 ng/ml NGF, neurite outgrowth was observed 2 days after induction (Fig. 1Ab). NGF was found to induce cell differentiation, leading to the smaller cell bodies and neurite formation, which can be observed 24 h after the cells were treated with 50 ng/ ml NGF. The proportion of neurite-exhibiting cells increased to >70% within 4 days (Fig. 1Ac), and the maximum neurite length was achieved on day 6 (Fig. 1Ad). The prediction of miRNAs for PTEN was performed using Targetscan (http://www.targetscan.org). Targetscan was here used to search for the most probable miRNAs against the 30 -UTR of PTEN in databases of rodent transcription. Among the predicted miRNAs, those from rats were selected as putative miRNAs for the next step of the study. Not all of the prediction results are shown.

Fig. 3. MiR-29a and PTEN levels. (A) Schematic representation of the putative highly conserved miR-29a target sites in PTEN mRNA. The putative miR-29a target sequences at PTEN 30 UTR are highly conserved across different species. A highly conserved predicted target site for miR-29a within the PTEN 30 UTR is underlined. (B) RT-qPCR confirmed the increase in miR-29a levels in 293T cells after the transfection of miR-29a mimic. Transfection of miR-29a inhibitor decreased the level of expression of miR-29a. Mean ± SD (n = 4). Student’s t-test was used here ⁄⁄⁄P < 0.001. (C) miR-29a negatively regulated PTEN expression at mRNA level. Treatment of miR-29a mimics in PC12 cells cultures significantly inhibited PTEN expression as compared with that of mimic control groups (the cel-67 mimic groups). Suppression of miR-29a activity significantly enhanced the expression of PTEN mRNA. The miR-29a mimic versus mimic control and the miR-29a inhibitor versus inhibitor control (the cel-67 inhibitor groups). Mean ± SD (n = 4). Student’s t-test was used here ⁄⁄⁄P < 0.001. (D) Western blot analysis of PTEN expression exhibited similar negative correlation of miR-29a and PTEN expression. Cells transfected with miR-29a mimics had decreased protein levels of PTEN, and cells transfected with miR-29a inhibitors had an increased expression of PTEN. b-actin served as the loading control and was used to normalize densitometry values. (E) The quantification of densitometric levels of PTEN. Mean ± SD (n = 4). Student’s t-test was used here ⁄P < 0.05. Please cite this article in press as: Zou H et al. MicroRNA-29A/PTEN pathway modulates neurite outgrowth in PC12 cells. Neuroscience (2015), http://dx.doi.org/10.1016/j.neuroscience.2015.01.055

328 329 330 331 332 333 334 335 336 337 338 339 340 341 342 343 344 345 346

NSC 16036

No. of Pages 12

12 February 2015

H. Zou et al. / Neuroscience xxx (2015) xxx–xxx 347 348 349 350 351

352 353 354 355 356 357 358 359 360 361

Among the results, we show values only for the miRNAs with an exact match to positions 2–8 of the mature miRNAs (the seed + position 8) shown. These are marked with an A in subsequent parts of this study. The concrete parameters of the matched miRNAs are presented in Fig. 1B.

MiRNA expression during PC12 cell differentiation as induced by NGF Because miRNAs play a key role in cellular differentiation by targeting multiple transcripts and affecting expression of numerous proteins(Mao et al., 2013; Wu et al., 2013), the levels of the selected miRNAs were assessed 2 days after the addition of 50 ng/ml NGF (Fig. 2A, B). The results indicated that miR-92a-1, miR-29a, miR-92b, and miR-29c expression levels increased during NGF-induced differentiation of PC12 cells (Fig. 2C). Within 48 h of NGF

7

treatment, relative mRNA and protein levels of PTEN had decreased to approximately 75% and 50% of their former levels, as compared to the undifferentiated PC12 cells (Fig. 2D–F).

362

MiR-29a and PTEN levels

366

Sequence analysis indicated that the potential miR-29a targeting sequences were located at nt681–688 (Fig. 3A) and nt1741–1747 of the PTEN 30 -UTR, but only the nt681–688 nucleotide sequences were highly conserved across different species (Fig. 3A). These target regions were validated in the following functional assays. First, it was confirmed that miR-29a levels were altered by transfecting PC12 cells with miR-29a mimic using RT-PCR. MiR-29a mimic increased miR-29a

367

Fig. 4. MiR-29a directly down-regulates PTEN. (A) Predict PTEN was potential targets for miR-29a and its validation. (B–C) Luciferase reporter assay was performed to assess the effects of miR-29a and anti-sense miR-29a on the luciferase intensity as controlled by 30 UTR of PTEN. Mean ± SD (n = 4). An ANOVA test was used here. (B) LSD test showed that miR-29a group had significantly less luciferase activity than negative controls (P = 0.005) and PTEN-mut group had significantly more than the miR-29a group (P = 0.002). (C) LSD test showed the miR-29a inhibitor group to have significantly more luciferase activity than negative controls (P = 0.024) and the PTEN-mut group showed significantly less than the miR-29a inhibitor group (P = 0.002) ⁄⁄P < 0.01, ⁄P < 0.05. (D) Western blot analysis of PTEN expression confirmed that miR-29a could directly down-regulate PTEN expression. 293T Cells co-transfected with miR-29a mimics and 3⁄FLAG-PTEN-30 UTRs had decreased protein levels of FLAG-PTEN, and 293T cells co-transfected with miR-29a mimic and 3⁄FLAG-PTEN-30 UTRs-mut had an increased expression of FLAG-PTEN. Here, 100 nM of miR-29a was used for all four conditions. p-Akt, a gene expressed downstream of PTEN, had the opposite tendency. b-actin served as the loading control and was used to normalize densitometry values. (E–G) The quantification of densitometric levels of FLAG-PTEN, Akt, and p-Akt. Mean ± SD (n = 4). An ANOVA test was used here. (E) LSD test showed there to be significantly less luciferase activity in the PTEN + 30 UTRs group than in the PTEN group (P = 0.000) and significantly more in the 30 UTRs-mut group than in the PTEN + 30 UTRs group (P = 0.004). (G) The PTEN group showed significantly less luciferase activity than the control group (P = 0.005) and the PTEN + 30 UTRs group showed significantly more than the PTEN group (P = 0.000). The 30 UTRs-mut group showed significantly less than the PTEN + 30 UTRs group (P = 0.004) ⁄⁄P < 0.01, ⁄⁄⁄P < 0.001. Please cite this article in press as: Zou H et al. MicroRNA-29A/PTEN pathway modulates neurite outgrowth in PC12 cells. Neuroscience (2015), http://dx.doi.org/10.1016/j.neuroscience.2015.01.055

363 364 365

368 369 370 371 372 373 374 375 376

NSC 16036

No. of Pages 12

12 February 2015

8 377 378 379 380 381 382 383 384 385 386 387 388 389 390 391 392 393

394 395 396 397

H. Zou et al. / Neuroscience xxx (2015) xxx–xxx

levels 235-fold, and miR-29a inhibitor decreased miR-29a levels by 60% that of the inhibitor control (Fig. 3B). MiRNAs can reduce protein levels by translational arrest and by degradation of mRNA. For this reason, levels of PTEN mRNA were assessed after transfection and results showed that miR-29a mimics reduced PTEN mRNA levels by 44% (Fig. 3C). However, miR-29a inhibitors significantly elevated the mRNA level of PTEN (Fig. 3C). These results demonstrated that miR-29a levels are inversely correlated with PTEN expression at mRNA levels in PC12 cells. Protein analysis was performed on PTEN in PC12 cells. Inhibition of endogenous miR-29a by transfection with the miR-29a inhibitor resulted in a significant, 41% increase in PTEN expression (Fig. 3D–E). The miR-29a mimic reduced PTEN protein levels to 54% that of the mimic control group (Fig. 3D–E). MiR-29a and regulation of PTEN expression and phosphorylation of AKT The miR-29a sequence was searched in the TargetScan with the 30 -UTR of the rat PTEN gene containing one

separate miR-29a-binding seed sequence that had been conserved across evolution. They are located in the nucleotide position 681–688 with TargetScan context score 0.30 (Fig. 1B). To demonstrate the direct interaction between miR-29a and PTEN mRNA, the PTEN-30 -UTR segment, which includes a potential target site for miR-29a, downstream of the psiCHECK-2 luciferase reporter gene, was cloned. This vector was co-transfected into 293T cells with miR-29a mimic or negative controls. Luciferase activity in the miR-29a group was markedly lower than in negative controls, by 46.3% (Fig. 4B). A psiCHECK-2 vector containing a 6bp mutant was generated in the seed sequence (psiCHECK-2-PTEN-mut vector) (Fig. 4A). The current results showed that the miR-29a mimic did not affect luciferase activity in the psiCHECK-2-PTEN-mut vector (Fig. 4B). Blocking the expression of miR-29a with the miR-29a inhibitor showed increased luciferase intensity in 293T cells. The psiCHECK-2-PTEN-mut vector cotransfected with miR-29a inhibitor did not show changes in luciferase activity in 293T cells (Fig. 4C). These results were consistent with the bioinformatic prediction

Fig. 5. Effect of miR-29a on PC12 cells. (A) RT-PCR confirmed the increase in miR-29a levels in PC12 cells after transfection with the lentivirus and miR-29a vectors. Mean ± SD (n = 4). Student’s t-test was used here ⁄⁄⁄P < 0.001. (B) MiR-29a vectors negatively regulated PTEN expression at the mRNA level. PC12-pLKO-miR-29a cell cultures significantly inhibited PTEN relative to PC12-pLKO-sh-GFP cells. Mean ± SD (n = 4). Student’s t-test was used here ⁄⁄⁄P < 0.001. (C) Western blot analysis of PTEN expression exhibited similar negative correlation of miR-29a and PTEN expression. PC12-pLKO-miR-29a cells had decreased protein levels of PTEN and increased protein levels of p-Akt, but did not show any changes in the total Akt level. b-actin was used to normalize densitometry values. (D–F) Quantification of densitometric levels of PTEN, p-Akt, and Akt. Mean ± SD (n = 4). Student’s t-test was used here ⁄⁄⁄P < 0.001. Please cite this article in press as: Zou H et al. MicroRNA-29A/PTEN pathway modulates neurite outgrowth in PC12 cells. Neuroscience (2015), http://dx.doi.org/10.1016/j.neuroscience.2015.01.055

398 399 400 401 402 403 404 405 406 407 408 409 410 411 412 413 414 415 416 417 418 419

NSC 16036

No. of Pages 12

12 February 2015

H. Zou et al. / Neuroscience xxx (2015) xxx–xxx 420 421 422 423 424 425 426 427 428

indicating the 30 -UTR of PTEN mRNA as a target for miR29a. To confirm the results given above, PTEN and the PTEN-30 -UTR segment, which includes a potential target site for miR-29a, were cloned downstream of the FLAG gene to generate the 3 FLAG-PTEN and FLAGPTEN-30 -UTRs vectors. The vectors were co-transfected into 293T cells with the miR-29a mimic. The protein expression level was markedly lower than in negative

9

controls, with an 84.3% reduction (Fig. 4D–E). A3 FLAG-PTEN-30 -UTRs-mut vector was generated as given above. Western blot analysis showed no decrease in the expression of FLAG (Fig. 4D–E). To assess pathways downstream of miR-29a/PTEN, Western blot analysis was conducted to assess phosphorylation of AKT. These results indicated that phosphorylation of AKT was more pronounced in the 3 FLAG-PTEN-30 UTR group than that in the 3 FLAG-PTEN group. This

Fig. 6. The effect of miR-29a and Akt pathway on axonal outgrowth. (A) Western blot analysis of Akt and Akt phosphorylation expression in PC12pLKO-sh-GFP cells and PC12-pLKO-miR-29a cells treated with or without PI3-kinase inhibitor (LY294002). (B–C) The quantification of densitometric levels. Mean ± SD (n = 4). An ANOVA test was used here. (B) LSD test showed the miR-29a group to have significantly more luciferase activity than the control group (P = 0.000) and the LY294002 group showed significantly less than the miR-29a group (P = 0.008) ⁄⁄ P < 0.01, ⁄⁄⁄P < 0.001. (D) Neurite outgrowth by PC12 cells were observed at different conditions. PC12 cells were labeled by CM-Dil (red). (a) PC12-pLKO-sh-GFP cells were cultured in DMEM/F12 medium. (b) PC12-pLKO-miR-29a cells were cultured in DMEM/F12 medium. (c) PC12pLKO-miR-29a cells were pretreated with LY294002 for 2 h before culture in DMEM/F12 medium. (a, c) PC12 cells with few neurites were round and red. (b) PC12 cells with neurites were observed in. Scale bar = 50 lm. (E–F) The number of cells with neurites and the length of neurites are shown in the bar graphs E and F, respectively. Data are presented as mean ± SEM from three independent experiments. An ANOVA test was used here. Fisher’s least significant difference (LSD) test showed there to be significantly more luciferase activity in the miR-29a group than in the control group (P = 0.007) and significantly less in the LY294002 group than in the miR-29a group (P = 0.004). (F) There was significantly more luciferase activity in the miR-29a group than in the control group (P = 0.000) and significantly less in the LY294002 group than in the miR-29a group (P = 0.006) ⁄⁄P < 0.01, ⁄⁄⁄P < 0.001. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.) Please cite this article in press as: Zou H et al. MicroRNA-29A/PTEN pathway modulates neurite outgrowth in PC12 cells. Neuroscience (2015), http://dx.doi.org/10.1016/j.neuroscience.2015.01.055

429 430 431 432 433 434 435 436 437

NSC 16036

No. of Pages 12

12 February 2015

10 438 439 440 441

442 443 444 445 446 447 448 449 450 451 452 453 454 455 456

H. Zou et al. / Neuroscience xxx (2015) xxx–xxx

was reversed in the 3 FLAG-PTEN-30 -UTRs-mut group (Fig. 4D, F, G). These data suggested that miR-29a could directly down-regulate PTEN expression and phosphorylation of AKT. MiR-29a, axonal outgrowth in PC12 cells, and modulation of PI3K/Akt signaling pathways PTEN is reported to restrict axon branching. The role of miR-29a in neurite growth was investigated further. First, two stable cell lines were generated, PC12-pLKOmiR-29a and PC12-pLKO-sh-GFP. Then, changes in PTEN mRNA and protein levels were searched using RT-PCR and Western blot analysis. Introduction of miR29a caused a sixfold increase in miR-29a expression over controls (Fig. 5A), a 51% decrease in PTEN mRNA levels, and a 55% decrease in PTEN protein levels (Fig. 5B–D). In PC12-pLKO-miR-29a cells, there was a significant decrease in PTEN expression accompanied by 2.25-fold up-regulation of AKT phosphorylation relative to controls (Fig. 5C, E, F).

Neurite outgrowth was quantified in these two cell lines. A positive association was observed between miR-29a expression and neurite outgrowth in PC12 cells. PC12pLKO-miR-29a cells were treated in the presence or absence of a PI3K inhibitor, LY294002, at 20 lM. As shown by the Western blot analysis in Fig. 6A, the PI3K inhibitor LY294002 completely blocked the phosphorylation of the miR-29a-induced PI3K downstream target Akt on serine 473. PC12-pLKO-shGFP cells showed primarily stubby neurite outgrowth (Fig. 6Ca), and PC12-pLKO-miR-29a cells had longer neurites (Fig. 6Cb). During blockage of the PI3K/Akt signaling pathways, PC12-pLKO-miR-29a cells regressed to primarily stubby neurite outgrowth (Fig. 6Cc). There was a significantly greater proportion of positive neurite-bearing cells, in PC12-pLKO-miR-29a cells 61.2 ± 4.5% (P < 0.01) than in PC12-pLKO-shGFP cells (5.1 ± 0.3%). During blockage of the PI3K/Akt signaling pathways, the relative number of positive neurite-bearing cells was significantly decreased, to 21.1 ± 1.5% (P < 0.01) (Fig. 6D). In addition, the

Fig. 7. GAP-43 and NF-200 expression in PC12-sh-GFP cells and PC12-miR-29a cells. (A) Representative immunofluorescence with anti-GAP43 and anti-NF-200 for (b, d) PC12-pLKO-miR-29a and (a, c) PC12-pLKO-sh-GFP cells after 72 h of culture. Mean ± SD (n = 4). Scale bar = 50 lm. (B–C) RT-PCR showed that PC12-pLKO-miR-29a expressed NF-200, GAP-43 higher than PC12-pLKO-sh-GFP cells after 72 h of culture. Mean ± SD (n = 4). Student’s t-test was used here ⁄⁄P < 0.01, ⁄⁄⁄P < 0.001. (D, F) Western blot analysis represents the protein bands on the gel for PC12-pLKO-miR-29a and PC12-pLKO-sh-GFP cells, respectively. There were significant differences in neural protein expression. (E, G) The quantification of densitometry levels of GAP-43 and NF-200. Mean ± SD (n = 4). Student’s t-test was used here ⁄⁄⁄P < 0.001. Please cite this article in press as: Zou H et al. MicroRNA-29A/PTEN pathway modulates neurite outgrowth in PC12 cells. Neuroscience (2015), http://dx.doi.org/10.1016/j.neuroscience.2015.01.055

457 458 459 460 461 462 463 464 465 466 467 468 469 470 471 472 473 474 475 476 477

NSC 16036

No. of Pages 12

12 February 2015

11

H. Zou et al. / Neuroscience xxx (2015) xxx–xxx 478 479 480 481 482 483 484 485 486 487 488 489 490 491 492 493 494 495 496 497 498 499 500 501 502 503 504

proportion of positive neurite-bearing cells in PC12-pLKOmiR-29a cells was significantly higher than in control cells (P < 0.01). Likewise, compared with PC12-pLKO-shGFP cells (10.1 ± 1.3 lm), the length of the longest neurite significantly increased to 161.2 ± 10.6 lm (P < 0.001) in PC12-pLKO-miR-29a cells. When PC12pLKO-miR-29a cells were treated with 20 lM LY294002 for 2 h, the length of the longest neurite was only 18.1 ± 7.5 lm (P < 0.01) (Fig. 6E). A strong association between neurite outgrowth and expression of GAP-43 and NF-200 has been reported in previous studies (Benowitz et al., 1997; Lin et al., 2014). For this reason, GAP-43 and NF-200 expression were studied in PC12-sh-GFP and PC12-miR-29a cells. A significant increase was observed in GAP-43 and NF-200 immunostaining in PC12-pLKO-miR-29a cells (Fig. 7Ab, d). The GAP-43 mRNA level was studied further with RT-PCR. There was a significant increase in GAP-43 and NF-200 mRNA in the PC12-pLKO-miR-29a cells relative to the PC12-pLKO-sh-GFP cells (Fig. 7B, C). Western blot analysis was performed to confirm the results of RT-PCR. PC12-pLKO-miR-29a cells expressed NF200 and GAP-43 protein at twice and five times as much as PC12-pLKO-sh-GFP cells, respectively (Fig. 7D–G). This is consistent with immune-fluorescent data demonstrating a significant increase in axon outgrowth after over-expression of miR-29a.

Although neurite outgrowth is accompanied by altered transcription of more than 1000 genes, recent studies have demonstrated that miRNAs and their downstream portion participate in neuron development, proliferation, and differentiation. For example, miR-21 promotes neurite outgrowth by directly down-regulating Sprouty2 expression (Strickland et al., 2011); and miR-145 inhibits neurite outgrowth by inhibiting Robo2 expression (Zhang et al., 2011). This report showed that miR-29a could directly decrease the expression of PTEN, increase phosphorylation of Akt, activate the Akt pathway, and promote neurite outgrowth. Previous studies have examined the effects of PTEN on neuronal differentiation. To date, few studies have consistently reported that PTEN deletions do not prevent neuronal differentiation but can alter neuronal morphology, proliferation, and migration (Izumi et al., 2011; Lachyankar et al., 2000b). PTEN is important to central axonal growth (Park et al., 2008). PTEN inhibition facilitates the intrinsic regenerative outgrowth of adult peripheral axons, and it might act as an intrinsic brake on the regenerative outgrowth (Christie et al., 2010). All in all, the current results confirm that miR-29a could promote neurite outgrowth by targeting PTEN. Although it is too early to speculate on the clinical uses of miRNAs, it does provide possible topics for research. The results of the present study suggest that over-expression of miR-29a might affects neurite outgrowth by down-regulating PTEN and other miR-29a targets. However, the underlying mechanisms require further investigation.

536 537 538 539 540 541 542 543 544 545 546 547 548 549 550 551 552 553 554 555 556 557 558 559 560 561 562 563 564

505

DISCUSSION

CONCLUSION

565

506

Here, the function of miR-29a/PTEN pathway on neurite outgrowth was demonstrated in PC12 cells. These findings provide the first evidence that miR-29a plays an important role in neurite outgrowth via down-regulating PTEN expression in PC12 cells. Emerging evidence indicates that miRNAs are important mediators of axonal regeneration (Fineberg et al., 2009). NGF is an important mediator. It causes significant neurite outgrowth in neurons. Many studies have explored the expression profile of miRNAs under NGF treatment, such as miR-17-92 cluster and miR-29 cluster (Zhang et al., 2013; Montalban et al., 2014). This study showed that miR-92a-1, miR-29a, miR-92b, and miR29c were up-regulated by NGF in PC12 cells. Previous studies have shown that miR-29 is involved in translational repression of a wide range of target genes. MiR29a modulates cellular differentiation and migration by regulating a wide range of target mRNAs. Reconstitution of miR-29 in rhabdomyosarcoma (RMS) in mice inhibits tumor growth and stimulates differentiation by targeting the YY1 transcription factor. This suggests that miR-29 acts as a tumor suppressor through its pro-myogenic function (Wang et al., 2008). In the development of hepatocellular carcinoma (HCC), miR-29a is involved in the regulation of migration of hepatoma cells. Its action is mediated by the HBx through modulation of Akt phosphorylation (Kong et al., 2011a). These findings confirm that miR-29a can promote neural outgrowth by down-regulating PTEN and increasing Akt phosphorylation for the first time.

The present work showed that miR-29a, one of the 9 predicted miRNAs in PC12 cells after NGF-induction, can regulate neurite outgrowth by targeting PTEN, a major inhibitor of axonal growth. It was also noted that knockdown of PTEN by miR-29a might promote Akt phosphorylation to improve the outgrowth ability of neurite. MiR-29a is an important regulator of neurite outgrowth. It acts by targeting PTEN and may be a suitable therapeutic target for neural disease.

566

Acknowledgments—This study was supported by grants from Jiangsu Province Health Department (KF200956) and the Changzhou Science & Technology Bureau (CJ20122027) PR China, and the National Science Foundation of China (81471263, 31100964, 8137218, 31200676). We are also would like to thank Yana Ma (PhD, Associate Professor, vice director of Department of Social Medicine, vice Chairman of the Union of Public Health School of Soochow University, Suzhou) for her statistical guidance during the revision of this manuscript and the anonymous reviewer for his or her professional comments and suggestions during the review process.

575

REFERENCES

586

Benowitz LI et al. (1997) Gap-43: an intrinsic determinant of neuronal development and plasticity. Trends Neurosci 20:84–91. Christie KJ et al. (2010) PTEN inhibition to facilitate intrinsic regenerative outgrowth of adult peripheral axons. J Neurosci 30:9306–9315. Fineberg SK et al. (2009) MicroRNAs potentiate neural development. Neuron 64:303–309.

587 588 589 590 591 592 593

507 508 509 510 511 512 513 514 515 516 517 518 519 520 521 522 523 524 525 526 527 528 529 530 531 532 533 534 535

Please cite this article in press as: Zou H et al. MicroRNA-29A/PTEN pathway modulates neurite outgrowth in PC12 cells. Neuroscience (2015), http://dx.doi.org/10.1016/j.neuroscience.2015.01.055

567 568 569 570 571 572 573 574

576 577 578 579 580 581 582 583 584 585

NSC 16036

No. of Pages 12

12 February 2015

12 594 595 596 597 598 599 600 601 602 603 604 605 606 607 608 609 610 611 612 613 614 615 616 617 618 619 620 621 622 623 624 625 626 627 628 629 630 667 668 669

H. Zou et al. / Neuroscience xxx (2015) xxx–xxx

Gimm O et al. (2000) Differential nuclear and cytoplasmic expression of PTEN in normal thyroid tissue, and benign and malignant epithelial thyroid tumors. Am J Pathol 156:1693–1700. Ho SN et al. (1989) Site-directed mutagenesis by overlap extension using the polymerase chain reaction. Gene 77:51–59. Holand K et al. (2011) The phosphoinositide 3-kinase signaling pathway as a therapeutic target in grade IV brain tumors. Curr Cancer Drug Targets 11:894–918. Izumi B et al. (2011) Microrna-223 expression in neutrophils in the early phase of secondary damage after spinal cord injury. Neurosci Lett 492:114–118. Kong G et al. (2011a) Upregulated microrna-29a by hepatitis B virus X protein enhances hepatoma cell migration by targeting PTEN in cell culture model. PLoS One 6:e19518. Kong G et al. (2011b) Upregulated microrna-29a by hepatitis b virus x protein enhances hepatoma cell migration by targeting pten in cell culture model. PLoS One(6):e19518. Lachyankar MB et al. (2000a) A role for nuclear PTEN in neuronal differentiation. J Neurosci 20:1404–1413. Lachyankar MB et al. (2000b) A role for nuclear PTEN in neuronal differentiation. J Neurosci 20:1404–1413. Li B et al. (2013) Mir-26a promotes neurite outgrowth by repressing PTEN expression. Mol Med Rep 8:676–680. Liaw D et al. (1997) Germline mutations of the PTEN gene in Cowden disease, an inherited breast and thyroid cancer syndrome. Nat Genet 16:64–67. Lin W et al. (2014) Bone marrow stromal cells promote neurite outgrowth of spinal motor neurons by means of neurotrophic factors in vitro. Neurol Sci 35:449–457. Liu K et al. (2010) Pten deletion enhances the regenerative ability of adult corticospinal neurons. Nat Neurosci 13:1075–1081. Mao S et al. (2013) Mir-17 regulates the proliferation and differentiation of the neural precursor cells during mouse corticogenesis. FEBS J. Montalban E et al. (2014) Mir-21 is an Ngf-modulated microRNA that supports Ngf signaling and regulates neuronal degeneration in pc12 cells. Neuromolecular Med 16:415–430.

Musatov S et al. (2004) Inhibition of neuronal phenotype by PTEN in PC12 cells. Proc Natl Acad Sci U S A 101:3627–3631. Park KK et al. (2008) Promoting axon regeneration in the adult CNS by modulation of the PTEN/mTOR pathway. Science 322:963–966. Pollock JD et al. (1990) Differential effects of ngf, fgf, egf, camp, and dexamethasone on neurite outgrowth and sodium channel expression in PC12 cells. J Neurosci 10:2626–2637. Qureshi IA et al. (2012) Emerging roles of non-coding RNAs in brain evolution, development, plasticity and disease. Nat Rev Neurosci 13:528–541. Rasheed BK et al. (1997) Pten gene mutations are seen in high-grade but not in low-grade gliomas. Cancer Res. 57:4187–4190. Stolarov J et al. (2001) Design of a retroviral-mediated ecdysoneinducible system and its application to the expression profiling of the PTEN tumor suppressor. Proc Natl Acad Sci U S A 98:13043–13048. Strickland IT et al. (2011) Axotomy-induced mir-21 promotes axon growth in adult dorsal root ganglion neurons. PLoS One 6:e23423. Wang H et al. (2008) Nf-kappab-yy1-mir-29 regulatory circuitry in skeletal myogenesis and rhabdomyosarcoma. Cancer Cell 14:369–381. Weng LP et al. (2002) PTEN blocks insulin-mediated ETS-2 phosphorylation through map kinase, independently of the phosphoinositide 3-kinase pathway. Hum Mol Genet 11:1687–1696. Wu R et al. (2013) MicroRNA-128 regulates the differentiation of rat bone mesenchymal stem cells into neuron-like cells by Wnt signaling. Mol Cell Biochem. Zhang HY et al. (2011) MicroRNAs 144, 145, and 214 are downregulated in primary neurons responding to sciatic nerve transection. Brain Res 1383:62–70. Zhang Y et al. (2013) The microrna-17-92 cluster enhances axonal outgrowth in embryonic cortical neurons. J Neurosci 33:6885–6894.

(Accepted 23 January 2015) (Available online xxxx)

Please cite this article in press as: Zou H et al. MicroRNA-29A/PTEN pathway modulates neurite outgrowth in PC12 cells. Neuroscience (2015), http://dx.doi.org/10.1016/j.neuroscience.2015.01.055

631 632 633 634 635 636 637 638 639 640 641 642 643 644 645 646 647 648 649 650 651 652 653 654 655 656 657 658 659 660 661 662 663 664 665 666