Parkinsonism and Related Disorders 20 (2014) 1399e1404
Contents lists available at ScienceDirect
Parkinsonism and Related Disorders journal homepage: www.elsevier.com/locate/parkreldis
PRRT2 truncated mutations lead to nonsense-mediated mRNA decay in Paroxysmal Kinesigenic Dyskinesia Li Wu 1, Hui-Dong Tang 1, Xiao-Jun Huang, Lan Zheng, Xiao-Li Liu, Tian Wang, Jing-Yi Wang, Li Cao*, Sheng-Di Chen* Department of Neurology and Institute of Neurology, Rui Jin Hospital, School of Medicine, Shanghai Jiao Tong University, Shanghai 200025, China
a r t i c l e i n f o
a b s t r a c t
Article history: Received 22 June 2014 Received in revised form 8 October 2014 Accepted 12 October 2014
Background and purpose: Paroxysmal Kinesigenic Dyskinesia (PKD) is an episodic involuntary movement disorder characterized by recurrent and brief involuntary movements. Proline-rich transmembrane protein 2 (PRRT2) has been identified as the causative gene for PKD, Benign familial infantile convulsions (BFIC) and Infantile convulsions with choreoathetosis (ICCA). As well, PRRT2 mutations have been detected in patients with PED or PNKD. To date, most of the mutations have been found to be nonsense. Method: We used inhibitors of nonsense-mediated mRNA decay (NMD) pathway –emetine dihydrochloride hydrate and cycloheximide and silencing regulator of nonsense transcripts 1(UPF1) with immortalized lymphoblasts to detect whether the truncated mutations lead to NMD, a type of mRNA surveillance in every eukaryotic cell proved so far and that generally degrades mRNA containing premature translation termination codons (PTCs). In addition, we transfected the SH-SY5Y cells with wildtype and mutant PRRT2 plasmids to identify the PRRT2 protein's subcellular localization. Results: We detected, low expression of truncated PRRT2 and was further rescued by applying the inhibitor of NMD pathway, suggesting that NMD plays an important role in the pathogenesis of PKD by haplo-insufficiency. Moreover, for the small portion of undegraded mutant PRRT2 that was translated into truncated proteins, their cellular localization changed from membrane to cytoplasm and nuclear, which might lead to a functional loss. Conclusion: We suggest that the NMD of truncated mutation of PRRT2 and altered cellular localization of undegraded of PRRT2, might lead to PKD. © 2014 Elsevier Ltd. All rights reserved.
Keywords: Paroxysmal Kinesigenic Dyskinesia (PKD) Proline-rich transmembrane protein 2 (PRRT2) Nonsense-mediated mRNA decay (NMD) Regulator of nonsense transcripts 1(UPF1)
1. Introduction Paroxysmal Kinesigenic Dyskinesias (PKD) is an episodic involuntary movement disorder characterized by recurrent and brief attacks induced by sudden voluntary movement [1]. The attacks, which last from seconds to 1 min, usually comprise dystonia, chorea, athetosis, ballism, or a combination of all or any [2]. Other intermittent neurological disorders, such as infantile convulsions (IC) or infantile convulsions with choreoathetosis (ICCA) have also been reported amongst some PKD patients [3]. Proline-rich transmembrane protein 2 (PRRT2) has been identified as a causative gene for PKD, ICCA and benign familial infantile convulsions (BFIC)
* Corresponding authors. E-mail addresses: [email protected] (L. Cao), [email protected] (S.-D. Chen). 1 Authors contributed equally to this work. http://dx.doi.org/10.1016/j.parkreldis.2014.10.012 1353-8020/© 2014 Elsevier Ltd. All rights reserved.
[4e6], and more recently, patients with paroxysmal exertioninduced dyskinesias (PED) or paroxysmal non-kinesigenic dyskinesia (PNKD) were found to harbor PRRT2 mutations [7,8]. All these findings widen the spectrum of phenotypes caused by PRRT2 mutations, which may be referred to as PRRT2-related diseases (PRD). To date, more than 50 different PRRT2 mutations have been documented [4e6]. Nonsense mutations which harbor premature termination codons (PTCs) are the most common types, and c.649dupC (p.R217PfsX8) is a hot-spot [8e24]. We summarized all the truncated mutations of PRRT2 and found that they locate more than 50 ~ 55 bp upstream of the last exoneexon junction, in line with the known mechanism of NMD. We presumed that most of those nonsense mutated PRRT2 transcripts were not translated into protein by selectively triggering the nonsense-mediated mRNA decay (NMD) pathway, a transcriptional regulatory mechanism that efficiently degrades mRNA with PTCs to diminish the production of potentially deleterious truncated proteins [25].
1400
L. Wu et al. / Parkinsonism and Related Disorders 20 (2014) 1399e1404
2. Materials and methods 2.1. Subjects We used immortalized B lymphoblastoid cell lines cultured from the blood of participants, according to the standard protocol [26]. A total of 4 subjects were recruited into this study: one healthy control and three PKD patients. The patients with PRRT2 mutations (p.Q163X, p.G192WfsX8, p.R217PfsX8) have been reported in our previous studies [12,14]. All the participants including normal controls signed informed consent, and the study was approved by Ruijin Hospital Ethics Committee.
using lipofectamine 2000 (Invitrogen). During the immunobloting process, mouse anti-Flag antibody (1:1000, sigma) and goat anti-mouse HRP conjugated antibody (1:10,000, Invitrogen) were used to detect Flag-PRRT2 fusion proteins expression in SH-SYSY cells. During the immunofluorescence process, mouse anti-Flag antibody (1:100, sigma) and goat anti-mouse- FIT 488 conjugated antibody (1:800, Invitrogen) were used to detect the localization of Flag-PRRT2 fusion protein in SH-SY5Y cells. All the experiments were conducted at least three times and then analyzed with confocal microscopy (Leica SP5).
3. Results
2.2. Cell culture and treatment with siRNAs SH-SYSY cells were purchased from ATCC and cultured in DMEM supplemented with 10% FBS and 100 U/ml penicillin/streptomycin (Invitrogen) at 37 C with 5% CO2. UPF1 siRNA 1879e1901 (50 -AAGATGCAGTTCCGCTCCATTTT-30 ); 1020e1038(50 GATGCAGTTCCGCTCCATT-30 ) were synthesized by GenePharma. UPF1 siRNA was used to transfect SH-SY5Y by lipofectamine 2000 (Invitrogen) serum-free media for 4 h at 60 nMol and 120 nMol. Western blot and qPCR were used to confirm the knockdown efficiency of UPF1 siRNAs. 2.3. NMD analysis The NMD analysis was performed according to a modified protocol [27,28]. Immortalized lymphoblasts were treated with emetine dihydrochloride hydrate (100 ug/ml, 6 h; Merck) or cycloheximide (25 ug/ml, 4 h; Beyotime). Then total RNA was extracted from immortalized B lymphoblastoid cell lines using a standard method with TRIZOL Reagent (Invitrogen), and reverse-transcribed using the PrimeScript® RT reagent Kit (Takara) according to the manufacture's instruction. The primers for amplification of mutation-containing fragments are summarized in Table 1. To determine whether the truncated mutation of PRRT2 degrades in NMD pathway, we designed primers to verify PRRT2 gene. Forward: CTGCTCCCCAACCAGACC; Reverse: CACTTATACACGCCTAAGTTG for detecting the level of the mutant allele; Forward: CTTATGCTGTCATGTCCCGGAACAG; Reverse: CCCCTCACTTATACACGCCTAAG for detecting the quantity of the PRRT2 mRNA. The purified PCR products were sequenced on an ABI 3730 XL sequencer (Applied Biosystems and Life Technologies, USA).
2.4. Generation of truncated plasmids and mutagenesis plasmids The truncated plasmids: human PRRT2 sequence was amplified by RT-PCR from a cDNA library of SH-SY5Y cells. PCR products encoding full-length (amino acid 1e340) or truncated (amino acid 1e163; 1e200; 1e225) human PRRT2 were cloned into pEGFP-N1 at EcoRI and BamHI sites and were verified by sequencing. Mutagenesis plasmids: PRRT2-WT (wild type) and PRRT2-R217PfsX8 mutant plasmids in p3XFLAG-CMV-10-expression vector were provided by Professor Fu (Department of Neurology, UCSF, San Francisco, CA 94158, USA). The PRRT2-Q163X and PRRT2G192WfsX8 mutation plasmids were generated using the Site-directed Gene Mutagenesis Kit (Beyotime). The primers for truncated plasmids and mutagenesis plasmids are summarized in Table 1. 2.5. Western blotting and immunofluorescence microscopy SH-SY5Y cells were transfected with PRRT2 plasmids (p3XFLAG-CMV-10PRRT2-WT/R217PfsX8/Q163X/G192WfsX8 fusion construct and empty plasmid)
Direct sequencing of mutant PRRT2 cDNA from the EBVtransformed lymphoblasts revealed a low expression of the PRRT2 mutant allele (Fig. 1, upper panel). After the lymphoblasts were treated with cycloheximide or emetine dihydrochloride hydrate (the inhibitor of NMD), we found that the expression level of the mutant allele was elevated almost equally to the wild-type alleles by direct sequencing of the corresponding cDNA (Fig. 1, lower panel), suggesting that most of the mutated transcript was degraded through nonsense-mediated mRNA Decay. We tried to measure the PRRT2 mRNA level of EBV-transformed lymphoblasts. The results showed that the PRRT2 mRNA level was decreased in all 3 PKD patients (Supplement Fig. 1). To investigate whether the insufficient expression of mutant PRRTS is due to mRNA degradation via NMD, we transfected SHSY5Y cells with PRRT2 plasmids (p3XFLAG-CMV-10-PRRT2-WT/ Q163X/G192WfsX8/R217PfsX8). In western bloting, protein extracts from Flag-PRRT2-WT cells showed a strong signal at ~65 kDa (Fig. 2A, left side, lane2) while a relatively weaker signal could be detected from the Flag-PRRT2-Mutant cells. (Fig. 2A, left side, lane 3,4,5). When we cotransfected SH-SY5Y cells with PRRT2-WT and 3 PRRT2-mutant plasmids, the expression of truncated mutant (Q163X, G192WfsX8 and R217PfsX8) proteins were significantly lower when compared to that of the wild-type PRRT2 protein (Fig. 2A, right side). The expression of mutant PRRT2 protein decreased to about 20% of wild-type PRRT2 (Fig. 2B). This suggests that the majority of the mutated transcripts were degraded and a few residual mutated transcripts were predicted to yield a Nterminally truncated protein. We also tried to conduct testing by using truncated plasmids as comparisons to mutagenesis plasmids. We prepared three truncated plasmids using GFP-fusion plasmids. There was a difference between the expression of truncated plasmids and the mutagenesis plasmids. As shown in Supplement Fig. 2, there was no decrease in the PRRT2 protein level in truncated plasmids (Supplement Fig. 2C) as compared to wild type plasmid. We also examined PRRT2 protein degradation with the rescue of proteasome inhibitors. The degradation of intracellular proteins consists of two resources: ubiquitin-proteasome system
Table 1 Primers for the reverse transcription (RT)-PCR and PRRT2 mutagenesis assays. Primer
Sequence (50 > 30 )
Tm ( C)
PRRT2-RT-F PRRT2-RT-R PRRT2-RT-iso1-F PRRT2-RT-iso1-R GAPDH-RT-F GAPDH-RT-R PRRT2-N1-GFP-F PRRT2-N1-GFP-R PRRT2-Q163-N1-GFP-R PRRT2-G192WfsX8 -N1-GFP-R PRRT2-R217PfsX8-N1-GFP-R PRRT2-Q163X mutation-F PRRT2-Q163X mutation-R PRRT2-G192WfsX8 mutation-F PRRT2-G192WfsX8 mutation-R
CTTATGCTGTCATGTCCCGGAACAG CCCCTCACTTATACACGCCTAAG CTGCTCCCCAACCAGACC CACTTATACACGCCTAAGTTG CGGAGTCAACGGATTTGGTCGTAT AGCCTTCTCCATGGTGGTGAAGAC GGAATTCGCCACCATGGCAGCCAGCAGCTCTG CGGGATCCCACTTATACACGCCTAAGTTG CGGGATCCTGGGTAGGGAGCTCTGGTTG CGGGATCCCCATCACCAGCCTGCAGGGGCAC GGAATTCTCAACCAGCTGCTGCAGCACTCGGGGGGGGGGCC CCAGAGCTCCCTACCTAGGAGGACCCCACCCC GGGGTGGGGTCCTCCTAGGTAGGGAGCTCTGG CCTGCAGGCTGGTGATTGGGGAAGAGGGCCCAGCC GGCTGGGCCCTCTTCCCCAATCACCAGCCTGCAGG
61
162
62
610
63
307
62
1035
62 62 62 55
504 615 690 ~7000
55
~7000
Amplicon (bp)
L. Wu et al. / Parkinsonism and Related Disorders 20 (2014) 1399e1404
1401
Fig. 1. Mutant PRRT2 mRNAs carrying premature termination codons triggered NMD. Direct sequencing of PRRT2 cDNA from the EBV-transformed cell lines showed lower expression of the c.487C > T (p.Q163X) mutant allele, c.573dupT (p.G192WfsX8) mutant allele and c.649dupC (p.R217fsPX8) mutant allele (upper); while treated with CHX, the mutant allele showed increased (lower).
and autophagy lysosome system. We used MG132 and 3-MA -the selective inhibitors of the proteasome and autophagy after overexpressing exogenous Flag-PRRT2 plasmids in SH-SY5Y cells. The results showed that there was no significant change between the Flag-PRRT2 protein levels, the inhibited groups and the control group (Supplement Fig. 3). In summary, PRRT2 mutant protein levels decrease at the mRNA level, irrespective of the degradation pathway. To confirm whether truncated PRRT2 mRNA is degraded through NMD, we suppressed the NMD pathway by using UPF1 siRNA to silence the key member of NMD [24]. Realtime PCR and Western blot showed that UPF1 expression level was suppressed by 80% using 120 nM siRNAs (Supplement Fig. 4A,B,C). As expected, when UPF1 downregulated, decreased mRNA and truncated protein levels of PRRT2 were rescued to a certain extent (Fig. 3A,B,C,D). The mRNA levels were elevated more, especially Flag-PRRT2-R217PfsX8 mutation showed statistical significance. As shown in Fig. 1, treating the cells with CHX and Emetine can up-regulate the mRNA level in lymphoblasts. We tested whether treatment of SH-SY5Y cells transfected with different PRRT2 mutagenesis plasmids with CHX and Emetine also up-regulates the mRNA and protein levels. The level of PRRT2 mRNA and protein in CHX and Emetine treated cells were increased compared with controls (Supplement Fig. 5). To examine the subcellular localization of wild type and truncated PRRT2 protein, we transfected the SH-SY5Y cells with either wild type or mutant plasmid of PRRT2. Wild type PRRT2 protein localization was mainly in the cell membrane. In contrast, the mutant PRRT2 proteins changed membrane localization into cytoplasm and nuclear (Fig. 4), indicating that PRRT2 truncated protein altered their subcellular localization.
4. Discussion PRRT2, responsible for PKD, encodes a 340-amino-acid protein containing two transmembrane domains (amino acids 268e290 and 315e337) [11,14]. To date, more than 50 PRRT2 mutations, of which the majority are nonsense (Supplement Fig. 6), were identified in patients with PRRT2-Related Disorder (PRD). In addition, the commonest hot-spot mutation c.649dupC were also detected in the patients with PKD [4e6]. Previous research speculated that nonsense-mediated RNA decay (NMD) pathway might be involved in the pathogenesis due to the near absence of truncated protein. NMD is an important mRNA surveillance system, which typically degrades transcripts containing PTCs to prevent the translation of unnecessary or aberrant transcripts. It is estimated that approximately one-third of all inherited disorders are caused by PTC-containing mRNAs [29]. And researches regarding PTC-related diseases showed that NMD represented a crucial modulator of the clinical phenotype [25,29]. In most cases, NMD can be beneficial owing to the elimination of transcripts encoding N-terminally truncated, dominant-negative proteins, which leads to toxic effects. This beneficial effect of NMD is well exemplified by b-thalassemia, in which carriers with heterozygous mutation are asymptomatic [25,29]. However, NMD could also aggravate disease phenotypes due to haploinsufficiency as the result of truncated proteins' degeneration [25,29]. Furthermore, the mammalian NMD surveillance system cannot distinguish PTCs in the penultimate exon that are located less than 55 base pairs (bp) from the final intron, and PTCs which are located very early in the open reading frame can also effectively evade NMD [25,29]. Previous research has revealed that PRRT2 truncated mutation results in altered protein subcellular localization [11]. However, Lee
Fig. 2. Detection of mutant PRRT2 protein expression in vitro western blot showed PRRT2 protein level was decreased in all mutant PRRT2 variants compared with that of wild type PRRT2 (A). The data were statistical analyzed quantitative data of Western blot and the value of wild type PRRT2 was set as 1.00 (B). X-axis represents SH-SY5Y cells were transfected with Flag-PRRT2-WT/Q163X/G182WfsX8/R217PfsX8 plasmids respectively; Y-axis represents the level of PRRT2 proteins. Bar plot indicated the statistical analysis for three mutant PRRT2 variant and wild type PRRT2 (Mean ± SD: 1.00 ± 0.013 for normal control; 0.192 ± 0.025 for Q163X; 0.316 ± 0.010 for G182WfsX8; 0.108 ± 0.011 for R217PfsX8) of three independent experiments. (*p < 0.05, student's t test comparing mutant PRRT2 plasmids with wild type PRRT2 plasmid).
1402
L. Wu et al. / Parkinsonism and Related Disorders 20 (2014) 1399e1404
Fig. 3. Effective inhibition of UPF1 resulted in increased mRNA and protein levels of Flag-PRRT2 harboring the mutations. There was increased mRNA and protein levels of PRRT2 between UPF1 silencing and the control, especially Significant difference was observed in PRRT2 harboring the p.R217fsPX8 mutation, assayed by Qpcr (A,B). X-axis represents FlagPRRT2-WT/Q163X/G182WfsX8/R217PfsX8 plasmids transfected SH-SY5Y cells treated with scramb siRNA and UPF1-siRNA respectively (B, D); Y-axis represents the level of PRRT2 mRNA (B) and proteins (D). Bar plot indicated the statistical analysis of PRRT2 mRNA level (B) (Mean ± SD: 1.00 ± 0.000 for Scramb-WT; 0.496 ± 0.1711 for Scramb-Q163X; 0.366 ± 0.060 for Scramb-G192WfsX8; 0.275 ± 0.083 for Scramb-R217PfsX8; 0.861 ± 0.112 for UPF1-WT; 0.677 ± 0.169 for UPF1-Q163X; 0.659 ± 0.092 for UPF1-G192WfsX8; 0.615 ± 0.089 for UPF1-R217PfsX8) and protein level (D) (Mean ± SD: 1.00 ± 0.000 for Scramb-WT; 0.02 ± 0.034 for Scramb-Q163X; 0.098 ± 0.059 for Scramb-G192WfsX8; 0.039 ± 0.025 for Scramb-R217PfsX8; 1.073 ± 0.362 for UPF1-WT; 0.124 ± 0.132 for UPF1-Q163X; 0.203 ± 0.074 for UPF1-G192WfsX8; 0.100 ± 0.075 for UPF1-R217PfsX8) of three independent experiments. (*p < 0.05, one way ANOVA comparing scramb siRNA with UPF1 siRNA group).
al showed that PRRT2 mutations lead to almost a complete absence of mutant protein in vitro [30]. We explored the two seemingly contradictory studies, and found that there was no contradiction between the two studies. Chen et al. used truncated plasmids while Lee et al. used site-directed mutagenesis of a full-length plasmid [11,30]. Both results were correct. The latter was closer to the lesion pattern of the disease, so we used the site-directed mutagenesis method to research the pathogenesis of PKD. On the basis of previous genetic studies [12,14], we further investigated the impact of the nonsense mutations on the mRNA expression and stability. In our study, we demonstrate the low expression of the PRRT2 truncated allele compared to wild-type allele at RNA level. Moreover, the low expression of truncated PRRT2 could be rescued when the cells are treated with cycloheximide and emetine dihydrocholride hydrate, both of which are inhibitors of NMD [27,28]. This observation reveals the involvement of NMD in the pathogenesis of PKD. The escape from NMD leads to the production of truncated protein and carriers with these NMD-insensitive mutations are clinically affected. These disorders, including b-thalassemia, congenital myotonia, are inherited in an unusual dominant fashion [25,29]. As NMD has such a Janus-face regarding disease manifestation, its role in the pathogenesis of PKD remains uncertain. Owing to the dominantly -inherited fashion in familial PKD and the low expression of truncated protein identified in the present study, we speculate that haploinsufficiency, due to NMD, might contribute to
the underlying mechanism of PKD. Moreover, the present study showed that a small portion of the nonsense PRRT2 mRNA escaped from NMD and was translated into the N-terminally truncated protein, which lost its membrane localization. In a close examination of the earlier report, we found that truncated plasmids were used, which resulted in the loss of the C-terminal department from the PRRT2 mutant site. So the special plasmids translated into proteins only have domain of N-segments, similar to our N-terminally truncated proteins. So, this finding is parallel to the previous research in which the observation of NMD was absent [11]. Our data support the haploinsufficiency model for PKD pathogenesis expaling why the mutant allele was decreased in PKD patients. Moreover, RT-PCR revealed a clear reduction in PRRT2 mRNA in each of the 3 PKD patients which was confirmed by semiquantitative analysis (Supplement Fig. 1): 60%; 56%; 63% reduction for the 3 PKD patients, suggesting haploinsufficiency to be the pathogenesis of PKD. Furthermore the responses of truncated plasmids and mutagenesis plasmids to the treatment of cells with CHX/Emetine were different. There was no change in the PRRT2 mRNA and protein levels when the cells were treated with CHX/ Emetine in truncated plasmids. The results for RT-PCR indicated that the mRNA levels of PRRT2 were upregulated in GFP-PRRT2 truncated plasmid (both wild type and mutant plasmids) transfected cells compared to the levels in negative and GFP-Vector transfected cells (Supplement Fig. 2A,B). There was no significant
L. Wu et al. / Parkinsonism and Related Disorders 20 (2014) 1399e1404
1403
Fig. 4. Detection of mutant PRRT2 protein location in vitro Confocal microscopy showed that wild type PRRT2 co-localized mainly in the membrane of the SH-SY5Y cells (top panel); while the mutant PRRT2 co-localized mainly in the cytoplasm of the cells (bottom panel) Flag-PRRT2-green; nucleus-DAPI-blue; n ¼ 3. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)
difference in the level of PRRT2 mRNA between the DMSO control group and the CHX treated group. Similar results were obtained using western blot detection. There was no significant difference between the PRRT2 protein level and the DMSO control group and the CHX treated group also (Supplement Fig. 2C,D). Thus the overriding negative effects may be due to haploinsufficiency or loss of function. Although the function of PRRT2 remains unclear, yeast twohybrid studies suggest that PRRT2 interacts with synaptosomalassociated protein 25kd (SNAP25), a presynaptic membrane protein involved in the synaptic vesicle membrane docking and fusion pathway [30]. It plays an important role in the calcium-triggered neuronal exocytosis [30]. Owing to the connection between PRRT2 and SNAP25, we presume that the alteration in PRRT2 expression, as well as the change in cellular localization identified in the present study, may result in synaptic dysfunction and thus lead to PKD. This hypothesis is consistent with the previous speculation from clinical findings that the underlying pathogenesis of PKD might be related to ion channel or transmitter release in the basal ganglia for its brief, stereotyped nature and the dramatic response to anticonvulsants but no loss of consciousness but an abnormal EEG during an attack [2]. However, how SNAP25 is involved in neuronal exocytosis needs further study. In conclusion, nonsense mutations of PRRT2 lead to a quantitative deficiency at the level of mRNA through nonsense-mediated mRNA decay, which may play an important role in the pathogenesis of PKD or PRD. Moreover, a small portion of undegraded truncated protein changed its cellular localization, which might result in the
loss of some of the physiological functions of PRRT2. The physiological function of PRRT2 protein is as yet unclear because of the immaturity of endogenous antibodies. We tested all the commercial PRRT2 antibodies, none worked. Further studies might contribute to an understanding of the function of the PRRT2 protein in order to verify whether the truncated mutant protein is due to the loss of physiological function. The alteration of PRRT2 expression might interfere with SNAP25 whose function is synaptic exocytosis, and thus leads to PKD or even PRD. Acknowledgments This study was supported by grants from National Key Program of Basic Research (2011CB504104) of China, Shanghai Municipal Natural Science Foundation (12ZR1418500), The National Natural Science Foundation of China (81271262). Appendix A. Supplementary data Supplementary data related to this article can be found at http:// dx.doi.org/10.1016/j.parkreldis.2014.10.012. References [1] Bruno MK, Hallett M, Gwinn-Hardy K, Sorensen B, Considine E, Tucker S, et al. Clinical evaluation of idiopathic paroxysmal kinesigenic dyskinesia: new diagnostic criteria. Neurology 2004;63:2280e7. [2] Bhatia KP. Paroxysmal dyskinesias. Mov Disord 2011;26:1157e65.
1404
L. Wu et al. / Parkinsonism and Related Disorders 20 (2014) 1399e1404
[3] Szepetowski P, Rochette J, Berquin P, Piussan C, Lathrop GM, Monaco AP. Familial infantile convulsions and paroxysmal choreoathetosis: a new neurological syndrome linked to the pericentromeric region of human chromosome 16. Am J Hum Genet 1997;61:889e98. [4] Becker F, Schubert J, Striano P, Anttonen AK, Liukkonen E, Gaily E, et al. PRRT2related disorders: further PKD and ICCA cases and review of the literature. J Neurol 2013;260:1234e44. [5] Heron SE, Dibbens LM. Role of PRRT2 in common paroxysmal neurological disorders: a gene with remarkable pleiotropy. J Med Genet 2013;3:133e9. [6] Meneret A, Gaudebout C, Riant F, Vidailhet M, Deplenne C, Roze E. PRRT2 mutations and paroxysmal disorders. Eur J Neurol 2013;20:872e8. [7] Liu Q, Qi Z, Wan XH, Li JY, Shi L, Lu Q, et al. Mutations in PRRT2 result in paroxysmal dyskinesias with marked variability in clinical expression. J Med Genet 2012;49:79e82. [8] Hedera P, Xiao J, Puschmann A, Mom 269 Ilovi D, Wu SW, Ledoux MS. Novel PRRT2 mutation in an African-American family with paroxysmal kinesigenic dyskinesia. BMC Neurol 2012;12:93. [9] Fabbri M, Marini C, Bisulli F, Di Vito L, Elia A, Guerrini R, et al. Clinical and polygraphic study of familial paroxysmal kinesigenic dyskinesia with PRRT2 mutation. Epileptic Disord 2013;15:123e7. [10] Steinlein OK, Villain M, Korenke C. The PRRT2 mutation c.649dupC is the so far most frequent cause of benign familial infantile convulsions. Seizure: J Br Epilepsy Assoc 2012;21:740e2. [11] Chen W-J, Lin Y, Xiong Z-Q, Wei W, Ni W, Tan G-H, et al. Exome sequencing identifies truncating mutations in PRRT2 that cause paroxysmal kinesigenic dyskinesia. Nat Genet 2011;43:1252e5. [12] Cao L, Huang XJ, Zheng L, Xiao Q, Wang XJ, Chen SD. Identification of a novel PRRT2 mutation in patients with paroxysmal kinesigenic dyskinesias and c.649dupC as a mutation hot-spot. Parkinsonism Relat Disord 2012;18:704e6. [13] Li J, Zhu X, Wang X, Sun W, Feng B, Du T, et al. Targeted genomic sequencing identifies PRRT2 mutations as a cause of paroxysmal kinesigenic choreoathetosis. J Med Genet 2012;49:76e8. [14] Wang JL, Cao L, Li XH, Hu ZM, Li JD, Zhang JG, et al. Identification of PRRT2 as the causative gene of paroxysmal kinesigenic dyskinesias. Brain 2011;134: 3493e501. [15] Ono S, Yoshiura K, Kinoshita A, Kikuchi T, Nakane Y, Kato N, et al. Mutations in PRRT2 responsible for paroxysmal kinesigenic dyskinesias also cause benign familial infantile convulsions. J Hum Genet 2012;57:338e41. [16] Meneret A, Grabli D, Depienne C, Gaudebout C, Picard F, Durr A, et al. PRRT2 mutations: a major cause of paroxysmal kinesigenic dyskinesia in the European population. Neurology 2012;79:170e4.
[17] Specchio N, Terracciano A, Trivisano M, Cappelletti S, Claps D, Travaglini L, et al. PRRT2 is mutated in familial and non-familial benign infantile seizures. Eur J Paediatr Neurol 2012;17:77e81. [18] Dale RC, Gardiner A, Antony J, Houlden H. Familial PRRT2 mutation with heterogeneous paroxysmal disorders including paroxysmal torticollis and hemiplegic migraine. Dev Med Child Neurol 2012;54:958e60. [19] Yang X, Zhang Y, Xu X, Wang S, Yang Z, Wu Y, et al. Phenotypes and PRRT2 mutations in Chinese families with benign familial infantile epilepsy and infantile convulsions with paroxysmal choreoathetosis. BMC Neurol 2013;13:209. [20] Wang JL, Mao X, Hu ZM, Li JD, Li N, Guo JF, et al. Mutation analysis of PRRT2 in two Chinese BFIS families and nomenclature of PRRT2 related paroxysmal diseases. Neurosci Lett 2013;552:40e5. [21] Torisu H, Watanabe K, Shimojima K, Sugawara M, Sanefuji M, Ishizaki YM, et al. Girl with a PRRT2 mutation and infantile focal epilepsy with bilateral spikes. Brain Dev 2013;36:342e5. [22] Tan LC, Methawasin K, Teng EW, Ng AR, Seah SH, Au WL, et al. Clinico-genetic comparisons of paroxysmal kinesigenic dyskinesia patients with and without PRRT2 mutations. Eur J Neurol 2013;21:674e8. [23] Labate A, Tarantino P, Palamara G, Gagliardi M, Cavalcanti F, Ferlazzo E, et al. Mutations in PRRT2 result in familial infantile seizures with heterogeneous phenotypes including febrile convulsions and probable SUDEP. Epilepsy Res 2013;104:280e4. [24] Castiglioni C, Lopez L, Riant F, Bertini E, Terracciano A. PRRT2 mutation causes paroxysmal kinesigenic dyskinesia and hemiplegic migraine in monozygotic twins. Eur J Paediatr Neurol 2013;17:254e8. [25] Holbrook JA, Neu-Yilik G, Hentze MW, Kulozik AE. Nonsense-mediated decay approaches the clinic. Nat Genet 2004;36:801e8. [26] Ling PD, Huls HM. Isolation and immortalization of lymphocytes. Curr Protoc Mol Biol 2005;70. 28.2:28.2.1e28.2.5. [27] O'Roak BJ, Deriziotis P, Lee C, Vives L, Schwartz JJ, Girirajan S, et al. Exome sequencing in sporadic autism spectrum disorders identifies severe de novo mutations. Nat Genet 2011;43:585e9. [28] Levit A, Nutman D, Osher E, Kamhi E, Navon R. Two novel exonic point mutations in HEXA identified in a juvenile Tay-Sachs patient: role of alternative splicing and nonsense-mediated mRNA decay. Mol Genet Metab 2010;100: 176e83. [29] Khajavi M, Inoue K, Lupski JR. Nonsense-mediated mRNA decay modulates clinical outcome of genetic disease. Eur J Hum Genet 2006;10:1074e81. [30] Lee HY, Huang Y, Bruneau N, Roll P, Roberson ED, Hermann M, et al. Mutations in the gene PRRT2 cause paroxysmal kinesigenic dyskinesia with infantile convulsions. Cell Rep 2012;1:2e12.
Contents lists available at ScienceDirect
Parkinsonism and Related Disorders journal homepage: www.elsevier.com/locate/parkreldis
PRRT2 truncated mutations lead to nonsense-mediated mRNA decay in Paroxysmal Kinesigenic Dyskinesia Li Wu 1, Hui-Dong Tang 1, Xiao-Jun Huang, Lan Zheng, Xiao-Li Liu, Tian Wang, Jing-Yi Wang, Li Cao*, Sheng-Di Chen* Department of Neurology and Institute of Neurology, Rui Jin Hospital, School of Medicine, Shanghai Jiao Tong University, Shanghai 200025, China
a r t i c l e i n f o
a b s t r a c t
Article history: Received 22 June 2014 Received in revised form 8 October 2014 Accepted 12 October 2014
Background and purpose: Paroxysmal Kinesigenic Dyskinesia (PKD) is an episodic involuntary movement disorder characterized by recurrent and brief involuntary movements. Proline-rich transmembrane protein 2 (PRRT2) has been identified as the causative gene for PKD, Benign familial infantile convulsions (BFIC) and Infantile convulsions with choreoathetosis (ICCA). As well, PRRT2 mutations have been detected in patients with PED or PNKD. To date, most of the mutations have been found to be nonsense. Method: We used inhibitors of nonsense-mediated mRNA decay (NMD) pathway –emetine dihydrochloride hydrate and cycloheximide and silencing regulator of nonsense transcripts 1(UPF1) with immortalized lymphoblasts to detect whether the truncated mutations lead to NMD, a type of mRNA surveillance in every eukaryotic cell proved so far and that generally degrades mRNA containing premature translation termination codons (PTCs). In addition, we transfected the SH-SY5Y cells with wildtype and mutant PRRT2 plasmids to identify the PRRT2 protein's subcellular localization. Results: We detected, low expression of truncated PRRT2 and was further rescued by applying the inhibitor of NMD pathway, suggesting that NMD plays an important role in the pathogenesis of PKD by haplo-insufficiency. Moreover, for the small portion of undegraded mutant PRRT2 that was translated into truncated proteins, their cellular localization changed from membrane to cytoplasm and nuclear, which might lead to a functional loss. Conclusion: We suggest that the NMD of truncated mutation of PRRT2 and altered cellular localization of undegraded of PRRT2, might lead to PKD. © 2014 Elsevier Ltd. All rights reserved.
Keywords: Paroxysmal Kinesigenic Dyskinesia (PKD) Proline-rich transmembrane protein 2 (PRRT2) Nonsense-mediated mRNA decay (NMD) Regulator of nonsense transcripts 1(UPF1)
1. Introduction Paroxysmal Kinesigenic Dyskinesias (PKD) is an episodic involuntary movement disorder characterized by recurrent and brief attacks induced by sudden voluntary movement [1]. The attacks, which last from seconds to 1 min, usually comprise dystonia, chorea, athetosis, ballism, or a combination of all or any [2]. Other intermittent neurological disorders, such as infantile convulsions (IC) or infantile convulsions with choreoathetosis (ICCA) have also been reported amongst some PKD patients [3]. Proline-rich transmembrane protein 2 (PRRT2) has been identified as a causative gene for PKD, ICCA and benign familial infantile convulsions (BFIC)
* Corresponding authors. E-mail addresses: [email protected] (L. Cao), [email protected] (S.-D. Chen). 1 Authors contributed equally to this work. http://dx.doi.org/10.1016/j.parkreldis.2014.10.012 1353-8020/© 2014 Elsevier Ltd. All rights reserved.
[4e6], and more recently, patients with paroxysmal exertioninduced dyskinesias (PED) or paroxysmal non-kinesigenic dyskinesia (PNKD) were found to harbor PRRT2 mutations [7,8]. All these findings widen the spectrum of phenotypes caused by PRRT2 mutations, which may be referred to as PRRT2-related diseases (PRD). To date, more than 50 different PRRT2 mutations have been documented [4e6]. Nonsense mutations which harbor premature termination codons (PTCs) are the most common types, and c.649dupC (p.R217PfsX8) is a hot-spot [8e24]. We summarized all the truncated mutations of PRRT2 and found that they locate more than 50 ~ 55 bp upstream of the last exoneexon junction, in line with the known mechanism of NMD. We presumed that most of those nonsense mutated PRRT2 transcripts were not translated into protein by selectively triggering the nonsense-mediated mRNA decay (NMD) pathway, a transcriptional regulatory mechanism that efficiently degrades mRNA with PTCs to diminish the production of potentially deleterious truncated proteins [25].
1400
L. Wu et al. / Parkinsonism and Related Disorders 20 (2014) 1399e1404
2. Materials and methods 2.1. Subjects We used immortalized B lymphoblastoid cell lines cultured from the blood of participants, according to the standard protocol [26]. A total of 4 subjects were recruited into this study: one healthy control and three PKD patients. The patients with PRRT2 mutations (p.Q163X, p.G192WfsX8, p.R217PfsX8) have been reported in our previous studies [12,14]. All the participants including normal controls signed informed consent, and the study was approved by Ruijin Hospital Ethics Committee.
using lipofectamine 2000 (Invitrogen). During the immunobloting process, mouse anti-Flag antibody (1:1000, sigma) and goat anti-mouse HRP conjugated antibody (1:10,000, Invitrogen) were used to detect Flag-PRRT2 fusion proteins expression in SH-SYSY cells. During the immunofluorescence process, mouse anti-Flag antibody (1:100, sigma) and goat anti-mouse- FIT 488 conjugated antibody (1:800, Invitrogen) were used to detect the localization of Flag-PRRT2 fusion protein in SH-SY5Y cells. All the experiments were conducted at least three times and then analyzed with confocal microscopy (Leica SP5).
3. Results
2.2. Cell culture and treatment with siRNAs SH-SYSY cells were purchased from ATCC and cultured in DMEM supplemented with 10% FBS and 100 U/ml penicillin/streptomycin (Invitrogen) at 37 C with 5% CO2. UPF1 siRNA 1879e1901 (50 -AAGATGCAGTTCCGCTCCATTTT-30 ); 1020e1038(50 GATGCAGTTCCGCTCCATT-30 ) were synthesized by GenePharma. UPF1 siRNA was used to transfect SH-SY5Y by lipofectamine 2000 (Invitrogen) serum-free media for 4 h at 60 nMol and 120 nMol. Western blot and qPCR were used to confirm the knockdown efficiency of UPF1 siRNAs. 2.3. NMD analysis The NMD analysis was performed according to a modified protocol [27,28]. Immortalized lymphoblasts were treated with emetine dihydrochloride hydrate (100 ug/ml, 6 h; Merck) or cycloheximide (25 ug/ml, 4 h; Beyotime). Then total RNA was extracted from immortalized B lymphoblastoid cell lines using a standard method with TRIZOL Reagent (Invitrogen), and reverse-transcribed using the PrimeScript® RT reagent Kit (Takara) according to the manufacture's instruction. The primers for amplification of mutation-containing fragments are summarized in Table 1. To determine whether the truncated mutation of PRRT2 degrades in NMD pathway, we designed primers to verify PRRT2 gene. Forward: CTGCTCCCCAACCAGACC; Reverse: CACTTATACACGCCTAAGTTG for detecting the level of the mutant allele; Forward: CTTATGCTGTCATGTCCCGGAACAG; Reverse: CCCCTCACTTATACACGCCTAAG for detecting the quantity of the PRRT2 mRNA. The purified PCR products were sequenced on an ABI 3730 XL sequencer (Applied Biosystems and Life Technologies, USA).
2.4. Generation of truncated plasmids and mutagenesis plasmids The truncated plasmids: human PRRT2 sequence was amplified by RT-PCR from a cDNA library of SH-SY5Y cells. PCR products encoding full-length (amino acid 1e340) or truncated (amino acid 1e163; 1e200; 1e225) human PRRT2 were cloned into pEGFP-N1 at EcoRI and BamHI sites and were verified by sequencing. Mutagenesis plasmids: PRRT2-WT (wild type) and PRRT2-R217PfsX8 mutant plasmids in p3XFLAG-CMV-10-expression vector were provided by Professor Fu (Department of Neurology, UCSF, San Francisco, CA 94158, USA). The PRRT2-Q163X and PRRT2G192WfsX8 mutation plasmids were generated using the Site-directed Gene Mutagenesis Kit (Beyotime). The primers for truncated plasmids and mutagenesis plasmids are summarized in Table 1. 2.5. Western blotting and immunofluorescence microscopy SH-SY5Y cells were transfected with PRRT2 plasmids (p3XFLAG-CMV-10PRRT2-WT/R217PfsX8/Q163X/G192WfsX8 fusion construct and empty plasmid)
Direct sequencing of mutant PRRT2 cDNA from the EBVtransformed lymphoblasts revealed a low expression of the PRRT2 mutant allele (Fig. 1, upper panel). After the lymphoblasts were treated with cycloheximide or emetine dihydrochloride hydrate (the inhibitor of NMD), we found that the expression level of the mutant allele was elevated almost equally to the wild-type alleles by direct sequencing of the corresponding cDNA (Fig. 1, lower panel), suggesting that most of the mutated transcript was degraded through nonsense-mediated mRNA Decay. We tried to measure the PRRT2 mRNA level of EBV-transformed lymphoblasts. The results showed that the PRRT2 mRNA level was decreased in all 3 PKD patients (Supplement Fig. 1). To investigate whether the insufficient expression of mutant PRRTS is due to mRNA degradation via NMD, we transfected SHSY5Y cells with PRRT2 plasmids (p3XFLAG-CMV-10-PRRT2-WT/ Q163X/G192WfsX8/R217PfsX8). In western bloting, protein extracts from Flag-PRRT2-WT cells showed a strong signal at ~65 kDa (Fig. 2A, left side, lane2) while a relatively weaker signal could be detected from the Flag-PRRT2-Mutant cells. (Fig. 2A, left side, lane 3,4,5). When we cotransfected SH-SY5Y cells with PRRT2-WT and 3 PRRT2-mutant plasmids, the expression of truncated mutant (Q163X, G192WfsX8 and R217PfsX8) proteins were significantly lower when compared to that of the wild-type PRRT2 protein (Fig. 2A, right side). The expression of mutant PRRT2 protein decreased to about 20% of wild-type PRRT2 (Fig. 2B). This suggests that the majority of the mutated transcripts were degraded and a few residual mutated transcripts were predicted to yield a Nterminally truncated protein. We also tried to conduct testing by using truncated plasmids as comparisons to mutagenesis plasmids. We prepared three truncated plasmids using GFP-fusion plasmids. There was a difference between the expression of truncated plasmids and the mutagenesis plasmids. As shown in Supplement Fig. 2, there was no decrease in the PRRT2 protein level in truncated plasmids (Supplement Fig. 2C) as compared to wild type plasmid. We also examined PRRT2 protein degradation with the rescue of proteasome inhibitors. The degradation of intracellular proteins consists of two resources: ubiquitin-proteasome system
Table 1 Primers for the reverse transcription (RT)-PCR and PRRT2 mutagenesis assays. Primer
Sequence (50 > 30 )
Tm ( C)
PRRT2-RT-F PRRT2-RT-R PRRT2-RT-iso1-F PRRT2-RT-iso1-R GAPDH-RT-F GAPDH-RT-R PRRT2-N1-GFP-F PRRT2-N1-GFP-R PRRT2-Q163-N1-GFP-R PRRT2-G192WfsX8 -N1-GFP-R PRRT2-R217PfsX8-N1-GFP-R PRRT2-Q163X mutation-F PRRT2-Q163X mutation-R PRRT2-G192WfsX8 mutation-F PRRT2-G192WfsX8 mutation-R
CTTATGCTGTCATGTCCCGGAACAG CCCCTCACTTATACACGCCTAAG CTGCTCCCCAACCAGACC CACTTATACACGCCTAAGTTG CGGAGTCAACGGATTTGGTCGTAT AGCCTTCTCCATGGTGGTGAAGAC GGAATTCGCCACCATGGCAGCCAGCAGCTCTG CGGGATCCCACTTATACACGCCTAAGTTG CGGGATCCTGGGTAGGGAGCTCTGGTTG CGGGATCCCCATCACCAGCCTGCAGGGGCAC GGAATTCTCAACCAGCTGCTGCAGCACTCGGGGGGGGGGCC CCAGAGCTCCCTACCTAGGAGGACCCCACCCC GGGGTGGGGTCCTCCTAGGTAGGGAGCTCTGG CCTGCAGGCTGGTGATTGGGGAAGAGGGCCCAGCC GGCTGGGCCCTCTTCCCCAATCACCAGCCTGCAGG
61
162
62
610
63
307
62
1035
62 62 62 55
504 615 690 ~7000
55
~7000
Amplicon (bp)
L. Wu et al. / Parkinsonism and Related Disorders 20 (2014) 1399e1404
1401
Fig. 1. Mutant PRRT2 mRNAs carrying premature termination codons triggered NMD. Direct sequencing of PRRT2 cDNA from the EBV-transformed cell lines showed lower expression of the c.487C > T (p.Q163X) mutant allele, c.573dupT (p.G192WfsX8) mutant allele and c.649dupC (p.R217fsPX8) mutant allele (upper); while treated with CHX, the mutant allele showed increased (lower).
and autophagy lysosome system. We used MG132 and 3-MA -the selective inhibitors of the proteasome and autophagy after overexpressing exogenous Flag-PRRT2 plasmids in SH-SY5Y cells. The results showed that there was no significant change between the Flag-PRRT2 protein levels, the inhibited groups and the control group (Supplement Fig. 3). In summary, PRRT2 mutant protein levels decrease at the mRNA level, irrespective of the degradation pathway. To confirm whether truncated PRRT2 mRNA is degraded through NMD, we suppressed the NMD pathway by using UPF1 siRNA to silence the key member of NMD [24]. Realtime PCR and Western blot showed that UPF1 expression level was suppressed by 80% using 120 nM siRNAs (Supplement Fig. 4A,B,C). As expected, when UPF1 downregulated, decreased mRNA and truncated protein levels of PRRT2 were rescued to a certain extent (Fig. 3A,B,C,D). The mRNA levels were elevated more, especially Flag-PRRT2-R217PfsX8 mutation showed statistical significance. As shown in Fig. 1, treating the cells with CHX and Emetine can up-regulate the mRNA level in lymphoblasts. We tested whether treatment of SH-SY5Y cells transfected with different PRRT2 mutagenesis plasmids with CHX and Emetine also up-regulates the mRNA and protein levels. The level of PRRT2 mRNA and protein in CHX and Emetine treated cells were increased compared with controls (Supplement Fig. 5). To examine the subcellular localization of wild type and truncated PRRT2 protein, we transfected the SH-SY5Y cells with either wild type or mutant plasmid of PRRT2. Wild type PRRT2 protein localization was mainly in the cell membrane. In contrast, the mutant PRRT2 proteins changed membrane localization into cytoplasm and nuclear (Fig. 4), indicating that PRRT2 truncated protein altered their subcellular localization.
4. Discussion PRRT2, responsible for PKD, encodes a 340-amino-acid protein containing two transmembrane domains (amino acids 268e290 and 315e337) [11,14]. To date, more than 50 PRRT2 mutations, of which the majority are nonsense (Supplement Fig. 6), were identified in patients with PRRT2-Related Disorder (PRD). In addition, the commonest hot-spot mutation c.649dupC were also detected in the patients with PKD [4e6]. Previous research speculated that nonsense-mediated RNA decay (NMD) pathway might be involved in the pathogenesis due to the near absence of truncated protein. NMD is an important mRNA surveillance system, which typically degrades transcripts containing PTCs to prevent the translation of unnecessary or aberrant transcripts. It is estimated that approximately one-third of all inherited disorders are caused by PTC-containing mRNAs [29]. And researches regarding PTC-related diseases showed that NMD represented a crucial modulator of the clinical phenotype [25,29]. In most cases, NMD can be beneficial owing to the elimination of transcripts encoding N-terminally truncated, dominant-negative proteins, which leads to toxic effects. This beneficial effect of NMD is well exemplified by b-thalassemia, in which carriers with heterozygous mutation are asymptomatic [25,29]. However, NMD could also aggravate disease phenotypes due to haploinsufficiency as the result of truncated proteins' degeneration [25,29]. Furthermore, the mammalian NMD surveillance system cannot distinguish PTCs in the penultimate exon that are located less than 55 base pairs (bp) from the final intron, and PTCs which are located very early in the open reading frame can also effectively evade NMD [25,29]. Previous research has revealed that PRRT2 truncated mutation results in altered protein subcellular localization [11]. However, Lee
Fig. 2. Detection of mutant PRRT2 protein expression in vitro western blot showed PRRT2 protein level was decreased in all mutant PRRT2 variants compared with that of wild type PRRT2 (A). The data were statistical analyzed quantitative data of Western blot and the value of wild type PRRT2 was set as 1.00 (B). X-axis represents SH-SY5Y cells were transfected with Flag-PRRT2-WT/Q163X/G182WfsX8/R217PfsX8 plasmids respectively; Y-axis represents the level of PRRT2 proteins. Bar plot indicated the statistical analysis for three mutant PRRT2 variant and wild type PRRT2 (Mean ± SD: 1.00 ± 0.013 for normal control; 0.192 ± 0.025 for Q163X; 0.316 ± 0.010 for G182WfsX8; 0.108 ± 0.011 for R217PfsX8) of three independent experiments. (*p < 0.05, student's t test comparing mutant PRRT2 plasmids with wild type PRRT2 plasmid).
1402
L. Wu et al. / Parkinsonism and Related Disorders 20 (2014) 1399e1404
Fig. 3. Effective inhibition of UPF1 resulted in increased mRNA and protein levels of Flag-PRRT2 harboring the mutations. There was increased mRNA and protein levels of PRRT2 between UPF1 silencing and the control, especially Significant difference was observed in PRRT2 harboring the p.R217fsPX8 mutation, assayed by Qpcr (A,B). X-axis represents FlagPRRT2-WT/Q163X/G182WfsX8/R217PfsX8 plasmids transfected SH-SY5Y cells treated with scramb siRNA and UPF1-siRNA respectively (B, D); Y-axis represents the level of PRRT2 mRNA (B) and proteins (D). Bar plot indicated the statistical analysis of PRRT2 mRNA level (B) (Mean ± SD: 1.00 ± 0.000 for Scramb-WT; 0.496 ± 0.1711 for Scramb-Q163X; 0.366 ± 0.060 for Scramb-G192WfsX8; 0.275 ± 0.083 for Scramb-R217PfsX8; 0.861 ± 0.112 for UPF1-WT; 0.677 ± 0.169 for UPF1-Q163X; 0.659 ± 0.092 for UPF1-G192WfsX8; 0.615 ± 0.089 for UPF1-R217PfsX8) and protein level (D) (Mean ± SD: 1.00 ± 0.000 for Scramb-WT; 0.02 ± 0.034 for Scramb-Q163X; 0.098 ± 0.059 for Scramb-G192WfsX8; 0.039 ± 0.025 for Scramb-R217PfsX8; 1.073 ± 0.362 for UPF1-WT; 0.124 ± 0.132 for UPF1-Q163X; 0.203 ± 0.074 for UPF1-G192WfsX8; 0.100 ± 0.075 for UPF1-R217PfsX8) of three independent experiments. (*p < 0.05, one way ANOVA comparing scramb siRNA with UPF1 siRNA group).
al showed that PRRT2 mutations lead to almost a complete absence of mutant protein in vitro [30]. We explored the two seemingly contradictory studies, and found that there was no contradiction between the two studies. Chen et al. used truncated plasmids while Lee et al. used site-directed mutagenesis of a full-length plasmid [11,30]. Both results were correct. The latter was closer to the lesion pattern of the disease, so we used the site-directed mutagenesis method to research the pathogenesis of PKD. On the basis of previous genetic studies [12,14], we further investigated the impact of the nonsense mutations on the mRNA expression and stability. In our study, we demonstrate the low expression of the PRRT2 truncated allele compared to wild-type allele at RNA level. Moreover, the low expression of truncated PRRT2 could be rescued when the cells are treated with cycloheximide and emetine dihydrocholride hydrate, both of which are inhibitors of NMD [27,28]. This observation reveals the involvement of NMD in the pathogenesis of PKD. The escape from NMD leads to the production of truncated protein and carriers with these NMD-insensitive mutations are clinically affected. These disorders, including b-thalassemia, congenital myotonia, are inherited in an unusual dominant fashion [25,29]. As NMD has such a Janus-face regarding disease manifestation, its role in the pathogenesis of PKD remains uncertain. Owing to the dominantly -inherited fashion in familial PKD and the low expression of truncated protein identified in the present study, we speculate that haploinsufficiency, due to NMD, might contribute to
the underlying mechanism of PKD. Moreover, the present study showed that a small portion of the nonsense PRRT2 mRNA escaped from NMD and was translated into the N-terminally truncated protein, which lost its membrane localization. In a close examination of the earlier report, we found that truncated plasmids were used, which resulted in the loss of the C-terminal department from the PRRT2 mutant site. So the special plasmids translated into proteins only have domain of N-segments, similar to our N-terminally truncated proteins. So, this finding is parallel to the previous research in which the observation of NMD was absent [11]. Our data support the haploinsufficiency model for PKD pathogenesis expaling why the mutant allele was decreased in PKD patients. Moreover, RT-PCR revealed a clear reduction in PRRT2 mRNA in each of the 3 PKD patients which was confirmed by semiquantitative analysis (Supplement Fig. 1): 60%; 56%; 63% reduction for the 3 PKD patients, suggesting haploinsufficiency to be the pathogenesis of PKD. Furthermore the responses of truncated plasmids and mutagenesis plasmids to the treatment of cells with CHX/Emetine were different. There was no change in the PRRT2 mRNA and protein levels when the cells were treated with CHX/ Emetine in truncated plasmids. The results for RT-PCR indicated that the mRNA levels of PRRT2 were upregulated in GFP-PRRT2 truncated plasmid (both wild type and mutant plasmids) transfected cells compared to the levels in negative and GFP-Vector transfected cells (Supplement Fig. 2A,B). There was no significant
L. Wu et al. / Parkinsonism and Related Disorders 20 (2014) 1399e1404
1403
Fig. 4. Detection of mutant PRRT2 protein location in vitro Confocal microscopy showed that wild type PRRT2 co-localized mainly in the membrane of the SH-SY5Y cells (top panel); while the mutant PRRT2 co-localized mainly in the cytoplasm of the cells (bottom panel) Flag-PRRT2-green; nucleus-DAPI-blue; n ¼ 3. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)
difference in the level of PRRT2 mRNA between the DMSO control group and the CHX treated group. Similar results were obtained using western blot detection. There was no significant difference between the PRRT2 protein level and the DMSO control group and the CHX treated group also (Supplement Fig. 2C,D). Thus the overriding negative effects may be due to haploinsufficiency or loss of function. Although the function of PRRT2 remains unclear, yeast twohybrid studies suggest that PRRT2 interacts with synaptosomalassociated protein 25kd (SNAP25), a presynaptic membrane protein involved in the synaptic vesicle membrane docking and fusion pathway [30]. It plays an important role in the calcium-triggered neuronal exocytosis [30]. Owing to the connection between PRRT2 and SNAP25, we presume that the alteration in PRRT2 expression, as well as the change in cellular localization identified in the present study, may result in synaptic dysfunction and thus lead to PKD. This hypothesis is consistent with the previous speculation from clinical findings that the underlying pathogenesis of PKD might be related to ion channel or transmitter release in the basal ganglia for its brief, stereotyped nature and the dramatic response to anticonvulsants but no loss of consciousness but an abnormal EEG during an attack [2]. However, how SNAP25 is involved in neuronal exocytosis needs further study. In conclusion, nonsense mutations of PRRT2 lead to a quantitative deficiency at the level of mRNA through nonsense-mediated mRNA decay, which may play an important role in the pathogenesis of PKD or PRD. Moreover, a small portion of undegraded truncated protein changed its cellular localization, which might result in the
loss of some of the physiological functions of PRRT2. The physiological function of PRRT2 protein is as yet unclear because of the immaturity of endogenous antibodies. We tested all the commercial PRRT2 antibodies, none worked. Further studies might contribute to an understanding of the function of the PRRT2 protein in order to verify whether the truncated mutant protein is due to the loss of physiological function. The alteration of PRRT2 expression might interfere with SNAP25 whose function is synaptic exocytosis, and thus leads to PKD or even PRD. Acknowledgments This study was supported by grants from National Key Program of Basic Research (2011CB504104) of China, Shanghai Municipal Natural Science Foundation (12ZR1418500), The National Natural Science Foundation of China (81271262). Appendix A. Supplementary data Supplementary data related to this article can be found at http:// dx.doi.org/10.1016/j.parkreldis.2014.10.012. References [1] Bruno MK, Hallett M, Gwinn-Hardy K, Sorensen B, Considine E, Tucker S, et al. Clinical evaluation of idiopathic paroxysmal kinesigenic dyskinesia: new diagnostic criteria. Neurology 2004;63:2280e7. [2] Bhatia KP. Paroxysmal dyskinesias. Mov Disord 2011;26:1157e65.
1404
L. Wu et al. / Parkinsonism and Related Disorders 20 (2014) 1399e1404
[3] Szepetowski P, Rochette J, Berquin P, Piussan C, Lathrop GM, Monaco AP. Familial infantile convulsions and paroxysmal choreoathetosis: a new neurological syndrome linked to the pericentromeric region of human chromosome 16. Am J Hum Genet 1997;61:889e98. [4] Becker F, Schubert J, Striano P, Anttonen AK, Liukkonen E, Gaily E, et al. PRRT2related disorders: further PKD and ICCA cases and review of the literature. J Neurol 2013;260:1234e44. [5] Heron SE, Dibbens LM. Role of PRRT2 in common paroxysmal neurological disorders: a gene with remarkable pleiotropy. J Med Genet 2013;3:133e9. [6] Meneret A, Gaudebout C, Riant F, Vidailhet M, Deplenne C, Roze E. PRRT2 mutations and paroxysmal disorders. Eur J Neurol 2013;20:872e8. [7] Liu Q, Qi Z, Wan XH, Li JY, Shi L, Lu Q, et al. Mutations in PRRT2 result in paroxysmal dyskinesias with marked variability in clinical expression. J Med Genet 2012;49:79e82. [8] Hedera P, Xiao J, Puschmann A, Mom 269 Ilovi D, Wu SW, Ledoux MS. Novel PRRT2 mutation in an African-American family with paroxysmal kinesigenic dyskinesia. BMC Neurol 2012;12:93. [9] Fabbri M, Marini C, Bisulli F, Di Vito L, Elia A, Guerrini R, et al. Clinical and polygraphic study of familial paroxysmal kinesigenic dyskinesia with PRRT2 mutation. Epileptic Disord 2013;15:123e7. [10] Steinlein OK, Villain M, Korenke C. The PRRT2 mutation c.649dupC is the so far most frequent cause of benign familial infantile convulsions. Seizure: J Br Epilepsy Assoc 2012;21:740e2. [11] Chen W-J, Lin Y, Xiong Z-Q, Wei W, Ni W, Tan G-H, et al. Exome sequencing identifies truncating mutations in PRRT2 that cause paroxysmal kinesigenic dyskinesia. Nat Genet 2011;43:1252e5. [12] Cao L, Huang XJ, Zheng L, Xiao Q, Wang XJ, Chen SD. Identification of a novel PRRT2 mutation in patients with paroxysmal kinesigenic dyskinesias and c.649dupC as a mutation hot-spot. Parkinsonism Relat Disord 2012;18:704e6. [13] Li J, Zhu X, Wang X, Sun W, Feng B, Du T, et al. Targeted genomic sequencing identifies PRRT2 mutations as a cause of paroxysmal kinesigenic choreoathetosis. J Med Genet 2012;49:76e8. [14] Wang JL, Cao L, Li XH, Hu ZM, Li JD, Zhang JG, et al. Identification of PRRT2 as the causative gene of paroxysmal kinesigenic dyskinesias. Brain 2011;134: 3493e501. [15] Ono S, Yoshiura K, Kinoshita A, Kikuchi T, Nakane Y, Kato N, et al. Mutations in PRRT2 responsible for paroxysmal kinesigenic dyskinesias also cause benign familial infantile convulsions. J Hum Genet 2012;57:338e41. [16] Meneret A, Grabli D, Depienne C, Gaudebout C, Picard F, Durr A, et al. PRRT2 mutations: a major cause of paroxysmal kinesigenic dyskinesia in the European population. Neurology 2012;79:170e4.
[17] Specchio N, Terracciano A, Trivisano M, Cappelletti S, Claps D, Travaglini L, et al. PRRT2 is mutated in familial and non-familial benign infantile seizures. Eur J Paediatr Neurol 2012;17:77e81. [18] Dale RC, Gardiner A, Antony J, Houlden H. Familial PRRT2 mutation with heterogeneous paroxysmal disorders including paroxysmal torticollis and hemiplegic migraine. Dev Med Child Neurol 2012;54:958e60. [19] Yang X, Zhang Y, Xu X, Wang S, Yang Z, Wu Y, et al. Phenotypes and PRRT2 mutations in Chinese families with benign familial infantile epilepsy and infantile convulsions with paroxysmal choreoathetosis. BMC Neurol 2013;13:209. [20] Wang JL, Mao X, Hu ZM, Li JD, Li N, Guo JF, et al. Mutation analysis of PRRT2 in two Chinese BFIS families and nomenclature of PRRT2 related paroxysmal diseases. Neurosci Lett 2013;552:40e5. [21] Torisu H, Watanabe K, Shimojima K, Sugawara M, Sanefuji M, Ishizaki YM, et al. Girl with a PRRT2 mutation and infantile focal epilepsy with bilateral spikes. Brain Dev 2013;36:342e5. [22] Tan LC, Methawasin K, Teng EW, Ng AR, Seah SH, Au WL, et al. Clinico-genetic comparisons of paroxysmal kinesigenic dyskinesia patients with and without PRRT2 mutations. Eur J Neurol 2013;21:674e8. [23] Labate A, Tarantino P, Palamara G, Gagliardi M, Cavalcanti F, Ferlazzo E, et al. Mutations in PRRT2 result in familial infantile seizures with heterogeneous phenotypes including febrile convulsions and probable SUDEP. Epilepsy Res 2013;104:280e4. [24] Castiglioni C, Lopez L, Riant F, Bertini E, Terracciano A. PRRT2 mutation causes paroxysmal kinesigenic dyskinesia and hemiplegic migraine in monozygotic twins. Eur J Paediatr Neurol 2013;17:254e8. [25] Holbrook JA, Neu-Yilik G, Hentze MW, Kulozik AE. Nonsense-mediated decay approaches the clinic. Nat Genet 2004;36:801e8. [26] Ling PD, Huls HM. Isolation and immortalization of lymphocytes. Curr Protoc Mol Biol 2005;70. 28.2:28.2.1e28.2.5. [27] O'Roak BJ, Deriziotis P, Lee C, Vives L, Schwartz JJ, Girirajan S, et al. Exome sequencing in sporadic autism spectrum disorders identifies severe de novo mutations. Nat Genet 2011;43:585e9. [28] Levit A, Nutman D, Osher E, Kamhi E, Navon R. Two novel exonic point mutations in HEXA identified in a juvenile Tay-Sachs patient: role of alternative splicing and nonsense-mediated mRNA decay. Mol Genet Metab 2010;100: 176e83. [29] Khajavi M, Inoue K, Lupski JR. Nonsense-mediated mRNA decay modulates clinical outcome of genetic disease. Eur J Hum Genet 2006;10:1074e81. [30] Lee HY, Huang Y, Bruneau N, Roll P, Roberson ED, Hermann M, et al. Mutations in the gene PRRT2 cause paroxysmal kinesigenic dyskinesia with infantile convulsions. Cell Rep 2012;1:2e12.
