Curr Microbiol (2014) 68:495–502 DOI 10.1007/s00284-013-0494-3
Protein Engineering of Chit42 Towards Improvement of Chitinase and Antifungal Activities Mojegan Kowsari • Mostafa Motallebi Mohammadreza Zamani
•
Received: 26 May 2013 / Accepted: 15 October 2013 / Published online: 10 December 2013 Ó Springer Science+Business Media New York 2013
Abstract The antagonism of Trichoderma strains usually correlates with the secretion of fungal cell wall degrading enzymes such as chitinases. Chitinase Chit42 is believed to play an important role in the biocontrol activity of Trichoderma strains as a biocontrol agent against phytopathogenic fungi. Chit42 lacks a chitin-binding domain (ChBD) which is involved in its binding activity to insoluble chitin. In this study, a chimeric chitinase with improved enzyme activity was produced by fusing a ChBD from T. atroviride chitinase 18–10 to Chit42. The improved chitinase containing a ChBD displayed a 1.7-fold higher specific activity than chit42. This increase suggests that the ChBD provides a strong binding capacity to insoluble chitin. Moreover, Chit42-ChBD transformants showed higher antifungal activity towards seven phytopathogenic fungal species. Introduction Trichoderma harzianum is one of the most potent biocontrol agents against a wide range of economically important
M. Kowsari M. Motallebi (&) M. Zamani National Institute of Genetic Engineering and Biotechnology (NIGEB), Shahrak-e Pajoohesh, km 15, Tehran - Karaj Highway, P.O. Box 14965-161, Tehran, Iran e-mail: [email protected] M. Zamani e-mail: [email protected]
aerial and soilborn plant pathogens [26]. It appears that the main mechanism involved in biocontrol by T. harzianum is the release of lytic enzymes [15, 21]. Chitinases are considered key hydrolytic enzymes in the lysis of cell walls of fungi, and they play an important role in biological control [12, 27]. Among Trichoderma chitinases, Chit42 is essential for biocontrol activities against phytopathogenic fungi [19]. The lytic activity of Trichoderma strains could be improved by gene overexpression together with enzyme modification. Only a few of the fungal chitinases contain a chitin-binding domain (ChBD) which is linked to the catalytic site via a linker region. Chit42 in T. harzianum does not contain a ChBD [2, 19, 32]. Previous studies have shown that ChBDs exhibited remarkably high specificity to chitin, and its binding activity was reversible [14]. It is expected that, owing to its small size, the ChBD would have minimal interference with the tertiary structure of the fusion protein [6]. The ChBD is a tunnel-like structure which facilitates chitinase binding, thus, allowing the efficient degradation of chitin [13, 30]. We have constructed a chimeric chitinase by adding a chitin-binding domain from T. atroviride chitinase 18–10 to the N-terminal of Chit42 from T. atroviride to improve its enzyme activity. The antifungal activity of the constructed chimeric was evaluated to study the effect of ChBD in the antifungal activity of the chimeric chitinase.
Materials and Methods Microorganisms and Plasmids
M. Kowsari Agricultural Biotechnology Research Institute of Iran, Seed and Plant Improvement, Institutes Campus, Mahdasht Road, P. O. Box 31535-1897, Karaj, Iran e-mail: [email protected]
Trichoderma harzianum (ABRIICC T8-7MK), Rhizoctonia solani (ABRIICC Rs46), Fusarium graminearum (ABRIICC Fg21), Fusarium oxysporum (ABRIICC Fo11), Sclerotinia
123
496
sclerotiorum (ABRIICC Ss8), Verticillium dahlia (ABRIICC Vd5), Alternaria brassicola (ABRIICC Ab3) and Botrytis cinerea (ABRIICC Bc2) were provided by the Agricultural Biotechnology Research Institute of Iran (ABRII), type collection culture. The amdS plasmid p3SR2 was kindly provided by Prof. Dr. M. J. Hynes from Melbourne University, Australia. The pLMRS3 plasmid which carried the constitutive promoter pki1 from T. reesei and the cbh2 terminator from T. reesei cellobiohydrolaseII was kindly donated by Prof. Dr. R. L. Mach, Vienna University, Austria. Total genomic DNA was isolated from freeze-dried mycelia according to the method of Lee and Taylor [16]. The RNA from powdered mycelia was isolated using the RNeasy Plant Mini Kit (Qiagen) according to the manufacturer’s recommendations. Molecular biology procedures were performed following the standard protocols of Sambrook and Russell [28]. Growth Media Fungal strains were maintained on PDA (Potato Dextrose Agar). Colloidal Chitin Agar (CCA) selective medium contained (g/l): colloidal chitin, 5.0; sucrose, 1.0; NaNO3, 2.0; K2HPO4, 1.0; KCl, 0.5; MgSO4, 0.5; FeSO4, 0.01; agar 15 at pH 6.5. Salt minimal medium, MM [23] supplemented with 20 g/l glucose were used for spore inoculation. The MM medium was buffered using 0.2 M MES (2-Nmorpholino-ethanesulfonic acid)-KOH pH 6.0, or 0.2 M Tris pH 8.0. The selective medium for amdS expression was MM containing 10 mM acetamide as the sole nitrogen source and 12.5 mM CsCl (MMA). The Escherichia coli strain was grown in a Luria–Bertani (LB) medium at 37 °C, and media were supplemented with ampicillin (SIGMA, 100 g/ml). All chemicals and antibiotics were purchased from Merck (Germany). DNA modifying enzymes were obtained from Fermentase and Roche Biochemical. Construction of Hybrid Chitinase Chit42 cDNA from T. atroviride (DQ022674) was amplified using Pf1/Prx primers (Table 1) with XbaI site by Pfu DNA polymerase. The PCR mixture contained the standard concentration of DNA, dNTPs, primers and DNA polymerases. The PCR reaction was carried out as follows: one cycle for 50 s at 94 °C, 35 cycles of amplification: 1 min at 94 °C, 1 min at 60 °C and 1.5 min at 72 °C, followed by an additional cycle of 5 min at 72 °C. The blunt-ended fragment was ligated to vector pJET (pJEchit42) and pLMRS3 (pLMRS3-chit42). To create a chimeric gene containing ChBD?linker at the N-terminal end of chit42cDNA, the fragment containing chit42 cDNA (F1 fragment in Fig. 1) was amplified using F3/Prx primers (Table 1).
123
M. Kowsari et al.: Protein Engineering of Chit42 Table 1 Primers used in this study Primer
Sequences (50 –30 )
Pf1
GC TCTAGAATGTTGGGCTTCCTCGGAAAG
Prx
GCTCTAGACTAGTTGAGACCGCTTCGGAT
F3
GCTCCCGCCCACTTCGCCAGCGGATACGCAAACG
R1
TGAGGACCGCATTTTCTCTTCTCAACTGAGACG
F0 1
TCAGTTGAGAAGAGAAAATGCGGTCCTCAGGTTCC
R2
TTTGCGTATCCGCTGGCGAAGTGGGCGGGAGCCG
ChiF
TGCCTACGCCGATTATCAGAAGCA
ChiR
CTTCAAGTTGCGGTTGGCCTTCTT
btubuF
TTCTTGCATTGGTACACTAGCG
btubuR
ATCGTTCATGTTGGACTCAGCC
This fragment contained the coding sequence of the mature protein of Chit42 without its signal peptide and prepro region (1,170 bp). The signal peptide and prepro sequences of chit42 (105 bp) were amplified (F2 fragment in Fig. 1) from plasmid pJEchit42 using Pf1/R1 primers (Table 1). The fragment (237 bp) containing a chitin-binding domain (from amino acid 414 to 480) and a linker (from amino acid 481 to 492) in chitinase 18–10 (AAZ23945.1) was amplified (F3 fragment in Fig. 1) using the genomic DNA of T. atrovridea as template and F0 1/R2 as primers (Table 1). Amplified fragments (F2 and F3) were purified using a PCR product purification kit (Roche) and fused together in a second PCR step. R1/F0 1primers (Table 1) contained respectively a 14- and 15-nucleotides long 50 extension complementary to the ChBD?linker and signal peptide?prepro fragments that were necessary to fuse different fragments together. The chimeric chitinase was constructed using Splicing by Overlap Extension (SOEing) PCR. For overlap extension of PCR, equimolar amounts of each fragment (F2 and F3) were mixed in the absence of additional primers. The PCR programme consisted of seven repetitive cycles and was carried out with a denaturation step (94 °C, 1 min), an annealing step (54 °C, 1 min) and an elongation step (72 °C, 1.2 min). The fusion product was subsequently amplified using F1 and R2 primers in PCR reaction as described above. For the second SOEing PCR, the product of the first SOEing PCR and F1 fragment was purified and fused together in a second PCR reaction. R2 and F3 primers contained 17- and 15-nucleotides 50 extensions complementary to the F1 and linker fragments for fusion. For overlap extension PCR, equimolar amounts of each fragment were mixed without additional primers. The PCR programme consisting of seven repetitive cycles was carried out. Then the fused product was amplified using Pf1/ Prx primers. The chimeric gene was purified and cloned into XbaI site of pJET1.2. The nucleotide sequence of the chimeric gene was verified by DNA sequencing. The
M. Kowsari et al.: Protein Engineering of Chit42
497
Fig. 1 Scheme of gene constructions. Vectors pLMRS3-chit42 and pLMRS3-chit42ChBD were constructed amplifying the signal peptide, preproregion, ChBD, linker region and mature chit42with specific primers containing strategies for cleavage. pki prom, Pyruvate kinase promoter from T. reesei; sp, signal peptide; prepro,
preproregion; ChBD-Linker, Chitin-binding domain and linker of chitinase 18–10 T. atroviride; Chit42 cDNA encoding mature protein; cbh2 term, terminator of cellobiohydrolases II from T. reesei. Numbers inside shapes show fragment sizes; Arrows indicate primers for PCR and SOEing PCR amplification
fragment was ligated to the pLMRS3 vector to create pLMRS3-chit42ChBD for expression of the chimeric gene in Trichoderma.
Transcriptomic Analysis by Quantitative Real-time RT-PCR
Transformation Procedures Protoplast preparation and transformation were carried out according to the method of Penttila¨et al. [25]. T. harzianum T8-7 MK wild type was cotransformed with chitinasecontaining plasmids pLMRS3-ChBD and pLMRS3-chit42 with the plasmid p3SR2. Plasmid p3SR2 carries the amdS gene from as Aspergillus nidulans, which codes for acetamidase as a selectable marker. Cotransformation was conducted with a 1:10 (p3SR2/pLMRS3-chit42 & pLMRS3chit42ChBD) plasmid ratio, and 200–1,000 ll aliquots of the transformed protoplasts were plated in 0.75 % selective top Agar containing 1 M sorbitol as the osmotic stabilizer. The selective medium for amdS expression was MM glucose containing 10 mM acetamide as the sole nitrogen source instead of (NH4)2 SO4 and 12.5 mM CsCl. Individual colonies were randomly chosen for amds in the selective medium and incubated at 28 °C after five days. Protoplasts were placed on a 2 % CCA selective medium. The protoplast regeneration and the development of colonies were observed on plates that were incubated at room temperature. Regenerated transformants were selected based on their growth rate on selective medium. One mycelial disc (5 mm) of each transformant was inoculated on 0.5 % CCA and PDA media and incubated at 28 °C for four days.
Chit42 transcripts were quantified by real-time quantitative RT-PCR in transformants and control strains under repressive conditions with glucose. RNA was isolated from mycelia grown for 48 h at 28 °C in MM with 20 g/l glucose. Total RNA was isolated from 100 mg of freeze-dried mycelia powder derived from single spore of selected transformants and wild type using the RNeasy Plant Mini Kit (Qiagen). The cDNA were synthesized from 1 lg of total RNA using a cDNA synthesis kit with an oligo (dT) primer. One ll of the cDNA was used in the PCR reaction with the (chiF/chiR) and (btubuF/btubuR) as specific primers. Real-time PCR was performed using an ABI system with a SYBR green master mix. All PCRs were performed in triplicate in a total volume of 10 ll for 40 cycles under the following conditions: denaturation, 95 °C, 45 s; annealing, 58 °C, 1 min; extension, 72 °C, 1 min. The number of cDNA transcripts was normalized against the expression of the housekeeping b-tubulin gene [11]. Data were expressed as 2-DDCT [20]. Chitinase Activity Chitinase activity was assayed according to the method of Boller and Mauch [4]. To test the effect of a ChBD on chitinase activity, insoluble chitin was used as a substrate. Strains were grown for 60 h in pH 6-buffered MM with 20 g/l glucose; 250 ll concentrated supernatant or cell-free
123
498
M. Kowsari et al.: Protein Engineering of Chit42
extract of each strain was incubated with insoluble chitin. Chitin (10 g/l) was resuspended in a 70 mM potassium phosphate buffer pH 6.0. Activity was assayed in continuous shaking at 30 °C for 1 h. The released N-acetyl-glucosamine (GlcNAc) was measured according to the procedures set out by Reissig et al. [25]. A unit was defined as the amount of enzyme that released 1 lmol GlcNAc per 60 min. Chitinase activity data are the average of three experiments. Specific activity was expressed in units per microgram protein. The protein content in the culture filtrates was estimated using Bradford’s method [5].
Table 2 Growth rate and chitinase activity of the Chit42 and Chit42ChBD transformants
Chit42-11
27.5 ± 0.7
1.58 ± 0.02
140 ± 0.5
Test for Antagonism
Chit42-12
33.0 ± 1.2
3.15 ± 0.07
210 ± 1.3
Chit42-14
28.5 ± 0.8
2.16 ± 0.05
160 ± 0.9
In vitro tests were conducted to evaluate the antagonistic effect of chit42 and chit42-ChBD transformants against fungal pathogens on a PDA medium using the dual culture technique [9]. One mycelial disc (5 mm) of transformants and one disc (5 mm) of test pathogen were simultaneously placed on opposite sides of a PDA Petri dish and incubated at 26 °C. Three plates (replications) were used for each transformant and test pathogen based on a completely randomized design. The plates that received only the mycelial disc of pathogens served as control. The colony interaction was assayed as the percentage of inhibition on the PDA plate after four days of incubation following the formula suggested by Sundar et al. [29]. Inhibition of growth (%) = X – Y/X 9 100 where, X = mycelial growth of pathogen in the absence of Trichoderma (control), Y = mycelial growth of pathogen in the presence of transformants. The fungal strains included R. solani, F. graminearum, F. oxysporum, S. sclerotiorum, V. dahlia, A. brassicales and B. cinerea.
Chit42-ChBD3
30.0 ± 1.0
2.95 ± 0.09
220 ± 1.8
Chit42-ChBD4
26.0 ± 0.3
2.80 ± 0.05
230 ± 1.0
Results
Isolate
Diameter (mm/48 h)
Chitinase activity (U/ml)
Control (nontransformed)
17.5 ± 0.5
0.048 ± 0.001
Specific activity (U/mg) 20 ± 0.5
Chit42-2
26.0 ± 0.6
1.59 ± 0.01
130 ± 1.2
Chit42-4
25.0 ± 0.3
1.28 ± 0.02
110 ± 0.8
Chit42-6
30.0 ± 1.0
2.41 ± 0.09
180 ± 1.2
Chti42-8
26.5 ± 0.5
1.16 ± 0.01
100 ± 0.4
Chit42-9
32.0 ± 0.4
2.60 ± 0.01
190 ± 1.4
Chit42-ChBD6
31.0 ± 0.6
3.82 ± 0.09
260 ± 2.6
Chit42-ChBD7
27.0 ± 0.7
3.08 ± 0.07
220 ± 0.7
Chit42-ChBD11 Chti42-ChBD13
31.5 ± 0.5 32.0 ± 1.1
3.57 ± 0.09 4.82 ± 0.06
250 ± 1.4 330 ± 2.7
Chit42-ChBD14
25.8 ± 0.7
1.86 ± 0.02
140 ± 1.6
Chit42-ChBD15
32.0 ± 0.5
6.20 ± 0.09
390 ± 2.9
Results and standard deviations are the average of three replicates
Stable transformants were initially selected using a selective medium containing acetamide. From among 500 transformants for each construct, 100 were selected on the basis of their ability to grow on the selective medium containing 2 % colloidal chitin (2 %CCA). The selected stable amdS transformants were found to have chitinase activity. Among these transformants, 16 fast growing colonies for each construct, designated Chit42-ChBD1 to 16 and Chit42-1 to 16, were selected for further study. The growth rate of the selected colonies was examined on a 0.5 % CCA medium for 48 h. Based on the mycelial growth, eight fast growing transformants from each group were selected for subsequent study (Table 2).
Transformation of Trichoderma harzianum by Chitinase Genes
Expression Analysis
Trichoderma harzianum was cotransformed with the plasmid p3SR2 and the pLMRS3 derivatives (pLMRS3-chit42 and pLMRS3-chit42-ChBD) as shown in Fig. 1. The chimeric chitinase was constructed by the fusion of a Chit18–10 ChBD from T. atroviride to Chit42. The prediction of the ChBD glycozylation site by NetOGlyc 3.1 server showed four glycozylation sites in the ser-rich linker which separated the catalytic domain from the binding domain. The glycozylation of linker prevented the chimeric enzyme from proteolysis which occurs mainly in this region [29]. The ChBD was added to the N-terminal of chit42 employing SOEing PCR (Fig. 1).
To test the expression of chit42 and chit42-ChBD in the selected transformants, quantitative RT-PCR was performed using real-time PCR. The cDNA was prepared from the RNA of transformants and nontransformants (as negative control) grown in MM containing 20 g/l glucose as repressive conditions for endogenous chitinase repression. Based on calculations using the 2-DDCT method and b-tubulin as an internal reference gene, differential expression folds of chit42 (ranging from 8 to 32) and chimeric chitinase (ranging from 9.2 to 45.25) were detected in transformants with the highest level of expression for Chit42-ChBD15 (Fig. 2).
123
M. Kowsari et al.: Protein Engineering of Chit42
499
Fig. 2 Quantitative RT-PCR analysis of chitinase gene in the Chit42 and Chit42-ChBD transformants. Values (2-DDCT) corresponds to relative measurement against the chit42 transcript in the control (2DDCT = 1.002). Trichoderma btubulin was used as an internal reference gene
Table 3 Antifungal inhibition (%) of selected Chit42-ChBD transformants against different phytopathogenic fungi Pathogen
Control
Chit42BD3
Chit42ChBD4
Chit42ChBD6
Chit42ChBD7
Chit42ChBD11
Chit42ChBD13
Chit42ChBD14
Chit42ChBD15
R. solani
34
100
35
100
55.5
100
100
37.8
100
F. graminearum
32.5
66.6
30
33.3
66
F. oxysporum
21
80
16
76
40
80
60
25
S. sclerotiorum
18.5
68
16
100
52
68
78.6
27.3
V. dahlia
48
A. brassicola
49.5
B. cinerea
10
86.6
52
66.6
86.6
100
65
100
50
11
50
Chitinase Activity The effect of the ChBD on the chitinase activity of Chit42 was investigated with insoluble chitin under repressive conditions in a buffered glucose medium. While the enzyme activity in the Chit42 transformants ranged from 1.16 to 3.15 U/ml, the Chit42ChBD transformants showed improved chitinase activity of 1.86–6.2 U/ml (Table 2). Overall, specific chitinase activity was highest in transformants for the chimeric chitinases. The minimum and maximum specific activity of Chit42 and Chit42ChBD was 100–210 and 140–390 U/mg, respectively (Table 2). These results indicate that the presence of a ChBD can increase specific activity. The specific chitinase activity of Chit42ChBD-15 showed the highest activity of 390 U/mg when compared to Chit42-12 (210 U/mg) (Table 2). Antifungal Activity To determine whether an increase in the transformants’ chitinase activity correlates with their antifungal activity, dual culture tests were carried out. When phytopathogenic
46.6
86.6
66.6
83.3 88 100
77.7
95.5
77.5
100
76
88
100
80
100
12.5
30
25
12
62.5
fungi and T. harzianum (wild type or transformants) were grown in the same plates, they produced a zone of lysis in the pathogenic fungal mycelia. Seven phytopathogenic fungi were inoculated individually on plates against the different chimeric transformants (Table 3). All the transformants showed varied reductions in the growth rate of these seven fungi, ranging from 11 to 100 % (Table 3). The highest rate of inhibition based on overgrow and sporulation on pathogen was observed for R. solani. The growth inhibition of R. solani by Chit42-ChBD3, 6, 11, 13 and 15 transformants was similar and 100 % compared to the nontransformant as the control (Fig. 3). No growth was detected when pieces of the overgrown area of lysed and killed R. solani mycelia were transferred to fresh medium (data not shown). Among these transformants, Chit42-ChBD15 was the best at inhibiting the growth of the seven pathogens tested (Table 3). The minimum and maximum values of mean Inhibition by Chit42ChBD transformants against the seven phytopathogenic fungi were 31.6 and 88.6 %, respectively, which were significantly different compared with those of the wild type (10–49.5 %) and Chit42 transformants (24.7–63.4 %) (Table 4). At the same time, the mean inhibition by Chit42
123
500
M. Kowsari et al.: Protein Engineering of Chit42
Fig. 3 Growth inhibition of R. solani by Chit42-ChBD transformants and the control. Each plate has T. harzianum at the top and R. solani at the bottom. Transformants: E3, Chit42-ChBD3; E4, Chit42-
ChBD4; E6, Chit42-ChBD6; E7, Chit42-ChBD7; E11, Chit42ChBD11; E13, Chit42-ChBD13; E14, Chit42-ChBD14 and E15, Chit42-ChBD15
Table 4 Comparison of antifungal (%) activity of improved Chit42-ChBD and Chit42 transformants and wild type as control Pathogen R. solani F. graminearum F. oxysporum S. sclerotiorum V. dahlia A. brassicola B. cinerea
Overexpressed (inhibition mean)
Chit42 control (fold)
Chimer (inhibition mean)
Chit42 - ChBD (fold) control
Chimer (fold) over
34 ± 0.4
61.5
1.8
78.5
2.3
1.28
32.5 ± 0.5
45.4
1.4
57.4
1.76
1.26
21 ± 0.6
46.5
2.21
58.1
2.76
1.25
18.5 ± 0.5
45.5
2.46
63.7
3.44
1.40
62
1.29
82.8
1.72
1.33
49.5 ± 0.5
63.4
1.28
88.6
1.79
1.39
10 ± 0.3
24.7
2.47
31.6
3.16
1.28
Control (inhibition mean)
48 ± 0.8
Results and standard deviations are the average of three replicates
transformants was 24.7–63.4 % (Table 4). Transformants that overexpressed the hybrid chitinases inhibited growth of all pathogens more than both the wild type and Chit42 transformants expressing the native chitinases. Transformation of T. harzianum by chit42 increased its inhibition from 1.29-fold (for V. dahliae) to 2.47-fold (for S. sclerotiorum) when compared with the nontransformant (Table 4), while transformation by Chit42-ChBD increased the inhibition from 1.72-fold (for V. dahliae) to 3.44-fold (for S. sclerotiorum), indicating the positive effect of the ChBD on biocontrol activity.
Discussion Chitinases of T. harzianum are believed to play an important role in antifungal activity. Among these enzymes chit42 has been shown to be responsible for most of the
123
chitinase activity [7, 10, 18]. This enzyme does not contain a chitin-binding domain (ChBD) to bind to insoluble chitin such as fungal cell walls. Therefore, in this study, transformants of T. harzianum that overexpressed chimeric chitinases with a ChBD were obtained, and to improve fungal strains, the overexpression of hydrolases has usually been achieved using strong, but regulated promoters that need an inducer for expression. This is not the optimal situation for controlling plant disease [10, 17, 22, 32]. In this research, a constitutive promoter was used for chitinase overexpression, without using any specific inducer. Many over-produced hydrolases underwent proteolysis when they were overexpressed in Trichoderma. The Chit42 and Chit42RChBD transformants were grown in buffered media to prevent the proteolysis of overexpressed chitinases by acidic proteases [8]. Furthermore, the predicted glycozylation at the linker region of the binding domain could protect the chimeric chitinase against proteolysis.
M. Kowsari et al.: Protein Engineering of Chit42
501
Table 5 Comparison of overexpressed and chimer transformants based on 2-DDCT and chitinase activities Control
Overexpressed
Chimer
Chimer over (fold)
2-DDCT (mean)
1.00
17.53
23.35
1.33
Chitinase activity (U/ml) (mean)
0.048
1.99
3.64
1.83
Specific activity (U/mg) (mean)
20
150
260
1.7
Protection of the linker region by glycozylation has been demonstrated by Alfthan et al. [1] and Limon et al. [18]. Significant differences were observed between the chitinase activity of Chit42 and chimer transformants against insoluble chitin. The variations in observed enzyme activity among the Chit42 or ChBD-Chit42 transformants (Table 2) might be related to the copy number of the transgene and/or their position in the genome. The effect of these two parameters could mainly be normalized when the means of data from two kinds of transformants were compared. The means of extracellular chitinase activity produced by the Chit42 and Chit42-ChBD transformants were 1.99 and 3.64 U/ml, respectively (Table 5). The improved chitinase containing a chitin-binding domain showed higher chitinase activity than Chit42 (about 1.83fold) when grown in a glucose medium for repressing endogenous chitinases. This result showed an increase of about 83 % in chimer chitinase activity over expressed Chit42 (Table 5). Moreover, the mean of the specific activities of Chit42 was 150 U/mg, whereas that of Chit42ChBD was 260 U/mg, which shows a 1.7-fold increase. This increase (70 %) suggests that the ChBD may be helping the enzyme to bind better to the insoluble chitin, therefore, increasing enzyme activity (Table 5), while the difference between the transcript levels demonstrates a 33 % increase of ChBD-Chit42 mRNA over that of Chit42 when analysed by real-time PCR which emphasizes the role of the ChBD (Table 5). Limon et al. added a ChBD from Nicotiana tabacum to Chit42 and observed an approximately 36 % increase in the chitinase activity of the chimeric enzyme in the presence of insoluble chitin [18]. Fan et al. constructed a chimeric chitinase using the silkworm ChBD and Beauveria bassiana chitinase which showed a 5.5-fold increase in enzymatic activity in the presence of powdered chitin [9]. The effect of a ChBD on chitin binding was also described by Hashimoto et al. [14]. They showed that deletion of the ChBD from chitinase A1 greatly decreased the efficiency of chitin degradation. In this study, the transformants expressing chimeric chitinase, which is more active towards crystalline chitin, also showed higher antifungal activity than the Chit42 transformants. This seems to result from the subsite
structure in the binding cleft (ChBD) of this enzyme. This finding was also reported by Hashimoto et al. [14] who suggested that the ChBD recognizes an insoluble or crystalline chitin structure. The variation among the antifungal activity of these chitinases was observed when seven phytopathogenic fungi were tested (Table 3). This may be due to the intrinsic variability of chitin and cell wall composition which naturally exists in polymorphic forms. [3, 24, 31]. Looking at the results, we can introduce the Chit42ChBD15 as the best transformant with the highest chitinase activity (6.201 U/ml), specific activity (390 U/mg) and also an antagonistic effect. In conclusion, our data demonstrate that enzyme engineering can produce a chitinase with an improved activity capacity, which will lead to higher enzyme and antifungal activities; thus the transformants generated in this study might result in better biocontrol agents in the field. Acknowledgments We thank Prof. Dr. R. L. Mach and Prof. Dr. M. J. Hynes for kindly providing plasmids. We wish to thank Dr. M. C. Limon for her advises. This project was supported by the National Institute of Genetic Engineering and Biotechnology.
References 1. Alfthan K, Takkinen K, Sizmann D et al (1995) Properties of a single-chain antibody containing different linker peptides. Protein Eng 8:725–731 2. Arakane Y, Zhu Q, Matsumiya M, Muthukrishnan S et al (2003) Properties of catalytic, linker and chitin-binding domains of insect chitinase. Insect Biochem Mol Biol 33:631–648 3. Aranaz I, Mengı0 bar M, Harris R, Panos I, Miralles B et al (2009) Functional characterization of chitin and chitosan. Curr Chem Biol 3:203–230 4. BollerT Mauch F (1988) Colorimetric assay for chitinase. Methods Enzymol 161:430–435 5. Bradford M (1976) A rapid and sensitive method for the quantification of microgram quantities of protein utilizing the principle of protein–dye binding. Anal Biochem 72:249–254 6. Chern JT, Chao YP (2005) Chitin-binding domain based immobilization of D-hydantoinase. J Biotechnol 117:267–275 7. De la Cruz J, Hidalgo-Gallego A, Lora JM, Benı´tez T et al (1992) Isolation and characterization of three chitinases from Trichoderma harzianum. Eur J Biochem 206:859–867 8. Delgado-Jarana J, Rincon AM, Benitez T (2002) Aspartyl protease from Trichoderma harzianum CECT 2413: cloning and characterization. Microbiology 148:1305–1315 9. Fan Y, Fang W, Guo S, Pei X et al (2007) Increased insect virulence in Beauveria bassiana strains overexpressing an engineered chitinase. Appl Environ Microbiol 73:295–302 10. Garcı´a I, Lora JM, De la Cruz J, Benı´tez T et al (1994) Cloning and characterization of a chitinase (CHIT42) cDNA from the mycoparasitic fungus Trichoderma harzianum. Curr Genet 27:83–89 11. Glass NL, Donaldson G (1995) Development of primer sets designed for use with the PCR to amplify conserved genes from filamentous ascomycetes. Appl Environ Microbiol 61:1323–1330
123
502 12. Guthrie JL, Khalif S, Castle AJ (2005) An improved method for detection and quantification of chitinase activities. Can J Microbiol 51:491–495 13. Hardt M, Laine RA (2004) Mutation of active site residues in the chitin-binding domain ChBDChiA1 from chitinase A1 of Bacillus circulans alters substrate specificity: use of a green fluorescent protein binding assay. Arch Biochem Biophys 426:286–297 14. Hashimoto M, Ikegami T, Seino S, Ohuchi N et al (2000) Expression and characterization of the chitin-binding domain of chitinase A1 from Bacillus circulans WL-12. J Bacteriol 182:3045–3054 15. Kubicek CP, Herrera-Estrella A, Seidl-Seiboth V, Martinez DA, Druzhinina IS, Thon M, Zeilinger S et al (2011) Comparative genome sequence analysis underscores mycoparasitism as the ancestral life style of Trichoderma. Genome Biol 12:R40 16. Lee SB, Taylor JW (1990) Isolation of DNA from fungal mycelia and single spores. In: Innis DGM, Sninsky J, White T (eds) In: PCR protocols: a guide to methods and applications, vol 34. Academic Press, Orlando 17. Limo´n MC, Lora JM, Garcı´a I, De la Cruz J, Llobell A et al (1995) Primary structure and expression pattern of the 33 kDa chitinase gene from the mycoparasitic fungus Trichoderma harzianum. Curr Genet 28:478–483 18. Limon MC, Margolles-Clark E, Benitez T, Penttila M (2001) Addition of substrate-binding domains increases substrate-binding capacity and specific activity of a chitinase from Trichoderma harzianum. FEMS Microbiol Lett 198:57–63 19. Limon MC, Chacon MR, Mejias R, Delgado-Jarana J et al (2004) Increased antifungal and chitinase specific activities of Trichoderma harzianum CECT 2413 by addition of a cellulose binding domain. Appl Microbiol Biotechnol 64:675–685 20. Livak KJ, Schmittgen T (2001) Analysis of relative gene expression data using real-time quantitative PCR and the 2-DDCT method. Methods 25:402–408 21. Matarese F, Sarrocco S, Gruber S, Seidl SV, Vannacci G (2012) Biocontrol of Fusarium head blight: interactions between Trichoderma and mycotoxigenic Fusarium. Microbiology 158:98–106
123
M. Kowsari et al.: Protein Engineering of Chit42 22. Migheli Q, Gonza´lez-Candelas L, Dealessi L et al (1998) Transformants of Trichoderma longibrachiatum overexpressing the b-1,4-endoglucanase gene egl1 show enhanced biocontrol of Pythium ultimun on cucumber. Phytopathology 88:673–677 23. Penttila¨ M, Nevalainen H, Ra¨tto¨ M, Salminen E, Knowles J (1987) A versatile transformation system for the cellulolytic filamentous fungus Trichoderma reesei. Gene 61:155–164 24. Pillai CKS, Paul W, Chandra PS (2009) Chitin and chitosan polymers: chemistry, solubility and fiber formation. Prog Polym Sci 34:641–678 25. Reissig JL, Strominger JL, Leloir L (1955) A modified colorimetric method for the estimation of N-acetylamino sugars. J Biol Chem 217:959–966 26. Reithner B, Ibarra-Laclette E, Mach RL, Estrella H (2011) A identification of mycoparasitism-related genes in Trichoderma atroviride. Appl Environ Microbiol 77:4361–4370 27. Ryder LS, Harris BD, Soanes DM, Kershaw MJ et al (2012) Saprotrophic competitiveness and biocontrol fitness of a genetically modified strain of the plant-growth-promoting fungus Trichoderma hamatum GD12. Microbiology 158:84–97 28. Sambrook J, Russell D (2001) Molecular cloning: a laboratory manual. Cold Spring Harbor Laboratory Press, Woodburry 29. Sundar AR, Das ND, Krishnaveni D (1995) In-vitro antagonism of Trichoderma spp. against two fungal pathogens of castor. Indian J Plant Protec 23:152–155 30. Van Aalten DMF, Komander D, Synstad B, Gaseidnes S et al (2001) Structural insights into the catalytic mechanism of a family 18 exo-chitinase. PNAS 98:8979–8984 31. Van de Velde K, Kiekens P (2004) Structure analysis and degree of substitution of chitin, chitosan and dibutyrylchitin by FT-IR spectroscopy and solid state 13C NMR. Carbohydr Polym 58:409–416 32. Yanai K, Takaya N, Kojima N, Horiuchi H et al (1992) Purification of two chitinases from Rhizopus oligosporus and isolation and sequencing of the encoding genes. J Bacteriol 174:7398–7406
Protein Engineering of Chit42 Towards Improvement of Chitinase and Antifungal Activities Mojegan Kowsari • Mostafa Motallebi Mohammadreza Zamani
•
Received: 26 May 2013 / Accepted: 15 October 2013 / Published online: 10 December 2013 Ó Springer Science+Business Media New York 2013
Abstract The antagonism of Trichoderma strains usually correlates with the secretion of fungal cell wall degrading enzymes such as chitinases. Chitinase Chit42 is believed to play an important role in the biocontrol activity of Trichoderma strains as a biocontrol agent against phytopathogenic fungi. Chit42 lacks a chitin-binding domain (ChBD) which is involved in its binding activity to insoluble chitin. In this study, a chimeric chitinase with improved enzyme activity was produced by fusing a ChBD from T. atroviride chitinase 18–10 to Chit42. The improved chitinase containing a ChBD displayed a 1.7-fold higher specific activity than chit42. This increase suggests that the ChBD provides a strong binding capacity to insoluble chitin. Moreover, Chit42-ChBD transformants showed higher antifungal activity towards seven phytopathogenic fungal species. Introduction Trichoderma harzianum is one of the most potent biocontrol agents against a wide range of economically important
M. Kowsari M. Motallebi (&) M. Zamani National Institute of Genetic Engineering and Biotechnology (NIGEB), Shahrak-e Pajoohesh, km 15, Tehran - Karaj Highway, P.O. Box 14965-161, Tehran, Iran e-mail: [email protected] M. Zamani e-mail: [email protected]
aerial and soilborn plant pathogens [26]. It appears that the main mechanism involved in biocontrol by T. harzianum is the release of lytic enzymes [15, 21]. Chitinases are considered key hydrolytic enzymes in the lysis of cell walls of fungi, and they play an important role in biological control [12, 27]. Among Trichoderma chitinases, Chit42 is essential for biocontrol activities against phytopathogenic fungi [19]. The lytic activity of Trichoderma strains could be improved by gene overexpression together with enzyme modification. Only a few of the fungal chitinases contain a chitin-binding domain (ChBD) which is linked to the catalytic site via a linker region. Chit42 in T. harzianum does not contain a ChBD [2, 19, 32]. Previous studies have shown that ChBDs exhibited remarkably high specificity to chitin, and its binding activity was reversible [14]. It is expected that, owing to its small size, the ChBD would have minimal interference with the tertiary structure of the fusion protein [6]. The ChBD is a tunnel-like structure which facilitates chitinase binding, thus, allowing the efficient degradation of chitin [13, 30]. We have constructed a chimeric chitinase by adding a chitin-binding domain from T. atroviride chitinase 18–10 to the N-terminal of Chit42 from T. atroviride to improve its enzyme activity. The antifungal activity of the constructed chimeric was evaluated to study the effect of ChBD in the antifungal activity of the chimeric chitinase.
Materials and Methods Microorganisms and Plasmids
M. Kowsari Agricultural Biotechnology Research Institute of Iran, Seed and Plant Improvement, Institutes Campus, Mahdasht Road, P. O. Box 31535-1897, Karaj, Iran e-mail: [email protected]
Trichoderma harzianum (ABRIICC T8-7MK), Rhizoctonia solani (ABRIICC Rs46), Fusarium graminearum (ABRIICC Fg21), Fusarium oxysporum (ABRIICC Fo11), Sclerotinia
123
496
sclerotiorum (ABRIICC Ss8), Verticillium dahlia (ABRIICC Vd5), Alternaria brassicola (ABRIICC Ab3) and Botrytis cinerea (ABRIICC Bc2) were provided by the Agricultural Biotechnology Research Institute of Iran (ABRII), type collection culture. The amdS plasmid p3SR2 was kindly provided by Prof. Dr. M. J. Hynes from Melbourne University, Australia. The pLMRS3 plasmid which carried the constitutive promoter pki1 from T. reesei and the cbh2 terminator from T. reesei cellobiohydrolaseII was kindly donated by Prof. Dr. R. L. Mach, Vienna University, Austria. Total genomic DNA was isolated from freeze-dried mycelia according to the method of Lee and Taylor [16]. The RNA from powdered mycelia was isolated using the RNeasy Plant Mini Kit (Qiagen) according to the manufacturer’s recommendations. Molecular biology procedures were performed following the standard protocols of Sambrook and Russell [28]. Growth Media Fungal strains were maintained on PDA (Potato Dextrose Agar). Colloidal Chitin Agar (CCA) selective medium contained (g/l): colloidal chitin, 5.0; sucrose, 1.0; NaNO3, 2.0; K2HPO4, 1.0; KCl, 0.5; MgSO4, 0.5; FeSO4, 0.01; agar 15 at pH 6.5. Salt minimal medium, MM [23] supplemented with 20 g/l glucose were used for spore inoculation. The MM medium was buffered using 0.2 M MES (2-Nmorpholino-ethanesulfonic acid)-KOH pH 6.0, or 0.2 M Tris pH 8.0. The selective medium for amdS expression was MM containing 10 mM acetamide as the sole nitrogen source and 12.5 mM CsCl (MMA). The Escherichia coli strain was grown in a Luria–Bertani (LB) medium at 37 °C, and media were supplemented with ampicillin (SIGMA, 100 g/ml). All chemicals and antibiotics were purchased from Merck (Germany). DNA modifying enzymes were obtained from Fermentase and Roche Biochemical. Construction of Hybrid Chitinase Chit42 cDNA from T. atroviride (DQ022674) was amplified using Pf1/Prx primers (Table 1) with XbaI site by Pfu DNA polymerase. The PCR mixture contained the standard concentration of DNA, dNTPs, primers and DNA polymerases. The PCR reaction was carried out as follows: one cycle for 50 s at 94 °C, 35 cycles of amplification: 1 min at 94 °C, 1 min at 60 °C and 1.5 min at 72 °C, followed by an additional cycle of 5 min at 72 °C. The blunt-ended fragment was ligated to vector pJET (pJEchit42) and pLMRS3 (pLMRS3-chit42). To create a chimeric gene containing ChBD?linker at the N-terminal end of chit42cDNA, the fragment containing chit42 cDNA (F1 fragment in Fig. 1) was amplified using F3/Prx primers (Table 1).
123
M. Kowsari et al.: Protein Engineering of Chit42 Table 1 Primers used in this study Primer
Sequences (50 –30 )
Pf1
GC TCTAGAATGTTGGGCTTCCTCGGAAAG
Prx
GCTCTAGACTAGTTGAGACCGCTTCGGAT
F3
GCTCCCGCCCACTTCGCCAGCGGATACGCAAACG
R1
TGAGGACCGCATTTTCTCTTCTCAACTGAGACG
F0 1
TCAGTTGAGAAGAGAAAATGCGGTCCTCAGGTTCC
R2
TTTGCGTATCCGCTGGCGAAGTGGGCGGGAGCCG
ChiF
TGCCTACGCCGATTATCAGAAGCA
ChiR
CTTCAAGTTGCGGTTGGCCTTCTT
btubuF
TTCTTGCATTGGTACACTAGCG
btubuR
ATCGTTCATGTTGGACTCAGCC
This fragment contained the coding sequence of the mature protein of Chit42 without its signal peptide and prepro region (1,170 bp). The signal peptide and prepro sequences of chit42 (105 bp) were amplified (F2 fragment in Fig. 1) from plasmid pJEchit42 using Pf1/R1 primers (Table 1). The fragment (237 bp) containing a chitin-binding domain (from amino acid 414 to 480) and a linker (from amino acid 481 to 492) in chitinase 18–10 (AAZ23945.1) was amplified (F3 fragment in Fig. 1) using the genomic DNA of T. atrovridea as template and F0 1/R2 as primers (Table 1). Amplified fragments (F2 and F3) were purified using a PCR product purification kit (Roche) and fused together in a second PCR step. R1/F0 1primers (Table 1) contained respectively a 14- and 15-nucleotides long 50 extension complementary to the ChBD?linker and signal peptide?prepro fragments that were necessary to fuse different fragments together. The chimeric chitinase was constructed using Splicing by Overlap Extension (SOEing) PCR. For overlap extension of PCR, equimolar amounts of each fragment (F2 and F3) were mixed in the absence of additional primers. The PCR programme consisted of seven repetitive cycles and was carried out with a denaturation step (94 °C, 1 min), an annealing step (54 °C, 1 min) and an elongation step (72 °C, 1.2 min). The fusion product was subsequently amplified using F1 and R2 primers in PCR reaction as described above. For the second SOEing PCR, the product of the first SOEing PCR and F1 fragment was purified and fused together in a second PCR reaction. R2 and F3 primers contained 17- and 15-nucleotides 50 extensions complementary to the F1 and linker fragments for fusion. For overlap extension PCR, equimolar amounts of each fragment were mixed without additional primers. The PCR programme consisting of seven repetitive cycles was carried out. Then the fused product was amplified using Pf1/ Prx primers. The chimeric gene was purified and cloned into XbaI site of pJET1.2. The nucleotide sequence of the chimeric gene was verified by DNA sequencing. The
M. Kowsari et al.: Protein Engineering of Chit42
497
Fig. 1 Scheme of gene constructions. Vectors pLMRS3-chit42 and pLMRS3-chit42ChBD were constructed amplifying the signal peptide, preproregion, ChBD, linker region and mature chit42with specific primers containing strategies for cleavage. pki prom, Pyruvate kinase promoter from T. reesei; sp, signal peptide; prepro,
preproregion; ChBD-Linker, Chitin-binding domain and linker of chitinase 18–10 T. atroviride; Chit42 cDNA encoding mature protein; cbh2 term, terminator of cellobiohydrolases II from T. reesei. Numbers inside shapes show fragment sizes; Arrows indicate primers for PCR and SOEing PCR amplification
fragment was ligated to the pLMRS3 vector to create pLMRS3-chit42ChBD for expression of the chimeric gene in Trichoderma.
Transcriptomic Analysis by Quantitative Real-time RT-PCR
Transformation Procedures Protoplast preparation and transformation were carried out according to the method of Penttila¨et al. [25]. T. harzianum T8-7 MK wild type was cotransformed with chitinasecontaining plasmids pLMRS3-ChBD and pLMRS3-chit42 with the plasmid p3SR2. Plasmid p3SR2 carries the amdS gene from as Aspergillus nidulans, which codes for acetamidase as a selectable marker. Cotransformation was conducted with a 1:10 (p3SR2/pLMRS3-chit42 & pLMRS3chit42ChBD) plasmid ratio, and 200–1,000 ll aliquots of the transformed protoplasts were plated in 0.75 % selective top Agar containing 1 M sorbitol as the osmotic stabilizer. The selective medium for amdS expression was MM glucose containing 10 mM acetamide as the sole nitrogen source instead of (NH4)2 SO4 and 12.5 mM CsCl. Individual colonies were randomly chosen for amds in the selective medium and incubated at 28 °C after five days. Protoplasts were placed on a 2 % CCA selective medium. The protoplast regeneration and the development of colonies were observed on plates that were incubated at room temperature. Regenerated transformants were selected based on their growth rate on selective medium. One mycelial disc (5 mm) of each transformant was inoculated on 0.5 % CCA and PDA media and incubated at 28 °C for four days.
Chit42 transcripts were quantified by real-time quantitative RT-PCR in transformants and control strains under repressive conditions with glucose. RNA was isolated from mycelia grown for 48 h at 28 °C in MM with 20 g/l glucose. Total RNA was isolated from 100 mg of freeze-dried mycelia powder derived from single spore of selected transformants and wild type using the RNeasy Plant Mini Kit (Qiagen). The cDNA were synthesized from 1 lg of total RNA using a cDNA synthesis kit with an oligo (dT) primer. One ll of the cDNA was used in the PCR reaction with the (chiF/chiR) and (btubuF/btubuR) as specific primers. Real-time PCR was performed using an ABI system with a SYBR green master mix. All PCRs were performed in triplicate in a total volume of 10 ll for 40 cycles under the following conditions: denaturation, 95 °C, 45 s; annealing, 58 °C, 1 min; extension, 72 °C, 1 min. The number of cDNA transcripts was normalized against the expression of the housekeeping b-tubulin gene [11]. Data were expressed as 2-DDCT [20]. Chitinase Activity Chitinase activity was assayed according to the method of Boller and Mauch [4]. To test the effect of a ChBD on chitinase activity, insoluble chitin was used as a substrate. Strains were grown for 60 h in pH 6-buffered MM with 20 g/l glucose; 250 ll concentrated supernatant or cell-free
123
498
M. Kowsari et al.: Protein Engineering of Chit42
extract of each strain was incubated with insoluble chitin. Chitin (10 g/l) was resuspended in a 70 mM potassium phosphate buffer pH 6.0. Activity was assayed in continuous shaking at 30 °C for 1 h. The released N-acetyl-glucosamine (GlcNAc) was measured according to the procedures set out by Reissig et al. [25]. A unit was defined as the amount of enzyme that released 1 lmol GlcNAc per 60 min. Chitinase activity data are the average of three experiments. Specific activity was expressed in units per microgram protein. The protein content in the culture filtrates was estimated using Bradford’s method [5].
Table 2 Growth rate and chitinase activity of the Chit42 and Chit42ChBD transformants
Chit42-11
27.5 ± 0.7
1.58 ± 0.02
140 ± 0.5
Test for Antagonism
Chit42-12
33.0 ± 1.2
3.15 ± 0.07
210 ± 1.3
Chit42-14
28.5 ± 0.8
2.16 ± 0.05
160 ± 0.9
In vitro tests were conducted to evaluate the antagonistic effect of chit42 and chit42-ChBD transformants against fungal pathogens on a PDA medium using the dual culture technique [9]. One mycelial disc (5 mm) of transformants and one disc (5 mm) of test pathogen were simultaneously placed on opposite sides of a PDA Petri dish and incubated at 26 °C. Three plates (replications) were used for each transformant and test pathogen based on a completely randomized design. The plates that received only the mycelial disc of pathogens served as control. The colony interaction was assayed as the percentage of inhibition on the PDA plate after four days of incubation following the formula suggested by Sundar et al. [29]. Inhibition of growth (%) = X – Y/X 9 100 where, X = mycelial growth of pathogen in the absence of Trichoderma (control), Y = mycelial growth of pathogen in the presence of transformants. The fungal strains included R. solani, F. graminearum, F. oxysporum, S. sclerotiorum, V. dahlia, A. brassicales and B. cinerea.
Chit42-ChBD3
30.0 ± 1.0
2.95 ± 0.09
220 ± 1.8
Chit42-ChBD4
26.0 ± 0.3
2.80 ± 0.05
230 ± 1.0
Results
Isolate
Diameter (mm/48 h)
Chitinase activity (U/ml)
Control (nontransformed)
17.5 ± 0.5
0.048 ± 0.001
Specific activity (U/mg) 20 ± 0.5
Chit42-2
26.0 ± 0.6
1.59 ± 0.01
130 ± 1.2
Chit42-4
25.0 ± 0.3
1.28 ± 0.02
110 ± 0.8
Chit42-6
30.0 ± 1.0
2.41 ± 0.09
180 ± 1.2
Chti42-8
26.5 ± 0.5
1.16 ± 0.01
100 ± 0.4
Chit42-9
32.0 ± 0.4
2.60 ± 0.01
190 ± 1.4
Chit42-ChBD6
31.0 ± 0.6
3.82 ± 0.09
260 ± 2.6
Chit42-ChBD7
27.0 ± 0.7
3.08 ± 0.07
220 ± 0.7
Chit42-ChBD11 Chti42-ChBD13
31.5 ± 0.5 32.0 ± 1.1
3.57 ± 0.09 4.82 ± 0.06
250 ± 1.4 330 ± 2.7
Chit42-ChBD14
25.8 ± 0.7
1.86 ± 0.02
140 ± 1.6
Chit42-ChBD15
32.0 ± 0.5
6.20 ± 0.09
390 ± 2.9
Results and standard deviations are the average of three replicates
Stable transformants were initially selected using a selective medium containing acetamide. From among 500 transformants for each construct, 100 were selected on the basis of their ability to grow on the selective medium containing 2 % colloidal chitin (2 %CCA). The selected stable amdS transformants were found to have chitinase activity. Among these transformants, 16 fast growing colonies for each construct, designated Chit42-ChBD1 to 16 and Chit42-1 to 16, were selected for further study. The growth rate of the selected colonies was examined on a 0.5 % CCA medium for 48 h. Based on the mycelial growth, eight fast growing transformants from each group were selected for subsequent study (Table 2).
Transformation of Trichoderma harzianum by Chitinase Genes
Expression Analysis
Trichoderma harzianum was cotransformed with the plasmid p3SR2 and the pLMRS3 derivatives (pLMRS3-chit42 and pLMRS3-chit42-ChBD) as shown in Fig. 1. The chimeric chitinase was constructed by the fusion of a Chit18–10 ChBD from T. atroviride to Chit42. The prediction of the ChBD glycozylation site by NetOGlyc 3.1 server showed four glycozylation sites in the ser-rich linker which separated the catalytic domain from the binding domain. The glycozylation of linker prevented the chimeric enzyme from proteolysis which occurs mainly in this region [29]. The ChBD was added to the N-terminal of chit42 employing SOEing PCR (Fig. 1).
To test the expression of chit42 and chit42-ChBD in the selected transformants, quantitative RT-PCR was performed using real-time PCR. The cDNA was prepared from the RNA of transformants and nontransformants (as negative control) grown in MM containing 20 g/l glucose as repressive conditions for endogenous chitinase repression. Based on calculations using the 2-DDCT method and b-tubulin as an internal reference gene, differential expression folds of chit42 (ranging from 8 to 32) and chimeric chitinase (ranging from 9.2 to 45.25) were detected in transformants with the highest level of expression for Chit42-ChBD15 (Fig. 2).
123
M. Kowsari et al.: Protein Engineering of Chit42
499
Fig. 2 Quantitative RT-PCR analysis of chitinase gene in the Chit42 and Chit42-ChBD transformants. Values (2-DDCT) corresponds to relative measurement against the chit42 transcript in the control (2DDCT = 1.002). Trichoderma btubulin was used as an internal reference gene
Table 3 Antifungal inhibition (%) of selected Chit42-ChBD transformants against different phytopathogenic fungi Pathogen
Control
Chit42BD3
Chit42ChBD4
Chit42ChBD6
Chit42ChBD7
Chit42ChBD11
Chit42ChBD13
Chit42ChBD14
Chit42ChBD15
R. solani
34
100
35
100
55.5
100
100
37.8
100
F. graminearum
32.5
66.6
30
33.3
66
F. oxysporum
21
80
16
76
40
80
60
25
S. sclerotiorum
18.5
68
16
100
52
68
78.6
27.3
V. dahlia
48
A. brassicola
49.5
B. cinerea
10
86.6
52
66.6
86.6
100
65
100
50
11
50
Chitinase Activity The effect of the ChBD on the chitinase activity of Chit42 was investigated with insoluble chitin under repressive conditions in a buffered glucose medium. While the enzyme activity in the Chit42 transformants ranged from 1.16 to 3.15 U/ml, the Chit42ChBD transformants showed improved chitinase activity of 1.86–6.2 U/ml (Table 2). Overall, specific chitinase activity was highest in transformants for the chimeric chitinases. The minimum and maximum specific activity of Chit42 and Chit42ChBD was 100–210 and 140–390 U/mg, respectively (Table 2). These results indicate that the presence of a ChBD can increase specific activity. The specific chitinase activity of Chit42ChBD-15 showed the highest activity of 390 U/mg when compared to Chit42-12 (210 U/mg) (Table 2). Antifungal Activity To determine whether an increase in the transformants’ chitinase activity correlates with their antifungal activity, dual culture tests were carried out. When phytopathogenic
46.6
86.6
66.6
83.3 88 100
77.7
95.5
77.5
100
76
88
100
80
100
12.5
30
25
12
62.5
fungi and T. harzianum (wild type or transformants) were grown in the same plates, they produced a zone of lysis in the pathogenic fungal mycelia. Seven phytopathogenic fungi were inoculated individually on plates against the different chimeric transformants (Table 3). All the transformants showed varied reductions in the growth rate of these seven fungi, ranging from 11 to 100 % (Table 3). The highest rate of inhibition based on overgrow and sporulation on pathogen was observed for R. solani. The growth inhibition of R. solani by Chit42-ChBD3, 6, 11, 13 and 15 transformants was similar and 100 % compared to the nontransformant as the control (Fig. 3). No growth was detected when pieces of the overgrown area of lysed and killed R. solani mycelia were transferred to fresh medium (data not shown). Among these transformants, Chit42-ChBD15 was the best at inhibiting the growth of the seven pathogens tested (Table 3). The minimum and maximum values of mean Inhibition by Chit42ChBD transformants against the seven phytopathogenic fungi were 31.6 and 88.6 %, respectively, which were significantly different compared with those of the wild type (10–49.5 %) and Chit42 transformants (24.7–63.4 %) (Table 4). At the same time, the mean inhibition by Chit42
123
500
M. Kowsari et al.: Protein Engineering of Chit42
Fig. 3 Growth inhibition of R. solani by Chit42-ChBD transformants and the control. Each plate has T. harzianum at the top and R. solani at the bottom. Transformants: E3, Chit42-ChBD3; E4, Chit42-
ChBD4; E6, Chit42-ChBD6; E7, Chit42-ChBD7; E11, Chit42ChBD11; E13, Chit42-ChBD13; E14, Chit42-ChBD14 and E15, Chit42-ChBD15
Table 4 Comparison of antifungal (%) activity of improved Chit42-ChBD and Chit42 transformants and wild type as control Pathogen R. solani F. graminearum F. oxysporum S. sclerotiorum V. dahlia A. brassicola B. cinerea
Overexpressed (inhibition mean)
Chit42 control (fold)
Chimer (inhibition mean)
Chit42 - ChBD (fold) control
Chimer (fold) over
34 ± 0.4
61.5
1.8
78.5
2.3
1.28
32.5 ± 0.5
45.4
1.4
57.4
1.76
1.26
21 ± 0.6
46.5
2.21
58.1
2.76
1.25
18.5 ± 0.5
45.5
2.46
63.7
3.44
1.40
62
1.29
82.8
1.72
1.33
49.5 ± 0.5
63.4
1.28
88.6
1.79
1.39
10 ± 0.3
24.7
2.47
31.6
3.16
1.28
Control (inhibition mean)
48 ± 0.8
Results and standard deviations are the average of three replicates
transformants was 24.7–63.4 % (Table 4). Transformants that overexpressed the hybrid chitinases inhibited growth of all pathogens more than both the wild type and Chit42 transformants expressing the native chitinases. Transformation of T. harzianum by chit42 increased its inhibition from 1.29-fold (for V. dahliae) to 2.47-fold (for S. sclerotiorum) when compared with the nontransformant (Table 4), while transformation by Chit42-ChBD increased the inhibition from 1.72-fold (for V. dahliae) to 3.44-fold (for S. sclerotiorum), indicating the positive effect of the ChBD on biocontrol activity.
Discussion Chitinases of T. harzianum are believed to play an important role in antifungal activity. Among these enzymes chit42 has been shown to be responsible for most of the
123
chitinase activity [7, 10, 18]. This enzyme does not contain a chitin-binding domain (ChBD) to bind to insoluble chitin such as fungal cell walls. Therefore, in this study, transformants of T. harzianum that overexpressed chimeric chitinases with a ChBD were obtained, and to improve fungal strains, the overexpression of hydrolases has usually been achieved using strong, but regulated promoters that need an inducer for expression. This is not the optimal situation for controlling plant disease [10, 17, 22, 32]. In this research, a constitutive promoter was used for chitinase overexpression, without using any specific inducer. Many over-produced hydrolases underwent proteolysis when they were overexpressed in Trichoderma. The Chit42 and Chit42RChBD transformants were grown in buffered media to prevent the proteolysis of overexpressed chitinases by acidic proteases [8]. Furthermore, the predicted glycozylation at the linker region of the binding domain could protect the chimeric chitinase against proteolysis.
M. Kowsari et al.: Protein Engineering of Chit42
501
Table 5 Comparison of overexpressed and chimer transformants based on 2-DDCT and chitinase activities Control
Overexpressed
Chimer
Chimer over (fold)
2-DDCT (mean)
1.00
17.53
23.35
1.33
Chitinase activity (U/ml) (mean)
0.048
1.99
3.64
1.83
Specific activity (U/mg) (mean)
20
150
260
1.7
Protection of the linker region by glycozylation has been demonstrated by Alfthan et al. [1] and Limon et al. [18]. Significant differences were observed between the chitinase activity of Chit42 and chimer transformants against insoluble chitin. The variations in observed enzyme activity among the Chit42 or ChBD-Chit42 transformants (Table 2) might be related to the copy number of the transgene and/or their position in the genome. The effect of these two parameters could mainly be normalized when the means of data from two kinds of transformants were compared. The means of extracellular chitinase activity produced by the Chit42 and Chit42-ChBD transformants were 1.99 and 3.64 U/ml, respectively (Table 5). The improved chitinase containing a chitin-binding domain showed higher chitinase activity than Chit42 (about 1.83fold) when grown in a glucose medium for repressing endogenous chitinases. This result showed an increase of about 83 % in chimer chitinase activity over expressed Chit42 (Table 5). Moreover, the mean of the specific activities of Chit42 was 150 U/mg, whereas that of Chit42ChBD was 260 U/mg, which shows a 1.7-fold increase. This increase (70 %) suggests that the ChBD may be helping the enzyme to bind better to the insoluble chitin, therefore, increasing enzyme activity (Table 5), while the difference between the transcript levels demonstrates a 33 % increase of ChBD-Chit42 mRNA over that of Chit42 when analysed by real-time PCR which emphasizes the role of the ChBD (Table 5). Limon et al. added a ChBD from Nicotiana tabacum to Chit42 and observed an approximately 36 % increase in the chitinase activity of the chimeric enzyme in the presence of insoluble chitin [18]. Fan et al. constructed a chimeric chitinase using the silkworm ChBD and Beauveria bassiana chitinase which showed a 5.5-fold increase in enzymatic activity in the presence of powdered chitin [9]. The effect of a ChBD on chitin binding was also described by Hashimoto et al. [14]. They showed that deletion of the ChBD from chitinase A1 greatly decreased the efficiency of chitin degradation. In this study, the transformants expressing chimeric chitinase, which is more active towards crystalline chitin, also showed higher antifungal activity than the Chit42 transformants. This seems to result from the subsite
structure in the binding cleft (ChBD) of this enzyme. This finding was also reported by Hashimoto et al. [14] who suggested that the ChBD recognizes an insoluble or crystalline chitin structure. The variation among the antifungal activity of these chitinases was observed when seven phytopathogenic fungi were tested (Table 3). This may be due to the intrinsic variability of chitin and cell wall composition which naturally exists in polymorphic forms. [3, 24, 31]. Looking at the results, we can introduce the Chit42ChBD15 as the best transformant with the highest chitinase activity (6.201 U/ml), specific activity (390 U/mg) and also an antagonistic effect. In conclusion, our data demonstrate that enzyme engineering can produce a chitinase with an improved activity capacity, which will lead to higher enzyme and antifungal activities; thus the transformants generated in this study might result in better biocontrol agents in the field. Acknowledgments We thank Prof. Dr. R. L. Mach and Prof. Dr. M. J. Hynes for kindly providing plasmids. We wish to thank Dr. M. C. Limon for her advises. This project was supported by the National Institute of Genetic Engineering and Biotechnology.
References 1. Alfthan K, Takkinen K, Sizmann D et al (1995) Properties of a single-chain antibody containing different linker peptides. Protein Eng 8:725–731 2. Arakane Y, Zhu Q, Matsumiya M, Muthukrishnan S et al (2003) Properties of catalytic, linker and chitin-binding domains of insect chitinase. Insect Biochem Mol Biol 33:631–648 3. Aranaz I, Mengı0 bar M, Harris R, Panos I, Miralles B et al (2009) Functional characterization of chitin and chitosan. Curr Chem Biol 3:203–230 4. BollerT Mauch F (1988) Colorimetric assay for chitinase. Methods Enzymol 161:430–435 5. Bradford M (1976) A rapid and sensitive method for the quantification of microgram quantities of protein utilizing the principle of protein–dye binding. Anal Biochem 72:249–254 6. Chern JT, Chao YP (2005) Chitin-binding domain based immobilization of D-hydantoinase. J Biotechnol 117:267–275 7. De la Cruz J, Hidalgo-Gallego A, Lora JM, Benı´tez T et al (1992) Isolation and characterization of three chitinases from Trichoderma harzianum. Eur J Biochem 206:859–867 8. Delgado-Jarana J, Rincon AM, Benitez T (2002) Aspartyl protease from Trichoderma harzianum CECT 2413: cloning and characterization. Microbiology 148:1305–1315 9. Fan Y, Fang W, Guo S, Pei X et al (2007) Increased insect virulence in Beauveria bassiana strains overexpressing an engineered chitinase. Appl Environ Microbiol 73:295–302 10. Garcı´a I, Lora JM, De la Cruz J, Benı´tez T et al (1994) Cloning and characterization of a chitinase (CHIT42) cDNA from the mycoparasitic fungus Trichoderma harzianum. Curr Genet 27:83–89 11. Glass NL, Donaldson G (1995) Development of primer sets designed for use with the PCR to amplify conserved genes from filamentous ascomycetes. Appl Environ Microbiol 61:1323–1330
123
502 12. Guthrie JL, Khalif S, Castle AJ (2005) An improved method for detection and quantification of chitinase activities. Can J Microbiol 51:491–495 13. Hardt M, Laine RA (2004) Mutation of active site residues in the chitin-binding domain ChBDChiA1 from chitinase A1 of Bacillus circulans alters substrate specificity: use of a green fluorescent protein binding assay. Arch Biochem Biophys 426:286–297 14. Hashimoto M, Ikegami T, Seino S, Ohuchi N et al (2000) Expression and characterization of the chitin-binding domain of chitinase A1 from Bacillus circulans WL-12. J Bacteriol 182:3045–3054 15. Kubicek CP, Herrera-Estrella A, Seidl-Seiboth V, Martinez DA, Druzhinina IS, Thon M, Zeilinger S et al (2011) Comparative genome sequence analysis underscores mycoparasitism as the ancestral life style of Trichoderma. Genome Biol 12:R40 16. Lee SB, Taylor JW (1990) Isolation of DNA from fungal mycelia and single spores. In: Innis DGM, Sninsky J, White T (eds) In: PCR protocols: a guide to methods and applications, vol 34. Academic Press, Orlando 17. Limo´n MC, Lora JM, Garcı´a I, De la Cruz J, Llobell A et al (1995) Primary structure and expression pattern of the 33 kDa chitinase gene from the mycoparasitic fungus Trichoderma harzianum. Curr Genet 28:478–483 18. Limon MC, Margolles-Clark E, Benitez T, Penttila M (2001) Addition of substrate-binding domains increases substrate-binding capacity and specific activity of a chitinase from Trichoderma harzianum. FEMS Microbiol Lett 198:57–63 19. Limon MC, Chacon MR, Mejias R, Delgado-Jarana J et al (2004) Increased antifungal and chitinase specific activities of Trichoderma harzianum CECT 2413 by addition of a cellulose binding domain. Appl Microbiol Biotechnol 64:675–685 20. Livak KJ, Schmittgen T (2001) Analysis of relative gene expression data using real-time quantitative PCR and the 2-DDCT method. Methods 25:402–408 21. Matarese F, Sarrocco S, Gruber S, Seidl SV, Vannacci G (2012) Biocontrol of Fusarium head blight: interactions between Trichoderma and mycotoxigenic Fusarium. Microbiology 158:98–106
123
M. Kowsari et al.: Protein Engineering of Chit42 22. Migheli Q, Gonza´lez-Candelas L, Dealessi L et al (1998) Transformants of Trichoderma longibrachiatum overexpressing the b-1,4-endoglucanase gene egl1 show enhanced biocontrol of Pythium ultimun on cucumber. Phytopathology 88:673–677 23. Penttila¨ M, Nevalainen H, Ra¨tto¨ M, Salminen E, Knowles J (1987) A versatile transformation system for the cellulolytic filamentous fungus Trichoderma reesei. Gene 61:155–164 24. Pillai CKS, Paul W, Chandra PS (2009) Chitin and chitosan polymers: chemistry, solubility and fiber formation. Prog Polym Sci 34:641–678 25. Reissig JL, Strominger JL, Leloir L (1955) A modified colorimetric method for the estimation of N-acetylamino sugars. J Biol Chem 217:959–966 26. Reithner B, Ibarra-Laclette E, Mach RL, Estrella H (2011) A identification of mycoparasitism-related genes in Trichoderma atroviride. Appl Environ Microbiol 77:4361–4370 27. Ryder LS, Harris BD, Soanes DM, Kershaw MJ et al (2012) Saprotrophic competitiveness and biocontrol fitness of a genetically modified strain of the plant-growth-promoting fungus Trichoderma hamatum GD12. Microbiology 158:84–97 28. Sambrook J, Russell D (2001) Molecular cloning: a laboratory manual. Cold Spring Harbor Laboratory Press, Woodburry 29. Sundar AR, Das ND, Krishnaveni D (1995) In-vitro antagonism of Trichoderma spp. against two fungal pathogens of castor. Indian J Plant Protec 23:152–155 30. Van Aalten DMF, Komander D, Synstad B, Gaseidnes S et al (2001) Structural insights into the catalytic mechanism of a family 18 exo-chitinase. PNAS 98:8979–8984 31. Van de Velde K, Kiekens P (2004) Structure analysis and degree of substitution of chitin, chitosan and dibutyrylchitin by FT-IR spectroscopy and solid state 13C NMR. Carbohydr Polym 58:409–416 32. Yanai K, Takaya N, Kojima N, Horiuchi H et al (1992) Purification of two chitinases from Rhizopus oligosporus and isolation and sequencing of the encoding genes. J Bacteriol 174:7398–7406
