Cell Mol Neurobiol (2014) 34:167–172 DOI 10.1007/s10571-013-9998-4
ORIGINAL RESEARCH
Protective Effects of Ginsenoside Rg1 Against Colistin Sulfate-Induced Neurotoxicity in PC12 Cells Guo-Zheng Jiang • Ji-Chang Li
Received: 28 September 2013 / Accepted: 15 October 2013 / Published online: 30 October 2013 Ó Springer Science+Business Media New York 2013
Abstract The present study aimed to examine the protective effect of ginsenoside Rg1 against colistin-induced neurotoxicity in cultured rat pheochromocytoma (PC12) cells. Ginsenoside Rg1 was shown to elevate cell viability, decrease levels of malondialdehyde and intracellular reactive oxygen species, enhance activity of superoxide dismutase and glutathione, and decrease the release of cytochromec, formation of DNA fragmentation in colistin-treated PC12 cells. Ginsenoside Rg1 also reversed the increased caspase-9 and -3 mRNA levels caused by colistin in PC12 cells. These results suggest that ginsenoside Rg1 exerts a neuroprotective effect on colistin-induced neurotoxicity in PC12 cells, at least in part, via the inhibition of oxidative stress, prevention of apoptosis mediated via mitochondria pathway. Coadministration of ginsenoside Rg1 highlights the potential to increase the therapeutic index of colistin. Keywords Ginsenoside Rg1 Colistin sulfate PC12 cells Oxidative stress Neuroprotection
Introduction Shortage of novel antibiotics for treating multidrug-resistant (MDR) gram-negative bacteria infections has become a severe challenge to worldwide medical field (Yousef et al. 2011). Although colistin (also known as polymyxin E) has good activity against such pathogens, it was largely abandoned in the 1970s because of its potential nephrotoxicity
and neurotoxicity (Li et al. 2005; Falagas et al. 2005). Over the last decades, colistin has been revived, and is now being used as a last-line therapy for MDR Gram-negative bacteria infections due to no other effective substitute (Falagas and Kasiakou 2006; Alhanout et al. 2010). Our recent studies suggested that colistin could induce depression, ataxia, neuronal, and axonal degeneration of brains and sciatic nerves when the mice were intravenously administrated colistin sulfate 15 mg/kg per day for 7 days (Dai et al. 2012, 2013a). Meanwhile, mitochondrial dysfunction and oxidative stress might account for the mechanism of neurotoxicity induced by colistin from our previous studies (Dai et al. 2013b; Liu et al. 2013). Differentiated rat pheochromocytoma (PC12) cells possess neuron-like characteristics in morphology and function, and have been widely used as an in vitro model in neurobiological and neurotoxicological studies (Wang et al. 2011; Da Silva et al. 2013 ). Ginsenoside Rg1 is one important active ingredient of ginseng, which showed a variety of pharmacological activities, such as immune modulation, anti-aging, anti-inflammatory, memory improvement, and anti-oxidation (Yu and Li 2000). Several studies suggest that ginsenoside Rg1 has neuroprotective effect (Zhang et al. 2000). Considering the activity of reducing neurotoxicity of ginsenoside Rg1, our study was designed to examine the toxicity of colistin on PC12 cells and evaluate the possible protective effect of ginsenoside Rg1 against colistin-induced neurotoxicity.
Materials and Methods G.-Z. Jiang J.-C. Li (&) College of Veterinary Medicine, Northeast Agricultural University, 59 Mucai Street, Xiangfang District, Harbin 150030, Heilongjiang, People’s Republic of China e-mail: [email protected]
Materials and Drugs Differentiated PC12 cells were obtained from the Pharmacology and Toxicology Lab of Northeast Agricultural
123
168
University. Colistin sulfate (20,195 U/mg), anhydrous dimethyl sulfoxide (DMSO), Trypsin, and 3-[4,5-dimethylthiazol2-yl]-2,5-diphenyl tetrazolium bromide (MTT) were obtained from Sigma-Aldrich (St. Louis, MO, USA). Dulbecco’s modified Eagle medium (DMEM) was from Hyclone (Beijing, China). LDH, MDA, SOD, and GSH assay kits were purchased from Jiancheng Institute of Biological Engineering (Nanjing, China). Reactive oxygen species assay kit was from Beyotime Institute of Biotechnology (Haimen, China). Cell Death Detection ELISAPlus kit was obtained from Roche Applied Sciences, Switzerland. Ginsenoside Rg1 (purity [98 %) was purchased from China Pharmaceutical Biological Products Analysis Institute (Beijing, China). Cell Culture and Treatment The PC 12 cells were maintained in DMEM medium supplemented with 10 % (vol/vol) FBS at 37 °C in humidified atmosphere of 95 % air and 5 % CO2. When cells were 80–90 % confluent, they were subcultured (split ratio 1:2). The experimental design contained five treatment groups: non-treated control, 125 lg/mL colistin, and 125 lg/mL colistin plus ginsenoside Rg1 (5, 10, and 20 lmol/L). According to previous study (Liu et al. 2013), PC 12 cells showed moderate toxic effect at colistin dose of 125 lg/mL. Hence, exposure of 125 lg/mL of colistin for 24 h was selected for subsequent experiments. After the cells were stabilized at 37 °C for 24 h, they were cultured in serum-free medium and incubated with corresponding drugs for another 24 h. Cell Viability Assay Cell viability was evaluated by MTT assay. The PC 12 cells were plated in 96-well plates (1.0 9 105 cells/mL) with 100 lL of medium. After 24 h of treatment, 10 lL of MTT solution (0.5 mg/mL) was added in each well, and incubated for another 4 h. The medium was removed, and 100 lL of DMSO was added in each well to dissolve the purple formazan crystals. Finally, the absorbance of each well was measured at 490 nm by a microplate reader. Cell viability was expressed as the percentage of the non-treated control, which was set to 100 %. LDH Release Assay The LDH content was measured with a LDH assay kit. After treatment, the medium was collected and centrifuged at 3,000 rpm for 10 min at 4 °C. The supernatant was used to measure LDH activity according to the manufacturer’s instructions. After reaction, the absorbance was measured by a microplate reader at 490 nm. The LDH leakages were expressed as a percentage of the non-treated control, which was set to 100 %.
123
Cell Mol Neurobiol (2014) 34:167–172
Measurement of MDA Level After treatment, cells were washed twice, then scraped from the plates into 1 mL ice-cold PBS and homogenized. After a centrifugation at 10,000 rpm for 10 min at 4 °C, supernatant was used for MDA level assay according to manufacturer’s instructions. After reaction, the absorbance was measured at 532 nm. The MDA level was expressed as a percentage of the non-treated control. Measurement of Reactive Oxygen Species (ROS) Generation Levels of intracellular ROS were measured with the oxidation-sensitive fluoroprobe 20 , 70 -dichlorofluorescin diacetate (DCFH-DA). After drug treatment, the cells were washed with PBS and incubated with DCFH-DA at final concentration of 10 lM for 30 min at 37 °C. After the cells were washed twice with PBS, the fluorescence intensity was measured by a fluorescent spectrophotometer (Thermo Scientific, USA) at an excitation wavelength of 488 nm and an emission wavelength of 525 nm. The levels of intracellular ROS were expressed as a percentage of the non-treated control, and which was set to 100 %. Measurement of SOD and GSH The activities of SOD and GSH were measured by assay kits. After treatments, cells were washed twice in ice-cold PBS and homogenized. The homogenate was centrifuged for 10 min at 10,000 rpm at 4 °C and supernatant was used for SOD and GSH activities assays according to the manufacturer’s instructions. The levels of SOD and GSH were expressed as a percentage of the non-treated control, and which was set to 100 %. Cytochrome-c Assay The PC 12 cells were washed twice with PBS after treatment. Cells were collected, fractionated, and cytosolic cytochrome-c was measured using the Quantikine M rat/ mouse cytochrome-c Enzyme-linked immunosorbent assay kit (R&D systems, Minneapolis, MN, USA) according to the manufacturer’s instructions. After reaction, the optical density was measured by a microplate reader at 490 nm. The level of cytochrome-c was expressed as a percentage of the non-treated control, which was set to 100 %. Quantification of DNA Fragmentation Quantification of DNA fragmentation was performed using Cell Death Detection ELISAPLUS kit. The PC 12 cells were washed twice with PBS after treatment. Then cells were
Cell Mol Neurobiol (2014) 34:167–172
169
incubated with 200 lL of lysis buffer for 30 min at room temperature. After a centrifugation at 1,000 rpm for 10 min at 4 °C, 20 lL of the supernatant from each group was transferred to a streptavidin-coated microplate and incubated with a mixture of anti-histone-biotin and anti-DNA-peroxidase. The amount of peroxidase retained in the immunocomplex was quantified by adding 2, 20 -azinobis (3-ethylbenzthiazoline-6-sulfonic acid) as the substrate, and absorbance of the reaction mixture was measured at 405 nm using a microplate reader. The extent of DNA fragmentation was expressed as percentage of the non-treated control, which was set to 100 %. Expression of Caspase-9 and -3 mRNA Real-time PCR was used to estimate the levels of caspase-9 and -3 mRNA. After treatment, total RNA was extracted from PC 12 cells using RNAiso Plus reagent (TaKaRa, Dalian, China) according to the manufacturer instructions. The extracted RNA was reverse-transcribed into cDNA using a PrimeScript RT reagent kit (TaKaRa, Dalian, China) for Quantitative PCR (ABI 7,300, USA) in the presence of a fluorescent dye (SYBR Green I; TaKaRa). A negative control without the RNA template was also included. The relative expression of caspase-9 and -3 mRNA was normalized to the amount of b-actin mRNA using the 2-DDC relative quantification method. The premiers are: caspase-9: Forward primer: 50 - TGTTTTGCAGGTCGCCAATG -30 ; Reverse primer: 50 -GCTTCACGGGACAGTTCTGA-30 ; caspase-3: Forward primer: 50 - TCTTTTCCGGCTGAGAGCAG -30 ; Reverse primer: 50 - CGTACAGTTTCAGCATGGCG -30 . Statistical Analysis Values were expressed as mean ± SD. Differences between groups were determined by analysis of variance using the Sigma Stat statistical software (SPSS Science, Chicago, USA). A value of p \ 0.05 was considered statistically significant.
Fig. 1 Effect of ginsenoside Rg1 on the cell viability of colistintreated PC12 cells. Values are expressed as mean ± SD (n = 5). *p \ 0.01 as compared with control group; ##p \ 0.01 as compared with colistin group
Fig. 2 Effect of ginsenoside Rg1 on the release of LDH of colistintreated PC12 cells. Values are expressed as mean ± SD (n = 5). *p \ 0.01 as compared with control group; ##p \ 0.01 as compared with colistin group
LDH Release Assay As shown in Fig. 2, treatment with 125 lg/mL colistin sulfate for 24 h significantly increased LDH release from PC12 cells by 61.4 %. Co-treatment with ginsenoside Rg1 at 5, 10, and 20 lmol/L significantly decreased colistininduced LDH release from PC12 cells by 21.0, 36.8, and 50.2 %, respectively.
Results Measurement of MDA, ROS, SOD, and GSH Levels Effect of Ginsenoside Rg1 on Colistin-Induced Cytotoxicity Colistin treatment at 125 lg/mL for 24 h caused cytotoxicity in PC12 cells, as shown by the reduction in cell viability from 100 to 68.2 % (Fig. 1). The co-treatment with 5 lmol/L ginsenoside Rg1 did not exert statistically significant effect on colistin-induced suppression of PC12 cells viability, whereas 10 and 20 lmol/L dose-dependently enhanced the cell viability to 85.6 and 90.4 %, respectively.
As shown in Fig. 3, oxidative stress was assessed by measuring MDA level, ROS level, SOD activity, and GSH activity. Exposure of PC12 cells to 125 lg/mL of colistin for 24 h significantly increased MDA and ROS level in PC12 cells by 69.5 and 34.7 %, respectively, while significantly decreased SOD and GSH activity by 27.6 and 23.4 %, respectively, suggesting that colistin induces oxidative stress. The co-treatment with different concentration of ginsenoside Rg1 (5, 10, and 20 lmol/L) significantly decreased colistin-induced MDA level by 11.9, 30.6, and
123
170
Cell Mol Neurobiol (2014) 34:167–172
Fig. 4 Effect of ginsenoside Rg1 on DNA fragmentation of colistintreated PC12 cells. Values are expressed as mean ± SD (n = 5). *p \ 0.01 as compared with control group; #p \ 0.05, ##p \ 0.01 as compared with colistin group
Fig. 5 Effect of ginsenoside Rg1 on the release of cytochrome-c in colistin-treated PC12 cells. Values are expressed as mean ± SD (n = 5). *p \ 0.01 as compared with control group; #p \ 0.05, ## p \ 0.01 as compared with colistin group
Quantification of DNA Fragmentation
Fig. 3 Effect of ginsenoside Rg1 on colistin-induced oxidative stress in PC12 cells. Oxidative stress was evaluated by measuring MDA content (a), ROS level (b), SOD activity (c), and GSH content (d). Values are expressed as mean ± SD (n = 5). *p \ 0.01 as compared with control group; #p \ 0.05, ##p \ 0.01 as compared with colistin group
44.3 %, respectively, ROS level by 8.7, 14.7, and 27.2 %, respectively. Co-treatment of ginsenoside Rg1 (5, 10, and 20 lmol/L) also significantly increased colistin-induced SOD level by 2.6, 10.7, and 14.6 %, respectively, GSH level by 4.7, 7.7, and 13.5 %, respectively.
123
As shown in Fig. 4, treatment of PC12 cells with 125 lg/mL of colistin for 24 h significantly increased DNA fragmentation by 44.4 %. The co-treatment with different concentration of ginsenoside Rg1 (5, 10, and 20 lmol/L) significantly decreased colistin-induced DNA fragmentation by 20.8, 24.6, and 32.0 %, respectively. Measurement of Cytochrome-c As shown in Fig. 5, exposure to 125 lg/mL of colistin for 24 h significantly increased the cytochrome-c release into cytoplasm by 48.1 %. Co-treatment with 5, 10, and 20 lmol/L ginsenoside Rg1 significantly decreased colistin-induced cytochrome-c level in cytoplasm of PC12 cells by 10.9, 24.3, and 31.2 %, respectively.
Cell Mol Neurobiol (2014) 34:167–172
Fig. 6 Effect of ginsenoside Rg1 on the expression of caspase-9 and -3 mRNA in colistin-treated PC12 cells. Values are expressed as mean ± SD (n = 5). *p \ 0.01 as compared with control group; ## p \ 0.01 as compared with colistin group
Levels of Caspase-9 and Caspase-3 mRNA Alterations in the expressions of the caspase-9 and caspase3 mRNA were analyzed by RT-PCR using b-actin as the control gene. As shown in Fig. 6, it was found that treatment of PC12 cell with 125 lg/mL of colistin for 24 h caused significant increase in the caspase-9 and caspase-3 mRNA levels by 99.4 and 93.3 %, respectively. While cotreatment with 5, 10, and 20 lmol/L ginsenoside Rg1 significantly decreased colistin-induced caspase-9 level by 38.9, 72.9, and 88.8 %, respectively, and caspase-3 level by 15.0, 29.7, and 65.7 %, respectively.
Discussion In the present study, we found that treating PC12 cells with colistin caused a significant decrease in the cell viability and increase in the apoptosis, confirming its neurotoxicity in PC12 cells. In this in vitro model, co-treatment with ginsenoside Rg1 dose-dependently prevented apoptotic cell death in PC12 cells induced by colistin through inhibition of oxidative stress and prevention of apoptosis mediated via mitochondria pathway.
171
Oxidative stress, defined as a disturbance in the balance between the production of ROS and antioxidant defense systems (Birben et al. 2012), may contribute to toxicity of colistin (Liu et al. 2013; Yousef et al. 2012). Excessive ROS levels are known to cause damage to major macromolecules in cells, including lipids, proteins, enzymes, and nucleic acids in cells, and they could alter neuronal function and injure nervous system (Fiers et al. 1999; Naziroglu 2009). MDA is a by-product of lipid peroxidation produced under oxidative stress. It indicates oxidative damage of plasma membrane and resultant thiobarbituric acid reactive substances, which are proportional to lipid peroxidation and oxidant stress (Xiao et al. 2008). On the other hand, cells are equipped with antioxidant defense systems including SOD and GSH to prevent damage caused by ROS (Halliwell 2001). In this study, we found that treatment of PC12 cells with 125 lg/mL of colistin caused a significant elevation of oxidative stress characterized by increase of ROS and MDA levels, and decrease in SOD and GSH activity. However, co-incubation of PC12 cells with ginsenoside Rg1 attenuated the changes mentioned earlier, this possibly because ginsenoside Rg1 enters mitochondria and stabilizes the mitochondrial redox balance. On the one hand, scavenges ROS directly, on the other hand, decreases the electron leakage of the electron transfer chain and subsequent ROS formation. Apoptosis is a vital pattern of cell death characterized by cell shrinkage, nuclear condense, DNA fragmentation, expression of apoptosis-related genes, and activation of caspase cascade (May and Madge 2007). DNA fragmentation has been considered as a biochemical hallmark for apoptosis and widely used as apoptosis index (Halliwell 2001). Our results showed that colistin could significantly (p \ 0.01) increase DNA fragmentation at 125 lg/mL, and ginsenoside Rg1 could prevent this damage. In this paper, expressions of caspase-9 and -3 mRNA responsible for apoptosis mediated mitochondria pathway were also measured. Ginsenoside Rg1 could decrease expressions of caspase-9 and -3 mRNA in PC12 cells treated by colistin. Mitochondrial cytochrome-c, an apoptosis promoting protein, was released when permeability of the mitochondrial membrane was increased (Chipuk et al. 2006). The release of cytochrome-c facilitates the formation of the apoptosome complex, leading to activation of caspase-9, subsequently activating the effector caspase-3, which execute the final stages of apoptosis (Carmody and Cotter 2001). From our study, the release of mitochondrial cytochrome-c was significantly decreased by ginsenoside Rg1 in PC12 cells treated with colistin. This contributed to decreased activation of caspase-9 and -3 with resultant inhibition of apoptosis induced by colistin. In summary, this study indicated that ginsenoside Rg1 could protect PC12 cells from injury caused by colistin.
123
172
Cell Mol Neurobiol (2014) 34:167–172
The results showed that ginsenoside Rg1 may protect PC12 cells against colistin-induced apoptosis, and this protection effect can be mediated through mitochondoria pathway, although other mechanism cannot be excluded, the neuroprotection of ginsenoside Rg1 against colistin is closely related to its antioxidant effects. Further studies are warranted to elucidate the mechanisms of colistin-induced neurotoxicity and protection by ginsenoside Rg1. The present study highlights the prospect of co-administering ginsenoside Rg1 to ameliorate colistin-induced neurotoxicity and thereby widen the therapeutic index of this important last-line antibiotic. Acknowledgments This work was supported by the National Natural Science Foundation of China (31272613), the Scientific Research Foundation of Technological Innovation for the Returned Overseas Chinese Scholars in Harbin City (2012RFLXN005), and the Scientific Research Fund of Heilongjiang Provincial Education Department (12521043). Conflict of interest of interest.
The authors declare that there are no conflicts
References Alhanout K, Malesinki S, Vidal N et al (2010) New insights into the antibacterial mechanism of action of squalamine. J Antimicrob Chemother 65:1688–1693 Birben E, Sahiner UM, Sackesen C et al (2012) Oxidative stress and antioxidant defense. World Allergy Organ J 5:9–19 Carmody RJ, Cotter TG (2001) Signaling apoptosis: a radical approach. Redox Rep 6:77–90 Chipuk JE, Bouchier-Hayes L, Green DR (2006) Mitochondrial outer membrane permeabilization during apoptosis: the innocent bystander scenario. Cell Death Differ 13:1396–1402 Da Silva MC, Mendonca LM, Venancio VD et al (2013) Coenzyme Q10 protects PC12 cells from cisplatin-induced DNA damage and neurotoxicity. Neurotoxicology 36C:10–16 Dai C, Li J, Lin W et al (2012) Electrophysiology and ultrastructural changes in mouse sciatic nerve associated with colistin sulfate exposure. Toxicol Mech Methods 22:592–596 Dai C, Li J, Li J (2013a) New insight in colistin induced neurotoxicity with the mitochondrial dysfunction in mice central nervous tissues. Exp Toxicol Pathol 6:941–948
123
Dai C, Zhang D, Li J (2013b) Effect of colistin exposure on calcium homeostasis and mitochondria functions in chick cortex neurons. Toxicol Mech Methods 23:281–288 Falagas ME, Kasiakou SK (2006) Toxicity of polymyxins: a systematic review of the evidence from old and recent studies. Crit Care 10:R27 Falagas ME, Bliziotis IA, Kasiakou SK et al (2005) Outcome of infections due to pandrug-resistant (PDR) gram-negative bacteria. BMC Infect Dis 5:24 Fiers W, Beyaert R, Declercq W et al (1999) More than one way to die: apoptosis and necrosis and reactive oxygen damage. Oncogene 18:7719–7730 Halliwell B (2001) Role of free radicals in the neurodegenerative disease: therapeutic implications for antioxidant treatment. Drugs Aging 18:685–716 Li J, Nation RL, Milne RW et al (2005) Evaluation of colistin as an agent against multi-resistant gram-negative bacteria. Int J Antimicrob Agents 25:11–25 Liu Y, Dai C, Li J, et al. (2013) Ascorbic acid protects against colistin sulfate-induced neurotoxicity in PC12 cells. Toxicol Mech Methods. doi:10.3109/15376516.2013.807532 May MJ, Madge LA (2007) Caspase inhibition sensitizes inhibitor of NF-kappa B kinase beta-deficient fibroblasts to caspase-independent cell death via the generation of reactive oxygen species. J Biol Chem 282:16105–16116 Naziroglu M (2009) Role of selenium on calcium signaling and oxidative stress-induced molecular pathways in epilepsy. Neurochem Res 34:2181–2191 Wang J, Sun P, Bao Y et al (2011) Cytotoxicity of single-walled carbon nanotubes on PC12 cells. Toxicol In Vitro 25:242–250 Xiao X, Liu J, Hu J et al (2008) Protective effects of protopine on hydrogen peroxide-induced oxidative injury of PC 12 cells via Ca2? antagonism and antioxidant mechanisms. Eur J Pharmacol 591:21–27 Yousef J, Chen G, Hill P et al (2011) Melatonin attenuates colistininduced nephrotoxicity in rats. Antimicrob Agents Chemother 9:4044–4045 Yousef J, Chen G, Hill P et al (2012) Ascorbic acid protects against the nephrotoxicity and apoptosis caused by colistin and affects its pharmacokinetics. J Antimicrob Chemother 67:452–459 Yu S, Li X (2000) Effect of ginsenoside on IL-1b and IL-6 mRNA expression in hippocampal neurons in chronic inflammation model of aged rats. Acta Pharmacol Sin 21:915–918 Zhang X, Li W, Wang Q et al (2000) Protective effects of ginsenoside Rg1, Re on cultured hippocampal and cortex neurons injury induced by b-amyloid protein. Acad J Sec Mil Med Univ 10:941–943
ORIGINAL RESEARCH
Protective Effects of Ginsenoside Rg1 Against Colistin Sulfate-Induced Neurotoxicity in PC12 Cells Guo-Zheng Jiang • Ji-Chang Li
Received: 28 September 2013 / Accepted: 15 October 2013 / Published online: 30 October 2013 Ó Springer Science+Business Media New York 2013
Abstract The present study aimed to examine the protective effect of ginsenoside Rg1 against colistin-induced neurotoxicity in cultured rat pheochromocytoma (PC12) cells. Ginsenoside Rg1 was shown to elevate cell viability, decrease levels of malondialdehyde and intracellular reactive oxygen species, enhance activity of superoxide dismutase and glutathione, and decrease the release of cytochromec, formation of DNA fragmentation in colistin-treated PC12 cells. Ginsenoside Rg1 also reversed the increased caspase-9 and -3 mRNA levels caused by colistin in PC12 cells. These results suggest that ginsenoside Rg1 exerts a neuroprotective effect on colistin-induced neurotoxicity in PC12 cells, at least in part, via the inhibition of oxidative stress, prevention of apoptosis mediated via mitochondria pathway. Coadministration of ginsenoside Rg1 highlights the potential to increase the therapeutic index of colistin. Keywords Ginsenoside Rg1 Colistin sulfate PC12 cells Oxidative stress Neuroprotection
Introduction Shortage of novel antibiotics for treating multidrug-resistant (MDR) gram-negative bacteria infections has become a severe challenge to worldwide medical field (Yousef et al. 2011). Although colistin (also known as polymyxin E) has good activity against such pathogens, it was largely abandoned in the 1970s because of its potential nephrotoxicity
and neurotoxicity (Li et al. 2005; Falagas et al. 2005). Over the last decades, colistin has been revived, and is now being used as a last-line therapy for MDR Gram-negative bacteria infections due to no other effective substitute (Falagas and Kasiakou 2006; Alhanout et al. 2010). Our recent studies suggested that colistin could induce depression, ataxia, neuronal, and axonal degeneration of brains and sciatic nerves when the mice were intravenously administrated colistin sulfate 15 mg/kg per day for 7 days (Dai et al. 2012, 2013a). Meanwhile, mitochondrial dysfunction and oxidative stress might account for the mechanism of neurotoxicity induced by colistin from our previous studies (Dai et al. 2013b; Liu et al. 2013). Differentiated rat pheochromocytoma (PC12) cells possess neuron-like characteristics in morphology and function, and have been widely used as an in vitro model in neurobiological and neurotoxicological studies (Wang et al. 2011; Da Silva et al. 2013 ). Ginsenoside Rg1 is one important active ingredient of ginseng, which showed a variety of pharmacological activities, such as immune modulation, anti-aging, anti-inflammatory, memory improvement, and anti-oxidation (Yu and Li 2000). Several studies suggest that ginsenoside Rg1 has neuroprotective effect (Zhang et al. 2000). Considering the activity of reducing neurotoxicity of ginsenoside Rg1, our study was designed to examine the toxicity of colistin on PC12 cells and evaluate the possible protective effect of ginsenoside Rg1 against colistin-induced neurotoxicity.
Materials and Methods G.-Z. Jiang J.-C. Li (&) College of Veterinary Medicine, Northeast Agricultural University, 59 Mucai Street, Xiangfang District, Harbin 150030, Heilongjiang, People’s Republic of China e-mail: [email protected]
Materials and Drugs Differentiated PC12 cells were obtained from the Pharmacology and Toxicology Lab of Northeast Agricultural
123
168
University. Colistin sulfate (20,195 U/mg), anhydrous dimethyl sulfoxide (DMSO), Trypsin, and 3-[4,5-dimethylthiazol2-yl]-2,5-diphenyl tetrazolium bromide (MTT) were obtained from Sigma-Aldrich (St. Louis, MO, USA). Dulbecco’s modified Eagle medium (DMEM) was from Hyclone (Beijing, China). LDH, MDA, SOD, and GSH assay kits were purchased from Jiancheng Institute of Biological Engineering (Nanjing, China). Reactive oxygen species assay kit was from Beyotime Institute of Biotechnology (Haimen, China). Cell Death Detection ELISAPlus kit was obtained from Roche Applied Sciences, Switzerland. Ginsenoside Rg1 (purity [98 %) was purchased from China Pharmaceutical Biological Products Analysis Institute (Beijing, China). Cell Culture and Treatment The PC 12 cells were maintained in DMEM medium supplemented with 10 % (vol/vol) FBS at 37 °C in humidified atmosphere of 95 % air and 5 % CO2. When cells were 80–90 % confluent, they were subcultured (split ratio 1:2). The experimental design contained five treatment groups: non-treated control, 125 lg/mL colistin, and 125 lg/mL colistin plus ginsenoside Rg1 (5, 10, and 20 lmol/L). According to previous study (Liu et al. 2013), PC 12 cells showed moderate toxic effect at colistin dose of 125 lg/mL. Hence, exposure of 125 lg/mL of colistin for 24 h was selected for subsequent experiments. After the cells were stabilized at 37 °C for 24 h, they were cultured in serum-free medium and incubated with corresponding drugs for another 24 h. Cell Viability Assay Cell viability was evaluated by MTT assay. The PC 12 cells were plated in 96-well plates (1.0 9 105 cells/mL) with 100 lL of medium. After 24 h of treatment, 10 lL of MTT solution (0.5 mg/mL) was added in each well, and incubated for another 4 h. The medium was removed, and 100 lL of DMSO was added in each well to dissolve the purple formazan crystals. Finally, the absorbance of each well was measured at 490 nm by a microplate reader. Cell viability was expressed as the percentage of the non-treated control, which was set to 100 %. LDH Release Assay The LDH content was measured with a LDH assay kit. After treatment, the medium was collected and centrifuged at 3,000 rpm for 10 min at 4 °C. The supernatant was used to measure LDH activity according to the manufacturer’s instructions. After reaction, the absorbance was measured by a microplate reader at 490 nm. The LDH leakages were expressed as a percentage of the non-treated control, which was set to 100 %.
123
Cell Mol Neurobiol (2014) 34:167–172
Measurement of MDA Level After treatment, cells were washed twice, then scraped from the plates into 1 mL ice-cold PBS and homogenized. After a centrifugation at 10,000 rpm for 10 min at 4 °C, supernatant was used for MDA level assay according to manufacturer’s instructions. After reaction, the absorbance was measured at 532 nm. The MDA level was expressed as a percentage of the non-treated control. Measurement of Reactive Oxygen Species (ROS) Generation Levels of intracellular ROS were measured with the oxidation-sensitive fluoroprobe 20 , 70 -dichlorofluorescin diacetate (DCFH-DA). After drug treatment, the cells were washed with PBS and incubated with DCFH-DA at final concentration of 10 lM for 30 min at 37 °C. After the cells were washed twice with PBS, the fluorescence intensity was measured by a fluorescent spectrophotometer (Thermo Scientific, USA) at an excitation wavelength of 488 nm and an emission wavelength of 525 nm. The levels of intracellular ROS were expressed as a percentage of the non-treated control, and which was set to 100 %. Measurement of SOD and GSH The activities of SOD and GSH were measured by assay kits. After treatments, cells were washed twice in ice-cold PBS and homogenized. The homogenate was centrifuged for 10 min at 10,000 rpm at 4 °C and supernatant was used for SOD and GSH activities assays according to the manufacturer’s instructions. The levels of SOD and GSH were expressed as a percentage of the non-treated control, and which was set to 100 %. Cytochrome-c Assay The PC 12 cells were washed twice with PBS after treatment. Cells were collected, fractionated, and cytosolic cytochrome-c was measured using the Quantikine M rat/ mouse cytochrome-c Enzyme-linked immunosorbent assay kit (R&D systems, Minneapolis, MN, USA) according to the manufacturer’s instructions. After reaction, the optical density was measured by a microplate reader at 490 nm. The level of cytochrome-c was expressed as a percentage of the non-treated control, which was set to 100 %. Quantification of DNA Fragmentation Quantification of DNA fragmentation was performed using Cell Death Detection ELISAPLUS kit. The PC 12 cells were washed twice with PBS after treatment. Then cells were
Cell Mol Neurobiol (2014) 34:167–172
169
incubated with 200 lL of lysis buffer for 30 min at room temperature. After a centrifugation at 1,000 rpm for 10 min at 4 °C, 20 lL of the supernatant from each group was transferred to a streptavidin-coated microplate and incubated with a mixture of anti-histone-biotin and anti-DNA-peroxidase. The amount of peroxidase retained in the immunocomplex was quantified by adding 2, 20 -azinobis (3-ethylbenzthiazoline-6-sulfonic acid) as the substrate, and absorbance of the reaction mixture was measured at 405 nm using a microplate reader. The extent of DNA fragmentation was expressed as percentage of the non-treated control, which was set to 100 %. Expression of Caspase-9 and -3 mRNA Real-time PCR was used to estimate the levels of caspase-9 and -3 mRNA. After treatment, total RNA was extracted from PC 12 cells using RNAiso Plus reagent (TaKaRa, Dalian, China) according to the manufacturer instructions. The extracted RNA was reverse-transcribed into cDNA using a PrimeScript RT reagent kit (TaKaRa, Dalian, China) for Quantitative PCR (ABI 7,300, USA) in the presence of a fluorescent dye (SYBR Green I; TaKaRa). A negative control without the RNA template was also included. The relative expression of caspase-9 and -3 mRNA was normalized to the amount of b-actin mRNA using the 2-DDC relative quantification method. The premiers are: caspase-9: Forward primer: 50 - TGTTTTGCAGGTCGCCAATG -30 ; Reverse primer: 50 -GCTTCACGGGACAGTTCTGA-30 ; caspase-3: Forward primer: 50 - TCTTTTCCGGCTGAGAGCAG -30 ; Reverse primer: 50 - CGTACAGTTTCAGCATGGCG -30 . Statistical Analysis Values were expressed as mean ± SD. Differences between groups were determined by analysis of variance using the Sigma Stat statistical software (SPSS Science, Chicago, USA). A value of p \ 0.05 was considered statistically significant.
Fig. 1 Effect of ginsenoside Rg1 on the cell viability of colistintreated PC12 cells. Values are expressed as mean ± SD (n = 5). *p \ 0.01 as compared with control group; ##p \ 0.01 as compared with colistin group
Fig. 2 Effect of ginsenoside Rg1 on the release of LDH of colistintreated PC12 cells. Values are expressed as mean ± SD (n = 5). *p \ 0.01 as compared with control group; ##p \ 0.01 as compared with colistin group
LDH Release Assay As shown in Fig. 2, treatment with 125 lg/mL colistin sulfate for 24 h significantly increased LDH release from PC12 cells by 61.4 %. Co-treatment with ginsenoside Rg1 at 5, 10, and 20 lmol/L significantly decreased colistininduced LDH release from PC12 cells by 21.0, 36.8, and 50.2 %, respectively.
Results Measurement of MDA, ROS, SOD, and GSH Levels Effect of Ginsenoside Rg1 on Colistin-Induced Cytotoxicity Colistin treatment at 125 lg/mL for 24 h caused cytotoxicity in PC12 cells, as shown by the reduction in cell viability from 100 to 68.2 % (Fig. 1). The co-treatment with 5 lmol/L ginsenoside Rg1 did not exert statistically significant effect on colistin-induced suppression of PC12 cells viability, whereas 10 and 20 lmol/L dose-dependently enhanced the cell viability to 85.6 and 90.4 %, respectively.
As shown in Fig. 3, oxidative stress was assessed by measuring MDA level, ROS level, SOD activity, and GSH activity. Exposure of PC12 cells to 125 lg/mL of colistin for 24 h significantly increased MDA and ROS level in PC12 cells by 69.5 and 34.7 %, respectively, while significantly decreased SOD and GSH activity by 27.6 and 23.4 %, respectively, suggesting that colistin induces oxidative stress. The co-treatment with different concentration of ginsenoside Rg1 (5, 10, and 20 lmol/L) significantly decreased colistin-induced MDA level by 11.9, 30.6, and
123
170
Cell Mol Neurobiol (2014) 34:167–172
Fig. 4 Effect of ginsenoside Rg1 on DNA fragmentation of colistintreated PC12 cells. Values are expressed as mean ± SD (n = 5). *p \ 0.01 as compared with control group; #p \ 0.05, ##p \ 0.01 as compared with colistin group
Fig. 5 Effect of ginsenoside Rg1 on the release of cytochrome-c in colistin-treated PC12 cells. Values are expressed as mean ± SD (n = 5). *p \ 0.01 as compared with control group; #p \ 0.05, ## p \ 0.01 as compared with colistin group
Quantification of DNA Fragmentation
Fig. 3 Effect of ginsenoside Rg1 on colistin-induced oxidative stress in PC12 cells. Oxidative stress was evaluated by measuring MDA content (a), ROS level (b), SOD activity (c), and GSH content (d). Values are expressed as mean ± SD (n = 5). *p \ 0.01 as compared with control group; #p \ 0.05, ##p \ 0.01 as compared with colistin group
44.3 %, respectively, ROS level by 8.7, 14.7, and 27.2 %, respectively. Co-treatment of ginsenoside Rg1 (5, 10, and 20 lmol/L) also significantly increased colistin-induced SOD level by 2.6, 10.7, and 14.6 %, respectively, GSH level by 4.7, 7.7, and 13.5 %, respectively.
123
As shown in Fig. 4, treatment of PC12 cells with 125 lg/mL of colistin for 24 h significantly increased DNA fragmentation by 44.4 %. The co-treatment with different concentration of ginsenoside Rg1 (5, 10, and 20 lmol/L) significantly decreased colistin-induced DNA fragmentation by 20.8, 24.6, and 32.0 %, respectively. Measurement of Cytochrome-c As shown in Fig. 5, exposure to 125 lg/mL of colistin for 24 h significantly increased the cytochrome-c release into cytoplasm by 48.1 %. Co-treatment with 5, 10, and 20 lmol/L ginsenoside Rg1 significantly decreased colistin-induced cytochrome-c level in cytoplasm of PC12 cells by 10.9, 24.3, and 31.2 %, respectively.
Cell Mol Neurobiol (2014) 34:167–172
Fig. 6 Effect of ginsenoside Rg1 on the expression of caspase-9 and -3 mRNA in colistin-treated PC12 cells. Values are expressed as mean ± SD (n = 5). *p \ 0.01 as compared with control group; ## p \ 0.01 as compared with colistin group
Levels of Caspase-9 and Caspase-3 mRNA Alterations in the expressions of the caspase-9 and caspase3 mRNA were analyzed by RT-PCR using b-actin as the control gene. As shown in Fig. 6, it was found that treatment of PC12 cell with 125 lg/mL of colistin for 24 h caused significant increase in the caspase-9 and caspase-3 mRNA levels by 99.4 and 93.3 %, respectively. While cotreatment with 5, 10, and 20 lmol/L ginsenoside Rg1 significantly decreased colistin-induced caspase-9 level by 38.9, 72.9, and 88.8 %, respectively, and caspase-3 level by 15.0, 29.7, and 65.7 %, respectively.
Discussion In the present study, we found that treating PC12 cells with colistin caused a significant decrease in the cell viability and increase in the apoptosis, confirming its neurotoxicity in PC12 cells. In this in vitro model, co-treatment with ginsenoside Rg1 dose-dependently prevented apoptotic cell death in PC12 cells induced by colistin through inhibition of oxidative stress and prevention of apoptosis mediated via mitochondria pathway.
171
Oxidative stress, defined as a disturbance in the balance between the production of ROS and antioxidant defense systems (Birben et al. 2012), may contribute to toxicity of colistin (Liu et al. 2013; Yousef et al. 2012). Excessive ROS levels are known to cause damage to major macromolecules in cells, including lipids, proteins, enzymes, and nucleic acids in cells, and they could alter neuronal function and injure nervous system (Fiers et al. 1999; Naziroglu 2009). MDA is a by-product of lipid peroxidation produced under oxidative stress. It indicates oxidative damage of plasma membrane and resultant thiobarbituric acid reactive substances, which are proportional to lipid peroxidation and oxidant stress (Xiao et al. 2008). On the other hand, cells are equipped with antioxidant defense systems including SOD and GSH to prevent damage caused by ROS (Halliwell 2001). In this study, we found that treatment of PC12 cells with 125 lg/mL of colistin caused a significant elevation of oxidative stress characterized by increase of ROS and MDA levels, and decrease in SOD and GSH activity. However, co-incubation of PC12 cells with ginsenoside Rg1 attenuated the changes mentioned earlier, this possibly because ginsenoside Rg1 enters mitochondria and stabilizes the mitochondrial redox balance. On the one hand, scavenges ROS directly, on the other hand, decreases the electron leakage of the electron transfer chain and subsequent ROS formation. Apoptosis is a vital pattern of cell death characterized by cell shrinkage, nuclear condense, DNA fragmentation, expression of apoptosis-related genes, and activation of caspase cascade (May and Madge 2007). DNA fragmentation has been considered as a biochemical hallmark for apoptosis and widely used as apoptosis index (Halliwell 2001). Our results showed that colistin could significantly (p \ 0.01) increase DNA fragmentation at 125 lg/mL, and ginsenoside Rg1 could prevent this damage. In this paper, expressions of caspase-9 and -3 mRNA responsible for apoptosis mediated mitochondria pathway were also measured. Ginsenoside Rg1 could decrease expressions of caspase-9 and -3 mRNA in PC12 cells treated by colistin. Mitochondrial cytochrome-c, an apoptosis promoting protein, was released when permeability of the mitochondrial membrane was increased (Chipuk et al. 2006). The release of cytochrome-c facilitates the formation of the apoptosome complex, leading to activation of caspase-9, subsequently activating the effector caspase-3, which execute the final stages of apoptosis (Carmody and Cotter 2001). From our study, the release of mitochondrial cytochrome-c was significantly decreased by ginsenoside Rg1 in PC12 cells treated with colistin. This contributed to decreased activation of caspase-9 and -3 with resultant inhibition of apoptosis induced by colistin. In summary, this study indicated that ginsenoside Rg1 could protect PC12 cells from injury caused by colistin.
123
172
Cell Mol Neurobiol (2014) 34:167–172
The results showed that ginsenoside Rg1 may protect PC12 cells against colistin-induced apoptosis, and this protection effect can be mediated through mitochondoria pathway, although other mechanism cannot be excluded, the neuroprotection of ginsenoside Rg1 against colistin is closely related to its antioxidant effects. Further studies are warranted to elucidate the mechanisms of colistin-induced neurotoxicity and protection by ginsenoside Rg1. The present study highlights the prospect of co-administering ginsenoside Rg1 to ameliorate colistin-induced neurotoxicity and thereby widen the therapeutic index of this important last-line antibiotic. Acknowledgments This work was supported by the National Natural Science Foundation of China (31272613), the Scientific Research Foundation of Technological Innovation for the Returned Overseas Chinese Scholars in Harbin City (2012RFLXN005), and the Scientific Research Fund of Heilongjiang Provincial Education Department (12521043). Conflict of interest of interest.
The authors declare that there are no conflicts
References Alhanout K, Malesinki S, Vidal N et al (2010) New insights into the antibacterial mechanism of action of squalamine. J Antimicrob Chemother 65:1688–1693 Birben E, Sahiner UM, Sackesen C et al (2012) Oxidative stress and antioxidant defense. World Allergy Organ J 5:9–19 Carmody RJ, Cotter TG (2001) Signaling apoptosis: a radical approach. Redox Rep 6:77–90 Chipuk JE, Bouchier-Hayes L, Green DR (2006) Mitochondrial outer membrane permeabilization during apoptosis: the innocent bystander scenario. Cell Death Differ 13:1396–1402 Da Silva MC, Mendonca LM, Venancio VD et al (2013) Coenzyme Q10 protects PC12 cells from cisplatin-induced DNA damage and neurotoxicity. Neurotoxicology 36C:10–16 Dai C, Li J, Lin W et al (2012) Electrophysiology and ultrastructural changes in mouse sciatic nerve associated with colistin sulfate exposure. Toxicol Mech Methods 22:592–596 Dai C, Li J, Li J (2013a) New insight in colistin induced neurotoxicity with the mitochondrial dysfunction in mice central nervous tissues. Exp Toxicol Pathol 6:941–948
123
Dai C, Zhang D, Li J (2013b) Effect of colistin exposure on calcium homeostasis and mitochondria functions in chick cortex neurons. Toxicol Mech Methods 23:281–288 Falagas ME, Kasiakou SK (2006) Toxicity of polymyxins: a systematic review of the evidence from old and recent studies. Crit Care 10:R27 Falagas ME, Bliziotis IA, Kasiakou SK et al (2005) Outcome of infections due to pandrug-resistant (PDR) gram-negative bacteria. BMC Infect Dis 5:24 Fiers W, Beyaert R, Declercq W et al (1999) More than one way to die: apoptosis and necrosis and reactive oxygen damage. Oncogene 18:7719–7730 Halliwell B (2001) Role of free radicals in the neurodegenerative disease: therapeutic implications for antioxidant treatment. Drugs Aging 18:685–716 Li J, Nation RL, Milne RW et al (2005) Evaluation of colistin as an agent against multi-resistant gram-negative bacteria. Int J Antimicrob Agents 25:11–25 Liu Y, Dai C, Li J, et al. (2013) Ascorbic acid protects against colistin sulfate-induced neurotoxicity in PC12 cells. Toxicol Mech Methods. doi:10.3109/15376516.2013.807532 May MJ, Madge LA (2007) Caspase inhibition sensitizes inhibitor of NF-kappa B kinase beta-deficient fibroblasts to caspase-independent cell death via the generation of reactive oxygen species. J Biol Chem 282:16105–16116 Naziroglu M (2009) Role of selenium on calcium signaling and oxidative stress-induced molecular pathways in epilepsy. Neurochem Res 34:2181–2191 Wang J, Sun P, Bao Y et al (2011) Cytotoxicity of single-walled carbon nanotubes on PC12 cells. Toxicol In Vitro 25:242–250 Xiao X, Liu J, Hu J et al (2008) Protective effects of protopine on hydrogen peroxide-induced oxidative injury of PC 12 cells via Ca2? antagonism and antioxidant mechanisms. Eur J Pharmacol 591:21–27 Yousef J, Chen G, Hill P et al (2011) Melatonin attenuates colistininduced nephrotoxicity in rats. Antimicrob Agents Chemother 9:4044–4045 Yousef J, Chen G, Hill P et al (2012) Ascorbic acid protects against the nephrotoxicity and apoptosis caused by colistin and affects its pharmacokinetics. J Antimicrob Chemother 67:452–459 Yu S, Li X (2000) Effect of ginsenoside on IL-1b and IL-6 mRNA expression in hippocampal neurons in chronic inflammation model of aged rats. Acta Pharmacol Sin 21:915–918 Zhang X, Li W, Wang Q et al (2000) Protective effects of ginsenoside Rg1, Re on cultured hippocampal and cortex neurons injury induced by b-amyloid protein. Acad J Sec Mil Med Univ 10:941–943
