Cell Biochem Biophys DOI 10.1007/s12013-014-0233-9
ORIGINAL PAPER
Protective Effect of sRAGE on Fetal Development in Pregnant Rats with Gestational Diabetes Mellitus Xuwen Tang • Qingxin Qin • Xiaobin Xie Ping He
•
Ó Springer Science+Business Media New York 2014
Abstract To investigate the protective effect of secretory receptor for advanced glycation endproducts (sRAGE) on the fetal development using rat model of gestational diabetes mellitus (GDM). The model of pregnant rats with intrauterine hyperglycemia was established by intraperitoneal injection of 25 mg/kg streptozotocin (STZ). Rats with established GDM were randomly grouped, and the pregnant rats in the experimental group were subsequently injected with recombinant sRAGE protein (5 mg/kg, in 0.2 mL PBS) at tail vein every 24 h, while the rats in control group were injected with the same dosage of albumin solution. Blood glucose, serum levels of advanced glycation endproducts (AGEs), and levels of RAGE protein in brain and heart tissues of pregnant rats were measured at 3, 13, and 19 days postconception. At 19 days fetuses were delivered by cesarean section, number of fetuses, their weight and placental weights were recorded, and fetal malformations and defects were analyzed visually and pathologically. The expression level of RAGE, NOX2, MCP-1, p65, VCAM-1, and VEGF mRNA in placenta was evaluated by real-time PCR. p65 protein localization was detected by immunohistochemistry in fetal brain and heart Xuwen Tang and Qingxin Qin have contributed equally to this study. X. Tang (&) P. He Department of Obstetrics, Guangzhou Women and Children’s Medical Center, Guangzhou 510623, China e-mail: [email protected] Q. Qin Department of Endocrinology, The First People’s Municipal Hospital of Guangzhou, Guangzhou 510180, China X. Xie Department of Pathology, Guangzhou Medical University, Guangzhou 510180, China
tissue sections. We analyzed the correlation between AGEs and RAGE level and the development of fetal rats, and the protective effect of blocking AGEs–RAGE pathway on the fetal development in the rat model of GDM was investigated. (1) The concentration of blood glucose and AGEs in serum of pregnant rats with GDM was significantly higher than in control group (p \ 0.05), with strong correlation between blood glucose and levels of AGEs (r = 0.693, p \ 0.05). (2) While both the number of fetuses and placental wet weight in pregnant rat model of GDM were similar to control group, pups from GDM group exhibited higher incidence of developmental abnormalities and higher average weight (p \ 0.05). sRAGE treatment slightly but not significantly reduced the probability of the fetal developmental defects, as compared to GDM group. (3) p65, a part of the NF-kB heterodimeric complex, was localized to cell nuclei in the fetal tissues of pups delivered by GDM rats, while sRAGE treatment partially restored cytoplasmic localization of p65, similarly to control tissues. Increased incidence of fetal developmental defects observed in offsprings of pregnant rats with GDM had significant correlation with the level of AGEs in serum of pregnant rats and expression levels of RAGE protein in tissues. GDM resulted in upregulation of mRNA expression of several pro-inflammatory and ROS-inducing genes in placental tissues of pregnant rats. Elevated blood glucose, serum AGEs levels, and increased gene expression are attenuated by intravenous sRAGE treatment. sRAGE appears to reduce the activity of NF-jB in fetal tissues, thus potentially having a protective effect on fetal development. Keywords Gestational diabetes mellitus Secretory receptor for advanced glycation endproducts Protection Fetal development
123
Cell Biochem Biophys
Introduction
Materials and Methods
Gestational diabetes mellitus (GDM) is associated with a number of maternal complications as well as fetal abnormalities that primarily arise from GDM-induced placental lesions [1]. Previous studies have demonstrated that efficient maternal glycemic control of GDM could not significantly reduce neonatal morbidity from serious complications such as asphyxia, dysplasia, and preeclampsia [2]. Numerous reports substantiated that the receptor for advanced glycation endproducts (RAGE) and its ligands (mainly advanced glycation endproducts, AGEs) interact to form AGEs–RAGE signaling pathway, initiating inflammatory and oxidative stress response that play an important role in the pathophysiology of diabetes [3–5]. AGEs are modified tissue proteins that accumulate in different tissues in the body with age, especially in conditions associated with glycemic or oxidative stress. Studies show that high levels of AGEs in serum of pregnant mother can be a predictor of GDM-induced adverse perinatal outcome, and may be used as a screening indicator of GDM-associated birth defects [6, 7]. RAGE belongs to the immunoglobulin superfamily of cell surface receptors. Carboxyl-terminally truncated or endogenous secretory RAGE (esRAGE) is a decoy receptor that possesses V-type immunoglobulin fragment, binding AGEs ligand but lacks transmembrane domain [8]. Therefore, the interaction of esRAGE and AGE cannot activate the cells. esRAGE is secreted and competitively binds AGEs before they reach a cellular RAGE, potentially protecting the cells from physiological and pathological effects mediated by AGEs [8]. Proteolytic cleavage of the membrane-bound form of RAGE by the sheddase, ADAM10, produces a soluble receptor. Both extracellular RAGE forms, esRAGE and sRAGE, can competitively bind circulating AGEs, attenuating AGEs–RAGE signaling, and protecting effector cells from the adverse effects of overactive AGEs–RAGE [9, 10]. The use of sRAGE may be a promising direction in developing new strategies of GDM treatment, and there is a great need in evaluating the protective effect of soluble RAGE on fetal development affected by maternal GDM. In this study, we used a rat model of GDM to further investigate molecular mechanisms of AGEs– RAGE signaling and their role in GDM-induced abnormal embryogenesis. We treated pregnant GDM rats with recombinant sRAGE and analyzed the changes in AGEs– RAGE signaling as well as developmental defects in newborn animals to determine the clinical value of the treatment of GDM with sRAGE.
Establishment of Rat Model for GDM
123
50 healthy 10-week-old female Wistar rats, weighing 180–250 g at 10 weeks of age, and 15 adult male Wistar rats (300–350 g) were provided by the Experimental Animal Center of Guangzhou Medical College. All experiment using animals were performed in accordance with protocols approved by the Medical Ethics Committee of Guangzhou Medical College. The weight of the female rats was maintained at 250–300 g at 12 weeks. Fasting animals with intravenous blood glucose levels higher than 6.7 mmol/L were excluded from the experiment. Male and female rats were allowed to mate, and the female rats lacking pessary next day were considered pregnant for 0.5 days. The resulting 30 pregnant rats were injected intravenously (tail vein) with 25 mg/kg streptozotocin (STZ) to induce GDM. 6 untreated pregnant rats were used as a control group. Methods Reagents All chemicals were purchased from Sigma (St. Louis, CA, USA) unless specified otherwise. Evaluation of Fetal Development in Rat Model of GDM Following STZ injection, blood glucose, serum levels of AGEs, and RAGE levels in brain and heart tissues of pregnant rats were measured at 3, 13 and 19 days. Serum AGEs and RAGE levels were detected by commercially available ELISA kits (Bio-Engineering Co., Ltd., Wuhan gorgeous). Blood glucose was assayed using custom glucose meter (Abbot, Netherlands). Cesarean section was performed at 19 days, placenta and fetuses were removed. The number and weights of fetuses, and placenta weight were recorded. Malformations and defects of each system organ in fetal rats were evaluated visually and pathologically. Serum AGEs was detected by AGE ELISA kit (BioEngineering Co., Ltd., Wuhan gorgeous). Real-Time PCR Total RNA was extracted from placentas, fetal brain and heart tissues by Trizol reagent (Life technologies, Carlsbad, CA, USA), and first-strand cDNA was synthesized using Promega RT kit and oligo (DT) 18 primers (Promega, Madison, WI, USA). Expression levels of RAGE,
Cell Biochem Biophys
Nox2, MCP-1, VCAM-1, p65, and VEGF were analyzed by real-time PCR using the following primers: RAGE Forward: 50 CCTGAGACGGGACTCTTCACG CTTCGG 30 ; RAGE reverse: 50 CTCCTCGTCCTCCTGGCTTTCTG GGGC 30 VCAM-1 Forward: 50 -GAAGCCGGTCATGGTCAA GT-30 VCAM-1 Reverse: 50 -GACGGTCACCCTTGAACAG TTC-30 ; VEGF Forward: 50 -GAGAATTCGGCCCCAACCAT GAACTTTCTGCT-30 VEGF Reverse: 50 -G AGCATGCCCTCCTGCCCGGCT CACCGC-30 ; Nox2 Forward, 50 -CCCTTTGGTACAGCCAGTGAA GAT-30 ; Nox2 Reverse, 50 -CAATCCCAGCTCCCACTAACAT CA-30 MCP-1 Forward: 50 -CCCCAGTCACCTGCTGTTAT-30 ; MCP-1 Reverse: 50 -TGGAATCCTGAACCCACTTC-30 ; P65 Forward: 50 -AGCACCATCAACTATGATGAGT TTC-30 P65 Reverse: 50 -GAGTTATAGCCTCAGGGTACTC CAT-30 Beta-actin Forward: 50 -TGTGCTATGTTGCCCTAG ACTT C-30 ; beta-actin Reverse: 50 -CGGACTCATCGTA CTCCT GCT-30 . Beta-actin was used as an internal control. Relative quantification was calculated using the 2- DDCt method. Western Blot Analysis Total proteins were extracted from brain, heart and placental tissues using lysis buffer (100 mM Tris–Cl, pH 6.8, 4 % (m/ v) SDS, 20 % (v/v) glycerol, 200 mM b-mercaptoethanol, 1 mM phenylmethylsulfonyl fluoride, and 1 g/mL aprotinin). Equal amounts of proteins were resolved on polyacrylamide gel, transferred onto nitrocellulose membrane and blocked with 5 % skim milk. Protein level of RAGE protein was detected by Western blotting using anti-RAGE antibody (Abcam, Cambridge, UK) and secondary antirabbit HRP-conjugated IgG (Sigma, St. Louis, CA, USA). Immunohistochemistry Brain and heart tissues were fixed with 10 % neutral buffered formalin, embedded in paraffin, sectioned and immunostained using anti-p65 antibody (Abcam, Cambridge, UK) and DyLight-488 conjugated secondary antibody (Abcam, Cambridge, UK). Cell nuclei were stained with DAPI.
Treatment of Pregnant GDM Rats with Recombinant sRAGE After STZ administration, pregnant rats were treated with 5 mg/kg recombinant sRAGE protein (Bio-Engineering Co., Ltd., Wuhan gorgeous) in 0.2 mL PBS by injection into tail vein every 24 h. Statistical Analysis Statistical analysis was done using SPSS 18.0. The results are represented as x ± SD. Averages between the two samples were compared using t test. Multiple groups were compared using ANOVA. Logistic regression analysis was used for multivariate analysis. Linear correlation and regression analysis were used for correlation Analysis.
Results The Effect of sRAGE on Blood Glucose Levels of Pregnant GDM Rats We first measured blood glucose in pregnant rats with STZ-induced GDM that were treated with recombinant sRAGE. As can be seen from Table 1, 3 days after established pregnancy, GDM rats exhibited over 4-fold higher blood glucose levels as compared to control group (p \ 0.05). Blood glucose remained elevated throughout the pregnancy, with average levels 2.9-fold higher in pregnant GDM rats comparing to control (p \ 0.05). sRAGE injection slightly but not significantly lowered blood glucose in the GDM group. However, the average concentration of blood glucose in GDM-sRAGE group was still over 1.9-fold higher than that in control group (p \ 0.05), suggesting that recombinant sRAGE treatment can partially control blood glucose in pregnant rats with GDM but cannot reduce it to the normal levels. The Effect of sRAGE on Serum Levels of AGEs We next evaluated the ability of sRAGE to affect serum levels of AGEs in pregnant GDM rat model. The average level of AGEs in serum of pregnant rats with GDM was over 1.5-fold higher as comparing to the control group (p \ 0.05), as indicated by ELISA. sRAGE-treated pregnant GDM rats exhibited serum AGEs levels similar to untreated control group at 3, 13 and 19 days postconception, suggesting that the AGEs levels in blood circulation of pregnant GDM rats can be maintained at normal level by treating them with sRAGE (Table 2). Serum AGEs levels of GDM, GDM-sRAGE, and control groups had a significant correlation with the blood
123
Cell Biochem Biophys Table 1 Blood glucose level in pregnant rats (mmol/L) Groups
Progestation
Pregnant at 3 days
Pregnant at 13 days
Pregnant at 19 days
Average during pregnancy
Normal control
4.5 ± 0.9
5.9 ± 3.5
7.1 ± 4.2
9.8 ± 5.5
6.8 ± 3.3
GDM
4.9 ± 0.3
28.7 ± 9.7
21.2 ± 10.1
15.8 ± 6.9
19.8 ± 4.1
GDM ? sRAGE
4.7 ± 0.8
21.7 ± 8.9
19.4 ± 9.2
12.8 ± 6.7
13.5 ± 2.9
Rats with STZ-induced GDM were intravenously injected with 5 mg/kg sRAGE as described in ‘‘Materials and Methods’’ section. Blood levels of glucose were measured at 3, 13 and 19 days postconception. Data are represented as x ± SD. p \ 0.05
Table 2 Serum AGEs level of pregnant rats Groups
Progestation
Pregnant at 3 days
Pregnant at 13 days
Pregnant at 19 days
Average during pregnancy
Normal control
824 ± 31
1098 ± 42
998 ± 67
891 ± 44
942 ± 44
GDM GDM ? sRAGE
801 ± 39 798 ± 59
1579 ± 71 978 ± 58
1635 ± 98 899 ± 69
1433 ± 32 874 ± 77
1462 ± 98 912 ± 61
Rats with STZ-induced GDM were intravenously injected with 5 mg/kg sRAGE as described in ‘‘Materials and Methods’’ section. Blood levels of AGEs were measured by ELISA at 3, 13 and 19 days postconception. Data are represented as x ± SD. p \ 0.05
Table 3 Physiological and pathological parameters of offspring rats Group
Average number of offspring rats
Average weight of offspring rats (g/rat)
Wet weight of placenta (g/placenta)
Total frequency of malformations
Normal control
11.8 ± 2.2
10.6 ± 1.9
13.5 ± 2.3
2
GDM GDM ? sRAGE
10.1 ± 3.1 10.9 ± 1.9
13.2 ± 2.2 10.9 ± 1.8
15.6 ± 3.4 14.2 ± 1.9
21 12
Rats with STZ-induced GDM were intravenously injected with 5 mg/kg sRAGE as described above. Fetuses were delivered by cesarean section at 19 days postconception. Data are represented as x ± SD. p \ 0.05
glucose levels at 3 days postconception (r = 0.704, p \ 0.05), and with the average blood glucose level during pregnancy (r = 0.693, p \ 0.05). These results suggest that high blood glucose level progestation could be a factor affecting AGEs concentration in blood, while blood glucose levels postconception have little effect on the serum concentration of AGEs. Correlation Between Average Serum AGEs Level, Average Blood Glucose Level and Developmental Fetal Malformations Fetuses of pregnant rats were delivered by cesarean section at 19 days in all three experimental groups (control, GDM and sRAGE-GDM). There were no differences in the number of fetuses and wet weight of placenta between the groups (Table 3). Fetuses from the GDM group had significantly higher weights than control and sRAGE-GDM group (p \ 0.05), while there was no significant difference in the fetal weights of pups in sRAGE group as compared to control. Increased birth weight in pups delivered from GDM rats significantly correlated with the increased
123
incidence of dysplasia and birth defects. While only 2 cases of stillbirth occurred in the control group, fetuses delivered from GDM rats exhibited higher number of stillbirths (9 cases), cardiac malformations (7 cases), cerebral dysplasia(4 cases) and limb hypoplasia (1 case) (p \ 0.05). 8 cases of stillbirth, 2 cases of cardiac malformations and 2 cases of limb hypoplasia were detected in pups harvested from sRAGE-GDM animals, and the decrease in the overall frequency of fetal malformation in sRAGE-GDM group was significant when compared to control group (p \ 0.05). Histopathological examination of fetal brain and heart tissue revealed abnormal brain and heart development in most of the stillborn fetuses. The number of neurons in brain tissues of pups harvested from GDM group was significantly reduced comparing to control, and the cells exhibited abnormal morphology, with partial disruption of the cell organelle structures (data not shown). Brain tissues exhibited characteristics of gliosis, and cardiac defects in the GDM fetuses included vascular abnormalities, ventricular septal defect, and unclosed ductus arteriosus (data not shown).
Cell Biochem Biophys
Fig. 1 Related gene expression of placenta, offspring brain and heart tissues. Total RNA was extracted from placental tissue of GDM rats, GDM rats that were injected with 5 mg/kg sRAGE, or untreated
animals (control). Expression levels of RAGE, NOX2, MCP-1, EGFR, VCAM-1 and p65 were analyzed by real-time PCR. Data are represented as x ± SD. p \ 0.05
Correlation analysis showed a significant positive correlation between blood glucose level at 3 days postconception, average blood glucose level and serum AGEs level in all groups (r = 0.702 [p \ 0.05] and r = 0.811 [p \ 0.05], respectively). There also was a significant positive correlation between AGEs level and the occurrence of birth defects (r = 0.605, p \ 0.05) as indicated by the frequency of fetal dysplasia in each group. The Effect of sRAGE on the Expression Levels of Placental, Brain and Heart Genes We next evaluated the changes in the mRNA expression of RAGE, as well as the expression level of several genes, such as NOX2, proinflammatory cytokine MCP-1, EGFR, adhesion molecule VCAM-1, and p65, that are known to be affected by hyperglycemia and diabetes [11–15]. Placentas from rats in all experimental groups were collected after cesarean section, and mRNA expression levels were analyzed by real-time PCR. Pregnant GDM rats exhibited significant upregulation of mRNA expression of RAGE, NOX2, MCP-1, EGFR, VCAM-1 and p65 comparing to control group, while sRAGE injection of GDM rats resulted in expression levels similar to control (Fig. 1). These results suggest that sRAGE treatment may be able to partially reduce mRNA expression of these genes back to normal levels.
Fig. 2 Expression of RAGE protein in placenta, fetal brain and fetal heart tissues. Fetuses from GDM rats, GDM rats that were injected with 5 mg/kg sRAGE, or untreated rats (control) were harvested 19 days postgestation, and RAGE levels in the placentas, fetal brain and fetal heart tissues were analyzed by Western blot analysis
Expression of RAGE Protein in Brain and Heart Tissues of Placenta and the Offspring We next evaluated protein levels of RAGE in fetal brain, heart, and placental tissues by Western blot analysis. While control group showed low levels of RAGE in all analyzed
123
Cell Biochem Biophys Fig. 3 Distribution of p65 protein in brain tissue cells of offspring. Fetuses of GDM rats, GDM rats that were injected with 5 mg/kg sRAGE, or untreated rats (control) were harvested 19 days postgestation, and brain cells were immunostained with anti-p65 antibody. Nuclei were counterstained with DAPI
tissues, there was a substantial increase in RAGE expression in GDM group (Fig. 2). These results correlate with the increased expression of RAGE mRNA as detected by real-time PCR (Fig. 1). The expression of RAGE protein in placenta, fetal brain, and heart tissues of pups harvested from pregnant rats in sRAGE-GDM group was significantly lower than that in GDM group, but still higher than normal group (Fig. 2) Distribution of p65 Protein in Fetal Brain Tissue Cells NFkB is a ubiquitous transcription factor that regulates the inflammatory response and whose overexpression seems to be related to type 1 diabetes. Previous reports indicated that diabetes is associated with higher activity of p65, a RELassociated protein involved in NF-kB heterodimer formation, nuclear translocation and activation [16, 17]. We evaluated nuclear and cytoplasmic localization of p65 in histological sections of fetal brain tissues harvested from pups from all experimental groups by immunofluorescence. Most of the p65 localized in cell nuclei in brain tissue cells of GDM group, as opposed to cytoplasmic localization in control brain tissue (Fig. 3). Nucleal localization of p65 could be significantly decreased (but not completely prevented) by treating GDM rats with sRAGE.
123
Discussion Incidence of GDM is increasing worldwide due to recent trends in obesity and advancing maternal age [18–25]. Women with GDM are at high risk for infection as well as for pregnancy complications, such as gestational hypertension and ketoacidosis. GDM also increases the risk for adverse pregnancy outcomes including fetal abnormalities, spontaneous abortion, macrosomia, intrauterine growth restriction and stillbirth. Incidence of congenital malformations of fetal vital organs is as high as 6–10 %, a 2–5fold increase as compared to uncomplicated healthy pregnancy [18–25]. Recent studies show that the accumulation of AGEs caused by persistent hyperglycemia during pregnancy is one of the key factors that cause fetal abnormalities. In chronic hyperglycemia, excess glucose combines with free amino acids on proteins, as well as with lipids and nucleic acids in conditions of nonenzymatic glycation to form AGEs that accumulate in the tissues. This accumulation leads to a series of toxic effects, including crosslinking of collagen and other matrix proteins, increase in vascular permeability, mononuclear cell infiltration that is associated with renal and microvascular complications [2, 6, 26]. The relationship between AGEs and its full-length cell surface receptor,
Cell Biochem Biophys
RAGE, emerges as a key pathway that induces deleterious effects in cells via activation of nuclear factor kappa-B, increased oxidative stress and upregulation of inflammatory mediators [27]. In contrast to full-length RAGE, sRAGE, C-truncated variant of the RAGE receptor that lacks the transmembrane and effector domains, acts both as a scavenger for soluble AGEs and competitive inhibitor of ligands that would bind to and activate RAGE [28] Intracellular pathways induced by AGEs–RAGE include pro-inflammatory pro-atherogenic mediators, including NFkB-dependent mediators, VCAM-1, ICAM-1, IL-1a, IL6, TNF-a, E-selectin, tissue factor, endothelin-1, and RAGE itself [29–31]. In our study we detected significantly elevated expression levels of MCP-1, EGFR, VCAM-1, Nox2 and p65 in placentas of pregnant rat with STZ-induced GDM. GDM also led to increased mRNA and protein expression of RAGE. Upregulation of Nox2 expression in placentas, detected in our study correlated with the previous evidence that in addition to the NF-kB dependent pathways, binding of AGEs to RAGE also activates the NADPH oxidase pathway, that results in the increased production of reactive oxygen species (ROS) [32]. Administration of recombinant sRAGE to pregnant GDM rats used in our study was able to significantly reduce expression levels of MCP-1, VCAM-1, EGFR, p65 and NADPH oxidase, Nox2, suggesting protective antioxidant effect of sRAGE. Oxidative stress induced by AGEs– RAGE signaling pathway plays an important role in various complications of diabetes in adults, such as diabetic nephropathy, diabetic retinopathy, diabetes cardiovascular disease and diabetic neuropathy, as well as in the pathogenesis of fetal malformations [7, 19, 33, 34]. We showed that administration of sRAGE to rats with STZ-induced GDM was able to attenuate the increase in blood glucose and significantly reduce the accumulation of AGEs in the serum of pregnant rats with GDM. We also found a strong positive correlation between the levels of blood glucose and AGEs in the serum of pregnant GDM rats and the incidence of fetal abnormalities in the pups. sRAGE treatment was able to significantly reduce the total number of developmental defects in the offsprings of GDM rats. Moreover, while brain cells of fetuses delivered from GDM rats exhibited nuclear localization of NF-kB- p65, characteristic of its activated state, sRAGE treatment was able to restore cytoplasmic localization of p65, thus attenuating the damaging effect of the elevated blood glucose and AGEs levels. In conclusion, we showed in this study that in the rat model of GDM, STZ caused an elevated blood glucose and AGEs levels, which correlated with the increased incidence of developmental fetal malformations in offsprings. Elevated AGEs level also correlated with the increased expression of genes related to RAGE, inflammatory
signaling pathways and oxidative stress. Our results suggest that sRAGE treatment of GDM may lessen GDMinduced upregulation of pro-inflammatory and ROS-producing mediators, activation of NFkB pathway, and has a protective effect on fetal development.
References 1. Imam, K. (2012). Gestational diabetes mellitus. Advances in Experimental Medicine and Biology, 771, 24–34. 2. Crowther, C. A., Hiller, J. E., Moss, J. R., McPhee, A. J., Jeffries, W. S., Robinson, J. S., et al. (2005). Effect of treatment of gestational diabetes mellitus on pregnancy outcomes. New England Journal of Medicine, 352, 2477–2486. 3. Chawla, D., Bansal, S., Banerjee, B. D., Madhu, S. V., Kalra, O. P., & Tripathi, A. K. (2014). Role of advanced glycation end product (AGE)-induced receptor (RAGE) expression in diabetic vascular complications. Microvascular Research, 28(95C), 1–6. 4. Hu, H., Jiang, H., Ren, H., Hu, X., Wang, X., & Han, C. (2014). AGEs and chronic subclinical inflammation in diabetes: Disorders of immune system. Diabetes/Metabolism Research and Reviews,. doi:10.1002/dmrr.2560. 5. Yamagishi, S., & Matsui, T. (2010). Advanced glycation end products, oxidative stress and diabetic nephropathy. Oxidative Medicine and Cellular Longevity, 3(2), 101–108. 6. de Ranitz-Greven, W. L., Kaasenbrood, L., Poucki, W. K., Hamerling, J., Bos, D. C., Visser, G. H., et al. (2012). Advanced glycation end products, measured as skin autofluorescence, during normal pregnancy and pregnancy complicated by diabetes mellitus. Diabetes Technology & Therapeutics, 14, 1134–1139. 7. Mai, C., Wang, B., Wen, J., Lin, X., & Niu, J. (2014). Lipoprotein-associated phospholipase A2 and AGEs are associated with cardiovascular risk factors in women with history of gestational diabetes mellitus. Gynecological Endocrinology: The Official Journal of the International Society of Gynecological Endocrinology, 30, 241–244. 8. Kalea, A. Z., Schmidt, A. M., & Hudson, B. I. (2011). Alternative splicing of RAGE: Roles in biology and disease. Front iers in Bioscience (Landmark Ed)., 1(16), 2756–2770. 9. Goh, S. Y., & Cooper, M. E. (2008). Clinical review: The role of advanced glycation end products in progression and complications of diabetes. The Journal of Clinical Endocrinology and Metabolism, 93, 1143–1152. 10. Guosheng, L., Hongmei, S., Chuan, N., Haiying, L., Xiaopeng, Z., & Xianqiong, L. (2009). The relationship of serum AGE levels in diabetic mothers with adverse fetal outcome. Journal of Perinatology: Official Journal of the California Perinatal Association, 29, 483–488. 11. Sukumar, P., Viswambharan, H., Imrie, H., Cubbon, R. M., Yuldasheva, N., Gage, M., et al. (2013). Nox2 NADPH oxidase has a critical role in insulin resistance-related endothelial cell dysfunction. Diabetes, 62(6), 2130–2134. 12. Panee, J. (2012). Monocyte Chemoattractant Protein 1 (MCP-1) in obesity and diabetes. Cytokine, 60(1), 1–12. 13. Benter, I. F., Benboubetra, M., Hollins, A. J., Yousif, M. H., Canatan, H., & Akhtar, S. (2009). Early inhibition of EGFR signaling prevents diabetes-induced up-regulation of multiple gene pathways in the mesenteric vasculature. Vascular Pharmacology, 51(4), 236–245. 14. Gustavsson, C., Agardh, C. D., Zetterqvist, A. V., Nilsson, J., Agardh, E., & Gomez, M. F. (2010). Vascular cellular adhesion molecule-1 (VCAM-1) expression in mice retinal vessels is
123
Cell Biochem Biophys
15.
16.
17.
18.
19.
20.
21. 22. 23. 24.
25. 26.
affected by both hyperglycemia and hyperlipidemia. PLoS One, 5(9), e12699. Chen, P., Chen, J. B., Chen, W. Y., Zheng, Q. L., Wang, Y. Q., & Xu, X. J. (2012). Effects of quercetin on nuclear factor-jB p65 expression in renal ubiquitin-proteasome system of diabetic rats. Zhonghua Nei Ke Za Zhi, 51(6), 460–465. Devaraj, S., Cheung, A. T., Jialal, I., et al. (2007). Evidence of increased inflammation and microcirculatory abnormalities in patients with type 1 diabetes and their role in microvascular complications. Diabetes, 56, 2790–2796. Hofmann, M. A., Schiekofer, S., Isermann, B., et al. (1999). Peripheral blood mononuclear cells isolated from patients with diabetic nephropathy show increased activation of the oxidativestress sensitive transcription factor NF-kappaB. Diabetologia, 42, 222–232. Pedula, K. L., Hillier, T. A., Schmidt, M. M., et al. (2009). Ethnic differences in gestational oral glucose screening in a large US population. Ethnicity and Disease, 19, 414–419. Page, K. A., Romero, A., Buchanan, T. A., & Xiang, A. H. (2014). Gestational diabetes mellitus, maternal obesity, and adiposity in offspring. The Journal of Pediatrics, 164, 807–810. Buchanan, T. A., & Xiang, A. H. (2005). Gestational diabetes mellitus[J]. The Journal of Clinical Investigation, 115(3), 485–491. Kjos, S. L., & Buchanan, T. A. (1999). Gestational diabetes mellitus. New England Journal of Medicine, 341(23), 1749–1756. Jovanovic, L., & Pettitt, D. J. (2001). Gestational diabetes mellitus. JAMA, 286(20), 2516–2518. Coustan, D. R. (2013). Gestational diabetes mellitus. Clinical Chemistry, 59(9), 1310–1321. Gilmartin, A. B., Ural, S. H., & Repke, J. T. (2007). Gestational diabetes mellitus. Reviews in Obstetrics and Gynecology, 1(3), 129–134. Landon, M. B., & Gabbe, S. G. (2011). Gestational diabetes mellitus. Obstetrics and Gynecology, 118(6), 1379–1393. Wei, Y. M., & Yang, H. X. (2011). Comparison of the diagnostic criteria for gestational diabetes mellitus in China. Zhonghua fu chan ke za zhi, 46, 578–581.
123
27. Rong, L. L., Yan, S. F., Wendt, T., Hans, D., Pachydaki, S., Bucciarelli, L. G., et al. (2004). RAGE modulates peripheral nerve regeneration via recruitment of both inflammatory and axonal outgrowth pathways. FASEB, 18, 1818–1825. 28. Yonekura, H., Yamamoto, Y., Sakurai, S., Petrova, R. G., Abedin, M. J., Li, H., et al. (2003). Novel splice variants of the receptor for advanced glycation end-products expressed in human vascular endothelial cells and pericytes, and their putative roles in diabetes-induced vascular injury. Biochemical Journal, 370, 1097–1109. 29. Huttunen, H. J., Fages, C., & Rauvala, H. (1999). Receptor for advanced glycation end-products (RAGE)—Mediated neurite outgrowth and activation of NF-kB require the cytoplasmic domain of the receptor but different downstream signaling pathways. Journal of Biological Chemistry, 274, 19919–19924. 30. Yan, S. D., Schmidt, A. M., Anderson, G. M., Zhang, J., Brett, J., Zou, Y. S., et al. (1994). Enhanced cellular oxidant stress by the interaction of advanced glycation end products with their receptors/binding proteins. Journal of Biological Chemistry, 269, 9889–9897. 31. Basta, G., Lazzerini, G., Massaro, M., Simoncini, T., Tanganelli, P., Fu, C., et al. (2002). Advanced glycation end-products activate endothelium through signal-transduction receptor RAGE: A mechanism for amplification of inflammatory responses. Circulation, 105, 816–822. 32. Wautier, M. P., Chappey, O., Corda, S., Stern, D. M., Schmidt, A. M., & Wautier, J. L. (2001). Activation of NADPH oxidase by AGE links oxidant stress to altered gene expression via RAGE. The American Journal of Physiology: Endocrinology and Metabolism, 280, E685–E694. 33. Alberti, K. G. M. M., & Zimmet, P. Z. (1998). Definition, diagnosis and classification of diabetes mellitus and its complications. Part 1: Diagnosis and classification of diabetes mellitus. Provisional report of a WHO consultation. Diabetic Medicine, 15(7), 539–553. 34. Consultation, W. H. O. (1999). Definition, diagnosis and classification of diabetes mellitus and its complications. Part 1.
ORIGINAL PAPER
Protective Effect of sRAGE on Fetal Development in Pregnant Rats with Gestational Diabetes Mellitus Xuwen Tang • Qingxin Qin • Xiaobin Xie Ping He
•
Ó Springer Science+Business Media New York 2014
Abstract To investigate the protective effect of secretory receptor for advanced glycation endproducts (sRAGE) on the fetal development using rat model of gestational diabetes mellitus (GDM). The model of pregnant rats with intrauterine hyperglycemia was established by intraperitoneal injection of 25 mg/kg streptozotocin (STZ). Rats with established GDM were randomly grouped, and the pregnant rats in the experimental group were subsequently injected with recombinant sRAGE protein (5 mg/kg, in 0.2 mL PBS) at tail vein every 24 h, while the rats in control group were injected with the same dosage of albumin solution. Blood glucose, serum levels of advanced glycation endproducts (AGEs), and levels of RAGE protein in brain and heart tissues of pregnant rats were measured at 3, 13, and 19 days postconception. At 19 days fetuses were delivered by cesarean section, number of fetuses, their weight and placental weights were recorded, and fetal malformations and defects were analyzed visually and pathologically. The expression level of RAGE, NOX2, MCP-1, p65, VCAM-1, and VEGF mRNA in placenta was evaluated by real-time PCR. p65 protein localization was detected by immunohistochemistry in fetal brain and heart Xuwen Tang and Qingxin Qin have contributed equally to this study. X. Tang (&) P. He Department of Obstetrics, Guangzhou Women and Children’s Medical Center, Guangzhou 510623, China e-mail: [email protected] Q. Qin Department of Endocrinology, The First People’s Municipal Hospital of Guangzhou, Guangzhou 510180, China X. Xie Department of Pathology, Guangzhou Medical University, Guangzhou 510180, China
tissue sections. We analyzed the correlation between AGEs and RAGE level and the development of fetal rats, and the protective effect of blocking AGEs–RAGE pathway on the fetal development in the rat model of GDM was investigated. (1) The concentration of blood glucose and AGEs in serum of pregnant rats with GDM was significantly higher than in control group (p \ 0.05), with strong correlation between blood glucose and levels of AGEs (r = 0.693, p \ 0.05). (2) While both the number of fetuses and placental wet weight in pregnant rat model of GDM were similar to control group, pups from GDM group exhibited higher incidence of developmental abnormalities and higher average weight (p \ 0.05). sRAGE treatment slightly but not significantly reduced the probability of the fetal developmental defects, as compared to GDM group. (3) p65, a part of the NF-kB heterodimeric complex, was localized to cell nuclei in the fetal tissues of pups delivered by GDM rats, while sRAGE treatment partially restored cytoplasmic localization of p65, similarly to control tissues. Increased incidence of fetal developmental defects observed in offsprings of pregnant rats with GDM had significant correlation with the level of AGEs in serum of pregnant rats and expression levels of RAGE protein in tissues. GDM resulted in upregulation of mRNA expression of several pro-inflammatory and ROS-inducing genes in placental tissues of pregnant rats. Elevated blood glucose, serum AGEs levels, and increased gene expression are attenuated by intravenous sRAGE treatment. sRAGE appears to reduce the activity of NF-jB in fetal tissues, thus potentially having a protective effect on fetal development. Keywords Gestational diabetes mellitus Secretory receptor for advanced glycation endproducts Protection Fetal development
123
Cell Biochem Biophys
Introduction
Materials and Methods
Gestational diabetes mellitus (GDM) is associated with a number of maternal complications as well as fetal abnormalities that primarily arise from GDM-induced placental lesions [1]. Previous studies have demonstrated that efficient maternal glycemic control of GDM could not significantly reduce neonatal morbidity from serious complications such as asphyxia, dysplasia, and preeclampsia [2]. Numerous reports substantiated that the receptor for advanced glycation endproducts (RAGE) and its ligands (mainly advanced glycation endproducts, AGEs) interact to form AGEs–RAGE signaling pathway, initiating inflammatory and oxidative stress response that play an important role in the pathophysiology of diabetes [3–5]. AGEs are modified tissue proteins that accumulate in different tissues in the body with age, especially in conditions associated with glycemic or oxidative stress. Studies show that high levels of AGEs in serum of pregnant mother can be a predictor of GDM-induced adverse perinatal outcome, and may be used as a screening indicator of GDM-associated birth defects [6, 7]. RAGE belongs to the immunoglobulin superfamily of cell surface receptors. Carboxyl-terminally truncated or endogenous secretory RAGE (esRAGE) is a decoy receptor that possesses V-type immunoglobulin fragment, binding AGEs ligand but lacks transmembrane domain [8]. Therefore, the interaction of esRAGE and AGE cannot activate the cells. esRAGE is secreted and competitively binds AGEs before they reach a cellular RAGE, potentially protecting the cells from physiological and pathological effects mediated by AGEs [8]. Proteolytic cleavage of the membrane-bound form of RAGE by the sheddase, ADAM10, produces a soluble receptor. Both extracellular RAGE forms, esRAGE and sRAGE, can competitively bind circulating AGEs, attenuating AGEs–RAGE signaling, and protecting effector cells from the adverse effects of overactive AGEs–RAGE [9, 10]. The use of sRAGE may be a promising direction in developing new strategies of GDM treatment, and there is a great need in evaluating the protective effect of soluble RAGE on fetal development affected by maternal GDM. In this study, we used a rat model of GDM to further investigate molecular mechanisms of AGEs– RAGE signaling and their role in GDM-induced abnormal embryogenesis. We treated pregnant GDM rats with recombinant sRAGE and analyzed the changes in AGEs– RAGE signaling as well as developmental defects in newborn animals to determine the clinical value of the treatment of GDM with sRAGE.
Establishment of Rat Model for GDM
123
50 healthy 10-week-old female Wistar rats, weighing 180–250 g at 10 weeks of age, and 15 adult male Wistar rats (300–350 g) were provided by the Experimental Animal Center of Guangzhou Medical College. All experiment using animals were performed in accordance with protocols approved by the Medical Ethics Committee of Guangzhou Medical College. The weight of the female rats was maintained at 250–300 g at 12 weeks. Fasting animals with intravenous blood glucose levels higher than 6.7 mmol/L were excluded from the experiment. Male and female rats were allowed to mate, and the female rats lacking pessary next day were considered pregnant for 0.5 days. The resulting 30 pregnant rats were injected intravenously (tail vein) with 25 mg/kg streptozotocin (STZ) to induce GDM. 6 untreated pregnant rats were used as a control group. Methods Reagents All chemicals were purchased from Sigma (St. Louis, CA, USA) unless specified otherwise. Evaluation of Fetal Development in Rat Model of GDM Following STZ injection, blood glucose, serum levels of AGEs, and RAGE levels in brain and heart tissues of pregnant rats were measured at 3, 13 and 19 days. Serum AGEs and RAGE levels were detected by commercially available ELISA kits (Bio-Engineering Co., Ltd., Wuhan gorgeous). Blood glucose was assayed using custom glucose meter (Abbot, Netherlands). Cesarean section was performed at 19 days, placenta and fetuses were removed. The number and weights of fetuses, and placenta weight were recorded. Malformations and defects of each system organ in fetal rats were evaluated visually and pathologically. Serum AGEs was detected by AGE ELISA kit (BioEngineering Co., Ltd., Wuhan gorgeous). Real-Time PCR Total RNA was extracted from placentas, fetal brain and heart tissues by Trizol reagent (Life technologies, Carlsbad, CA, USA), and first-strand cDNA was synthesized using Promega RT kit and oligo (DT) 18 primers (Promega, Madison, WI, USA). Expression levels of RAGE,
Cell Biochem Biophys
Nox2, MCP-1, VCAM-1, p65, and VEGF were analyzed by real-time PCR using the following primers: RAGE Forward: 50 CCTGAGACGGGACTCTTCACG CTTCGG 30 ; RAGE reverse: 50 CTCCTCGTCCTCCTGGCTTTCTG GGGC 30 VCAM-1 Forward: 50 -GAAGCCGGTCATGGTCAA GT-30 VCAM-1 Reverse: 50 -GACGGTCACCCTTGAACAG TTC-30 ; VEGF Forward: 50 -GAGAATTCGGCCCCAACCAT GAACTTTCTGCT-30 VEGF Reverse: 50 -G AGCATGCCCTCCTGCCCGGCT CACCGC-30 ; Nox2 Forward, 50 -CCCTTTGGTACAGCCAGTGAA GAT-30 ; Nox2 Reverse, 50 -CAATCCCAGCTCCCACTAACAT CA-30 MCP-1 Forward: 50 -CCCCAGTCACCTGCTGTTAT-30 ; MCP-1 Reverse: 50 -TGGAATCCTGAACCCACTTC-30 ; P65 Forward: 50 -AGCACCATCAACTATGATGAGT TTC-30 P65 Reverse: 50 -GAGTTATAGCCTCAGGGTACTC CAT-30 Beta-actin Forward: 50 -TGTGCTATGTTGCCCTAG ACTT C-30 ; beta-actin Reverse: 50 -CGGACTCATCGTA CTCCT GCT-30 . Beta-actin was used as an internal control. Relative quantification was calculated using the 2- DDCt method. Western Blot Analysis Total proteins were extracted from brain, heart and placental tissues using lysis buffer (100 mM Tris–Cl, pH 6.8, 4 % (m/ v) SDS, 20 % (v/v) glycerol, 200 mM b-mercaptoethanol, 1 mM phenylmethylsulfonyl fluoride, and 1 g/mL aprotinin). Equal amounts of proteins were resolved on polyacrylamide gel, transferred onto nitrocellulose membrane and blocked with 5 % skim milk. Protein level of RAGE protein was detected by Western blotting using anti-RAGE antibody (Abcam, Cambridge, UK) and secondary antirabbit HRP-conjugated IgG (Sigma, St. Louis, CA, USA). Immunohistochemistry Brain and heart tissues were fixed with 10 % neutral buffered formalin, embedded in paraffin, sectioned and immunostained using anti-p65 antibody (Abcam, Cambridge, UK) and DyLight-488 conjugated secondary antibody (Abcam, Cambridge, UK). Cell nuclei were stained with DAPI.
Treatment of Pregnant GDM Rats with Recombinant sRAGE After STZ administration, pregnant rats were treated with 5 mg/kg recombinant sRAGE protein (Bio-Engineering Co., Ltd., Wuhan gorgeous) in 0.2 mL PBS by injection into tail vein every 24 h. Statistical Analysis Statistical analysis was done using SPSS 18.0. The results are represented as x ± SD. Averages between the two samples were compared using t test. Multiple groups were compared using ANOVA. Logistic regression analysis was used for multivariate analysis. Linear correlation and regression analysis were used for correlation Analysis.
Results The Effect of sRAGE on Blood Glucose Levels of Pregnant GDM Rats We first measured blood glucose in pregnant rats with STZ-induced GDM that were treated with recombinant sRAGE. As can be seen from Table 1, 3 days after established pregnancy, GDM rats exhibited over 4-fold higher blood glucose levels as compared to control group (p \ 0.05). Blood glucose remained elevated throughout the pregnancy, with average levels 2.9-fold higher in pregnant GDM rats comparing to control (p \ 0.05). sRAGE injection slightly but not significantly lowered blood glucose in the GDM group. However, the average concentration of blood glucose in GDM-sRAGE group was still over 1.9-fold higher than that in control group (p \ 0.05), suggesting that recombinant sRAGE treatment can partially control blood glucose in pregnant rats with GDM but cannot reduce it to the normal levels. The Effect of sRAGE on Serum Levels of AGEs We next evaluated the ability of sRAGE to affect serum levels of AGEs in pregnant GDM rat model. The average level of AGEs in serum of pregnant rats with GDM was over 1.5-fold higher as comparing to the control group (p \ 0.05), as indicated by ELISA. sRAGE-treated pregnant GDM rats exhibited serum AGEs levels similar to untreated control group at 3, 13 and 19 days postconception, suggesting that the AGEs levels in blood circulation of pregnant GDM rats can be maintained at normal level by treating them with sRAGE (Table 2). Serum AGEs levels of GDM, GDM-sRAGE, and control groups had a significant correlation with the blood
123
Cell Biochem Biophys Table 1 Blood glucose level in pregnant rats (mmol/L) Groups
Progestation
Pregnant at 3 days
Pregnant at 13 days
Pregnant at 19 days
Average during pregnancy
Normal control
4.5 ± 0.9
5.9 ± 3.5
7.1 ± 4.2
9.8 ± 5.5
6.8 ± 3.3
GDM
4.9 ± 0.3
28.7 ± 9.7
21.2 ± 10.1
15.8 ± 6.9
19.8 ± 4.1
GDM ? sRAGE
4.7 ± 0.8
21.7 ± 8.9
19.4 ± 9.2
12.8 ± 6.7
13.5 ± 2.9
Rats with STZ-induced GDM were intravenously injected with 5 mg/kg sRAGE as described in ‘‘Materials and Methods’’ section. Blood levels of glucose were measured at 3, 13 and 19 days postconception. Data are represented as x ± SD. p \ 0.05
Table 2 Serum AGEs level of pregnant rats Groups
Progestation
Pregnant at 3 days
Pregnant at 13 days
Pregnant at 19 days
Average during pregnancy
Normal control
824 ± 31
1098 ± 42
998 ± 67
891 ± 44
942 ± 44
GDM GDM ? sRAGE
801 ± 39 798 ± 59
1579 ± 71 978 ± 58
1635 ± 98 899 ± 69
1433 ± 32 874 ± 77
1462 ± 98 912 ± 61
Rats with STZ-induced GDM were intravenously injected with 5 mg/kg sRAGE as described in ‘‘Materials and Methods’’ section. Blood levels of AGEs were measured by ELISA at 3, 13 and 19 days postconception. Data are represented as x ± SD. p \ 0.05
Table 3 Physiological and pathological parameters of offspring rats Group
Average number of offspring rats
Average weight of offspring rats (g/rat)
Wet weight of placenta (g/placenta)
Total frequency of malformations
Normal control
11.8 ± 2.2
10.6 ± 1.9
13.5 ± 2.3
2
GDM GDM ? sRAGE
10.1 ± 3.1 10.9 ± 1.9
13.2 ± 2.2 10.9 ± 1.8
15.6 ± 3.4 14.2 ± 1.9
21 12
Rats with STZ-induced GDM were intravenously injected with 5 mg/kg sRAGE as described above. Fetuses were delivered by cesarean section at 19 days postconception. Data are represented as x ± SD. p \ 0.05
glucose levels at 3 days postconception (r = 0.704, p \ 0.05), and with the average blood glucose level during pregnancy (r = 0.693, p \ 0.05). These results suggest that high blood glucose level progestation could be a factor affecting AGEs concentration in blood, while blood glucose levels postconception have little effect on the serum concentration of AGEs. Correlation Between Average Serum AGEs Level, Average Blood Glucose Level and Developmental Fetal Malformations Fetuses of pregnant rats were delivered by cesarean section at 19 days in all three experimental groups (control, GDM and sRAGE-GDM). There were no differences in the number of fetuses and wet weight of placenta between the groups (Table 3). Fetuses from the GDM group had significantly higher weights than control and sRAGE-GDM group (p \ 0.05), while there was no significant difference in the fetal weights of pups in sRAGE group as compared to control. Increased birth weight in pups delivered from GDM rats significantly correlated with the increased
123
incidence of dysplasia and birth defects. While only 2 cases of stillbirth occurred in the control group, fetuses delivered from GDM rats exhibited higher number of stillbirths (9 cases), cardiac malformations (7 cases), cerebral dysplasia(4 cases) and limb hypoplasia (1 case) (p \ 0.05). 8 cases of stillbirth, 2 cases of cardiac malformations and 2 cases of limb hypoplasia were detected in pups harvested from sRAGE-GDM animals, and the decrease in the overall frequency of fetal malformation in sRAGE-GDM group was significant when compared to control group (p \ 0.05). Histopathological examination of fetal brain and heart tissue revealed abnormal brain and heart development in most of the stillborn fetuses. The number of neurons in brain tissues of pups harvested from GDM group was significantly reduced comparing to control, and the cells exhibited abnormal morphology, with partial disruption of the cell organelle structures (data not shown). Brain tissues exhibited characteristics of gliosis, and cardiac defects in the GDM fetuses included vascular abnormalities, ventricular septal defect, and unclosed ductus arteriosus (data not shown).
Cell Biochem Biophys
Fig. 1 Related gene expression of placenta, offspring brain and heart tissues. Total RNA was extracted from placental tissue of GDM rats, GDM rats that were injected with 5 mg/kg sRAGE, or untreated
animals (control). Expression levels of RAGE, NOX2, MCP-1, EGFR, VCAM-1 and p65 were analyzed by real-time PCR. Data are represented as x ± SD. p \ 0.05
Correlation analysis showed a significant positive correlation between blood glucose level at 3 days postconception, average blood glucose level and serum AGEs level in all groups (r = 0.702 [p \ 0.05] and r = 0.811 [p \ 0.05], respectively). There also was a significant positive correlation between AGEs level and the occurrence of birth defects (r = 0.605, p \ 0.05) as indicated by the frequency of fetal dysplasia in each group. The Effect of sRAGE on the Expression Levels of Placental, Brain and Heart Genes We next evaluated the changes in the mRNA expression of RAGE, as well as the expression level of several genes, such as NOX2, proinflammatory cytokine MCP-1, EGFR, adhesion molecule VCAM-1, and p65, that are known to be affected by hyperglycemia and diabetes [11–15]. Placentas from rats in all experimental groups were collected after cesarean section, and mRNA expression levels were analyzed by real-time PCR. Pregnant GDM rats exhibited significant upregulation of mRNA expression of RAGE, NOX2, MCP-1, EGFR, VCAM-1 and p65 comparing to control group, while sRAGE injection of GDM rats resulted in expression levels similar to control (Fig. 1). These results suggest that sRAGE treatment may be able to partially reduce mRNA expression of these genes back to normal levels.
Fig. 2 Expression of RAGE protein in placenta, fetal brain and fetal heart tissues. Fetuses from GDM rats, GDM rats that were injected with 5 mg/kg sRAGE, or untreated rats (control) were harvested 19 days postgestation, and RAGE levels in the placentas, fetal brain and fetal heart tissues were analyzed by Western blot analysis
Expression of RAGE Protein in Brain and Heart Tissues of Placenta and the Offspring We next evaluated protein levels of RAGE in fetal brain, heart, and placental tissues by Western blot analysis. While control group showed low levels of RAGE in all analyzed
123
Cell Biochem Biophys Fig. 3 Distribution of p65 protein in brain tissue cells of offspring. Fetuses of GDM rats, GDM rats that were injected with 5 mg/kg sRAGE, or untreated rats (control) were harvested 19 days postgestation, and brain cells were immunostained with anti-p65 antibody. Nuclei were counterstained with DAPI
tissues, there was a substantial increase in RAGE expression in GDM group (Fig. 2). These results correlate with the increased expression of RAGE mRNA as detected by real-time PCR (Fig. 1). The expression of RAGE protein in placenta, fetal brain, and heart tissues of pups harvested from pregnant rats in sRAGE-GDM group was significantly lower than that in GDM group, but still higher than normal group (Fig. 2) Distribution of p65 Protein in Fetal Brain Tissue Cells NFkB is a ubiquitous transcription factor that regulates the inflammatory response and whose overexpression seems to be related to type 1 diabetes. Previous reports indicated that diabetes is associated with higher activity of p65, a RELassociated protein involved in NF-kB heterodimer formation, nuclear translocation and activation [16, 17]. We evaluated nuclear and cytoplasmic localization of p65 in histological sections of fetal brain tissues harvested from pups from all experimental groups by immunofluorescence. Most of the p65 localized in cell nuclei in brain tissue cells of GDM group, as opposed to cytoplasmic localization in control brain tissue (Fig. 3). Nucleal localization of p65 could be significantly decreased (but not completely prevented) by treating GDM rats with sRAGE.
123
Discussion Incidence of GDM is increasing worldwide due to recent trends in obesity and advancing maternal age [18–25]. Women with GDM are at high risk for infection as well as for pregnancy complications, such as gestational hypertension and ketoacidosis. GDM also increases the risk for adverse pregnancy outcomes including fetal abnormalities, spontaneous abortion, macrosomia, intrauterine growth restriction and stillbirth. Incidence of congenital malformations of fetal vital organs is as high as 6–10 %, a 2–5fold increase as compared to uncomplicated healthy pregnancy [18–25]. Recent studies show that the accumulation of AGEs caused by persistent hyperglycemia during pregnancy is one of the key factors that cause fetal abnormalities. In chronic hyperglycemia, excess glucose combines with free amino acids on proteins, as well as with lipids and nucleic acids in conditions of nonenzymatic glycation to form AGEs that accumulate in the tissues. This accumulation leads to a series of toxic effects, including crosslinking of collagen and other matrix proteins, increase in vascular permeability, mononuclear cell infiltration that is associated with renal and microvascular complications [2, 6, 26]. The relationship between AGEs and its full-length cell surface receptor,
Cell Biochem Biophys
RAGE, emerges as a key pathway that induces deleterious effects in cells via activation of nuclear factor kappa-B, increased oxidative stress and upregulation of inflammatory mediators [27]. In contrast to full-length RAGE, sRAGE, C-truncated variant of the RAGE receptor that lacks the transmembrane and effector domains, acts both as a scavenger for soluble AGEs and competitive inhibitor of ligands that would bind to and activate RAGE [28] Intracellular pathways induced by AGEs–RAGE include pro-inflammatory pro-atherogenic mediators, including NFkB-dependent mediators, VCAM-1, ICAM-1, IL-1a, IL6, TNF-a, E-selectin, tissue factor, endothelin-1, and RAGE itself [29–31]. In our study we detected significantly elevated expression levels of MCP-1, EGFR, VCAM-1, Nox2 and p65 in placentas of pregnant rat with STZ-induced GDM. GDM also led to increased mRNA and protein expression of RAGE. Upregulation of Nox2 expression in placentas, detected in our study correlated with the previous evidence that in addition to the NF-kB dependent pathways, binding of AGEs to RAGE also activates the NADPH oxidase pathway, that results in the increased production of reactive oxygen species (ROS) [32]. Administration of recombinant sRAGE to pregnant GDM rats used in our study was able to significantly reduce expression levels of MCP-1, VCAM-1, EGFR, p65 and NADPH oxidase, Nox2, suggesting protective antioxidant effect of sRAGE. Oxidative stress induced by AGEs– RAGE signaling pathway plays an important role in various complications of diabetes in adults, such as diabetic nephropathy, diabetic retinopathy, diabetes cardiovascular disease and diabetic neuropathy, as well as in the pathogenesis of fetal malformations [7, 19, 33, 34]. We showed that administration of sRAGE to rats with STZ-induced GDM was able to attenuate the increase in blood glucose and significantly reduce the accumulation of AGEs in the serum of pregnant rats with GDM. We also found a strong positive correlation between the levels of blood glucose and AGEs in the serum of pregnant GDM rats and the incidence of fetal abnormalities in the pups. sRAGE treatment was able to significantly reduce the total number of developmental defects in the offsprings of GDM rats. Moreover, while brain cells of fetuses delivered from GDM rats exhibited nuclear localization of NF-kB- p65, characteristic of its activated state, sRAGE treatment was able to restore cytoplasmic localization of p65, thus attenuating the damaging effect of the elevated blood glucose and AGEs levels. In conclusion, we showed in this study that in the rat model of GDM, STZ caused an elevated blood glucose and AGEs levels, which correlated with the increased incidence of developmental fetal malformations in offsprings. Elevated AGEs level also correlated with the increased expression of genes related to RAGE, inflammatory
signaling pathways and oxidative stress. Our results suggest that sRAGE treatment of GDM may lessen GDMinduced upregulation of pro-inflammatory and ROS-producing mediators, activation of NFkB pathway, and has a protective effect on fetal development.
References 1. Imam, K. (2012). Gestational diabetes mellitus. Advances in Experimental Medicine and Biology, 771, 24–34. 2. Crowther, C. A., Hiller, J. E., Moss, J. R., McPhee, A. J., Jeffries, W. S., Robinson, J. S., et al. (2005). Effect of treatment of gestational diabetes mellitus on pregnancy outcomes. New England Journal of Medicine, 352, 2477–2486. 3. Chawla, D., Bansal, S., Banerjee, B. D., Madhu, S. V., Kalra, O. P., & Tripathi, A. K. (2014). Role of advanced glycation end product (AGE)-induced receptor (RAGE) expression in diabetic vascular complications. Microvascular Research, 28(95C), 1–6. 4. Hu, H., Jiang, H., Ren, H., Hu, X., Wang, X., & Han, C. (2014). AGEs and chronic subclinical inflammation in diabetes: Disorders of immune system. Diabetes/Metabolism Research and Reviews,. doi:10.1002/dmrr.2560. 5. Yamagishi, S., & Matsui, T. (2010). Advanced glycation end products, oxidative stress and diabetic nephropathy. Oxidative Medicine and Cellular Longevity, 3(2), 101–108. 6. de Ranitz-Greven, W. L., Kaasenbrood, L., Poucki, W. K., Hamerling, J., Bos, D. C., Visser, G. H., et al. (2012). Advanced glycation end products, measured as skin autofluorescence, during normal pregnancy and pregnancy complicated by diabetes mellitus. Diabetes Technology & Therapeutics, 14, 1134–1139. 7. Mai, C., Wang, B., Wen, J., Lin, X., & Niu, J. (2014). Lipoprotein-associated phospholipase A2 and AGEs are associated with cardiovascular risk factors in women with history of gestational diabetes mellitus. Gynecological Endocrinology: The Official Journal of the International Society of Gynecological Endocrinology, 30, 241–244. 8. Kalea, A. Z., Schmidt, A. M., & Hudson, B. I. (2011). Alternative splicing of RAGE: Roles in biology and disease. Front iers in Bioscience (Landmark Ed)., 1(16), 2756–2770. 9. Goh, S. Y., & Cooper, M. E. (2008). Clinical review: The role of advanced glycation end products in progression and complications of diabetes. The Journal of Clinical Endocrinology and Metabolism, 93, 1143–1152. 10. Guosheng, L., Hongmei, S., Chuan, N., Haiying, L., Xiaopeng, Z., & Xianqiong, L. (2009). The relationship of serum AGE levels in diabetic mothers with adverse fetal outcome. Journal of Perinatology: Official Journal of the California Perinatal Association, 29, 483–488. 11. Sukumar, P., Viswambharan, H., Imrie, H., Cubbon, R. M., Yuldasheva, N., Gage, M., et al. (2013). Nox2 NADPH oxidase has a critical role in insulin resistance-related endothelial cell dysfunction. Diabetes, 62(6), 2130–2134. 12. Panee, J. (2012). Monocyte Chemoattractant Protein 1 (MCP-1) in obesity and diabetes. Cytokine, 60(1), 1–12. 13. Benter, I. F., Benboubetra, M., Hollins, A. J., Yousif, M. H., Canatan, H., & Akhtar, S. (2009). Early inhibition of EGFR signaling prevents diabetes-induced up-regulation of multiple gene pathways in the mesenteric vasculature. Vascular Pharmacology, 51(4), 236–245. 14. Gustavsson, C., Agardh, C. D., Zetterqvist, A. V., Nilsson, J., Agardh, E., & Gomez, M. F. (2010). Vascular cellular adhesion molecule-1 (VCAM-1) expression in mice retinal vessels is
123
Cell Biochem Biophys
15.
16.
17.
18.
19.
20.
21. 22. 23. 24.
25. 26.
affected by both hyperglycemia and hyperlipidemia. PLoS One, 5(9), e12699. Chen, P., Chen, J. B., Chen, W. Y., Zheng, Q. L., Wang, Y. Q., & Xu, X. J. (2012). Effects of quercetin on nuclear factor-jB p65 expression in renal ubiquitin-proteasome system of diabetic rats. Zhonghua Nei Ke Za Zhi, 51(6), 460–465. Devaraj, S., Cheung, A. T., Jialal, I., et al. (2007). Evidence of increased inflammation and microcirculatory abnormalities in patients with type 1 diabetes and their role in microvascular complications. Diabetes, 56, 2790–2796. Hofmann, M. A., Schiekofer, S., Isermann, B., et al. (1999). Peripheral blood mononuclear cells isolated from patients with diabetic nephropathy show increased activation of the oxidativestress sensitive transcription factor NF-kappaB. Diabetologia, 42, 222–232. Pedula, K. L., Hillier, T. A., Schmidt, M. M., et al. (2009). Ethnic differences in gestational oral glucose screening in a large US population. Ethnicity and Disease, 19, 414–419. Page, K. A., Romero, A., Buchanan, T. A., & Xiang, A. H. (2014). Gestational diabetes mellitus, maternal obesity, and adiposity in offspring. The Journal of Pediatrics, 164, 807–810. Buchanan, T. A., & Xiang, A. H. (2005). Gestational diabetes mellitus[J]. The Journal of Clinical Investigation, 115(3), 485–491. Kjos, S. L., & Buchanan, T. A. (1999). Gestational diabetes mellitus. New England Journal of Medicine, 341(23), 1749–1756. Jovanovic, L., & Pettitt, D. J. (2001). Gestational diabetes mellitus. JAMA, 286(20), 2516–2518. Coustan, D. R. (2013). Gestational diabetes mellitus. Clinical Chemistry, 59(9), 1310–1321. Gilmartin, A. B., Ural, S. H., & Repke, J. T. (2007). Gestational diabetes mellitus. Reviews in Obstetrics and Gynecology, 1(3), 129–134. Landon, M. B., & Gabbe, S. G. (2011). Gestational diabetes mellitus. Obstetrics and Gynecology, 118(6), 1379–1393. Wei, Y. M., & Yang, H. X. (2011). Comparison of the diagnostic criteria for gestational diabetes mellitus in China. Zhonghua fu chan ke za zhi, 46, 578–581.
123
27. Rong, L. L., Yan, S. F., Wendt, T., Hans, D., Pachydaki, S., Bucciarelli, L. G., et al. (2004). RAGE modulates peripheral nerve regeneration via recruitment of both inflammatory and axonal outgrowth pathways. FASEB, 18, 1818–1825. 28. Yonekura, H., Yamamoto, Y., Sakurai, S., Petrova, R. G., Abedin, M. J., Li, H., et al. (2003). Novel splice variants of the receptor for advanced glycation end-products expressed in human vascular endothelial cells and pericytes, and their putative roles in diabetes-induced vascular injury. Biochemical Journal, 370, 1097–1109. 29. Huttunen, H. J., Fages, C., & Rauvala, H. (1999). Receptor for advanced glycation end-products (RAGE)—Mediated neurite outgrowth and activation of NF-kB require the cytoplasmic domain of the receptor but different downstream signaling pathways. Journal of Biological Chemistry, 274, 19919–19924. 30. Yan, S. D., Schmidt, A. M., Anderson, G. M., Zhang, J., Brett, J., Zou, Y. S., et al. (1994). Enhanced cellular oxidant stress by the interaction of advanced glycation end products with their receptors/binding proteins. Journal of Biological Chemistry, 269, 9889–9897. 31. Basta, G., Lazzerini, G., Massaro, M., Simoncini, T., Tanganelli, P., Fu, C., et al. (2002). Advanced glycation end-products activate endothelium through signal-transduction receptor RAGE: A mechanism for amplification of inflammatory responses. Circulation, 105, 816–822. 32. Wautier, M. P., Chappey, O., Corda, S., Stern, D. M., Schmidt, A. M., & Wautier, J. L. (2001). Activation of NADPH oxidase by AGE links oxidant stress to altered gene expression via RAGE. The American Journal of Physiology: Endocrinology and Metabolism, 280, E685–E694. 33. Alberti, K. G. M. M., & Zimmet, P. Z. (1998). Definition, diagnosis and classification of diabetes mellitus and its complications. Part 1: Diagnosis and classification of diabetes mellitus. Provisional report of a WHO consultation. Diabetic Medicine, 15(7), 539–553. 34. Consultation, W. H. O. (1999). Definition, diagnosis and classification of diabetes mellitus and its complications. Part 1.
