Mol Biotechnol DOI 10.1007/s12033-014-9835-0
RESEARCH
Production of Recombinant Human Growth Hormone Conjugated with a Transcytotic Peptide in Pichia pastoris for Effective Oral Protein Delivery Jun-Yeong Lee • Sang-Kee Kang • Hui-Shan Li • Chang-Yun Choi • Tae-Eun Park • Jin-Duck Bok Seung-Ho Lee • Chong-Su Cho • Yun-Jaie Choi
•
Ó Springer Science+Business Media New York 2014
Abstract Among the possible delivery routes, the oral administration of a protein is simple and achieves high patient compliance without pain. However, the low bioavailability of a protein drug in the intestine due to the physical barriers of the intestinal epithelia is the most critical problem that needs to be solved. To overcome the low bioavailability of a protein drug in the intestine, we aimed to construct a recombinant Pichia pastoris expressing a human growth hormone (hGH) fusion protein conjugated with a transcytotic peptide (TP) that was screened through peroral phage display to target goblet cells in the intestinal epithelia. The TP-conjugated hGH was successfully produced in P. pastoris in a secreted form at concentrations of up to 0.79 g/l. The function of the TPJun-Yeong Lee and Sang-Kee Kang have contributed equally to this work. J.-Y. Lee (&) H.-S. Li C.-Y. Choi T.-E. Park Y.-J. Choi (&) Department of Agricultural Biotechnology, Seoul National University, Seoul 151-921, Republic of Korea e-mail: [email protected] Y.-J. Choi e-mail: [email protected] H.-S. Li e-mail: [email protected] C.-Y. Choi e-mail: [email protected]
conjugated hGH was validated by in vitro and in vivo assays. The transcytotic function of the TP through the intestinal epithelia was verified only in the C terminus conjugated hGH, which demonstrated the induction of IGF-1 in a HepG2 cell culture assay, a higher translocation of recombinant hGH into the ileal villi after oral administration in rats and both IGF-1 induction and higher body weight gain in rats after oral administration. The present study introduces the possibility for the development of an effective oral protein delivery system in the pharmaceutical and animal industries through the introduction of an effective TP into hGH. Keywords Conjugated protein drug Human growth hormone Pichia pastoris Transcytotic peptide Oral drug
J.-D. Bok e-mail: [email protected] S.-H. Lee Department of Nano-Bioengineering, College of Life Science and Bioengineering, University of Incheon, Incheon 406-772, Republic of Korea e-mail: [email protected] C.-S. Cho Y.-J. Choi Research Institute for Agriculture and Life Science, Seoul National University, Seoul 151-921, Republic of Korea e-mail: [email protected]
T.-E. Park e-mail: [email protected] S.-K. Kang J.-D. Bok Institute of Green-Bio Science & Technology, Seoul National University, Pyeongchanggun, Gangwondo 232-916, Republic of Korea e-mail: [email protected]
123
Mol Biotechnol
Introduction With the rapid progress in the fields of molecular biology and biotechnology in recent decades, protein drugs, rather than chemical drugs, have become a subject of special interest because of their several advantages, such as low cytotoxicity, minimized side effects, selective specificity, and minimal non-specific and drug–drug interactions [1, 2]. Most of the commercially available protein drugs are delivered by traditional routes, such as intramuscular, subcutaneous, and intravenous injections, because of their poor oral bioavailability. However, oral administration is sometimes preferred to any other routes due to several advantages, such as patient compliance, easy administration, and low cost of production, but low oral bioavailability is attributed to pre-systemic enzymatic degradation and poor absorption in the intestinal tract. Therefore, several strategies, such as formulation [3–5], site-specific delivery to colon [6, 7], chemical modification [1, 8], prodrug derivatization [9, 10], cell-penetrating peptides [11], membrane transporter [12], and receptor targeting [13, 14], have been tested to enhance the oral bioavailability of protein drugs. Among them, the receptor-mediated delivery of the protein has attracted much attention due to a number of beneficial traits. The modification of a protein drug with specific ligands confers higher oral bioavailability by site-specific targeting and intracellular passage of the drug, which was normally prevented by the intestinal barrier [15, 16]. Yeast is one of the most robust industrial fermentation organisms for the expression of therapeutic proteins compared with other eukaryotic expression system [17]. Among yeasts, P. pastoris as a popular methylotrophic yeast has been used to express recombinant proteins for both basic research and industrial application due to several key reasons: it is easy to genetically manipulate and grows rapidly on inexpensive media; it expresses foreign protein at a high level; and it performs post-translational modifications during protein expression, such as disulfide bond formation, glycosylation, and proteolysis, similarly to higher eukaryotic organisms [18]. In this study, we aimed to construct recombinant P. pastoris expressing a human growth hormone (hGH) fusion protein conjugated with a transcytotic peptide (TP) that could facilitate the translocation of its partner across the intestinal epithelia by targeting goblet cells. The TP is a hydrophilic and loop-shaped C7C-type peptide ligand with the amino acid sequence CSKSSDYQC, which was identified through the in vivo phage display screening in our previous study [19]. hGH was selected as a model protein drug because it has been broadly used as a medicine to treat human diseases, such as GH deficiency syndrome and cystic fibrosis of the lung [20], and as a growth and milk production enhancer in
123
livestock [21]. P. pastoris was used as a host cell for hGH expression because it exhibits a powerful capacity to meet the required target protein production due to simple recovery and purification steps [22].
Materials and Methods Construction of Recombinant hGH Expression Vectors Expression vectors were constructed using a commercial vector, pPICZa B (Invitrogen, CA, USA), to produce three recombinant hGHs (N-TP-hGH: TP conjugated at the N terminus of hGH, C-TP-hGH: TP conjugated at the C terminus of hGH, and hGH: hGH with no fusion partner). The human growth hormone gene, hGH1 (GenBank: NM_0005156), was amplified by PCR from the hGH1 expression vector constructed in our previous study [23]. The oligonucleotide sets encoding TP and G3S-linker were chemically synthesized (The Midland Certified Reagent Company, TX, USA) and used to generate TPG3S for N-TP-hGH and G3S-TP for C-TP-hGH (Table 1). Complementarily annealed double-strand TP-G3S or G3STP was ligated with the N or C terminus of the hGH1 gene, and each fusion gene was then inserted into the pPICZa B vector between the PstI and XbaI restriction enzyme sites (Fig. 1). The nucleotide sequence of each cloned gene in the expression vector was confirmed using ABI 3700, an automatic fluorescent sequencing system (Perkin Elmer and Applied Biosystem, CA, USA). Transformation of P. pastoris and Expression of Recombinant hGHs We used the P. pastoris X-33 yeast strain as the host for recombinant protein production. The yeast transformants were cultivated in 250 ml of YPD broth (BD Biosciences, NJ, USA) containing 0.05 % Zeocin antibiotic (Invitrogen, CA, USA) at 30 °C for 48 h. The P. pastoris cells were collected by centrifugation at 4509g and 4 °C for 15 min. Recombinant hGH expression was induced in 500 ml of BMMYC (1 % yeast extract, 2 % peptone, 100 mM dibasic potassium phosphate buffer (pH 6), 1.34 % yeast nitrogen base w/o amino acids, 4 9 10-5 % biotin (pH 6.5), 0.5 % methanol and 1 % casamino acids) for 24 h with 0.05 % methanol feeding at 12 h post-culture. The supernatant was collected by centrifugation at 6509g and 4 °C for 20 min. Purification of Recombinant hGHs Hydrophobic interaction chromatography (HIC) was performed for the purification of the recombinant hGHs using
Mol Biotechnol Table 1 Synthetic oligonucleotides for generation of C-TP-G3S and N-TP-G3S Gene name
Forward primer
Reverse primer
TP-G3S
TGTTCTAAGTCTTCTGACTACCAA TGTGGTGGTGGTTCT
GAACCACCACCACATTGGTAGTCA GAAGACTTAGAACATGCA
G3S-TP
CGGTGGTGGTTCTGCTTGTTCTAACTCTT CTGACTACCAATGTGGTTGAT
CTAGATCAACCACATTGGTAGTCAGAAG ACTTAGAACAAGCAGAACCACCAC
TA, USA), at 4 °C overnight. After washing, the membrane was incubated with goat anti-rabbit secondary antibody conjugated to horseradish peroxidase (1:5,000) (Millipore, MA, USA) for 1 h, developed with the Amersham ECL prime Western blotting detection reagent (GE Healthcare, Little Chalfont, UK) and visualized using the ChemiDoc MP imaging system (Bio-Rad, CA, USA). In Vitro Functional Validation of Recombinant hGHs
Fig. 1 Construction of expression vectors for recombinant hGH, N-TP-hGH, and T-TP-hGH. a-Factor is a signal sequence for protein secretion in yeast, and G3S (three glycines and one serine) is the molecular linker between the TP and hGH
a chromatography column (diameter 25 mm, BIO-RAD, CA, USA) packed with 6 ml of butyl-resin (Toyopearl 650 M series, Tosoh Bioscience, Tokyo, Japan) and equilibrated with binding buffer containing 1.75 M sodium sulfate, 20 mM Tris–HCl, and 1 mM EDTA (pH 8.0). The culture supernatant was also adjusted to 1.75 M sodium sulfate and then loaded onto the pre-equilibrated column. After washing extensively with the binding buffer, the protein bound to the resin was eluted with an elution buffer containing 5 % glycerol, 20 mM Tris–HCl, and 1 mM EDTA (pH 8.0) at a flow rate of 2 ml/min. The purified hGHs were detected by SDS-PAGE under non-reducing conditions and quantified using the BCA assay (Thermo Scientific, MA, USA). Western Blot Analysis The protein bands from the SDS-PAGE gel were transferred to a PVDF membrane (GE Healthcare, Little Chalfont, UK). The membrane was blocked with 5 % skim milk (BD Biosciences, NJ, USA) at room temperature for 1 h and then incubated with rabbit anti-hGH polyclonal antibody (Abcam, Cambrigde, UK) or rabbit anti-TP polyclonal antibody (1:1,000), which was obtained through the systemic immunization of chemically synthesized TP peptide (ACSKSSDYQCG) into rabbits (Biosynthesis Inc.,
The human hepatoma cell line (HepG2 cells) was maintained in Gibco Opti-MEM (Life Technologies, MA, USA) supplemented with 10 % fetal bovine serum (Hyclone, Little Chalfont, UK) at 37 °C under 5 % CO2 in a humidified atmosphere, and the medium was changed twice a week. To validate the biological function of the recombinant hGHs, HepG2 cells were seeded at a density of 5 9 104 cells per well in 12-well plates, grown for 36 h, and then incubated in 2 ml of serum-free medium for an additional 6 h. After several washing steps, 2 ml of serumfree medium with 0.5 lg of recombinant hGHs or commercial hGH (R&D systems, MN, USA) was added, and the cells were incubated for 24 h. The amount of IGF-1 in the collected supernatant was determined using a human IGF-1 ELISA kit (R&D Systems, MN, USA). The cultured cells were trypsinized and counted using a hemocytometer for measurement of the cell proliferation rate. In Vivo Immunohistochemistry For in vivo assays, SD rats were used following the policy and regulations for the care and use of laboratory animals (Laboratory Animal Center, Seoul National University, Korea). The SD rats were maintained in the laboratory animal facility with a temperature of 23 ± 2 °C, a relative humidity of 50 ± 20 %, and a 12-h light/12-h dark cycle. All of the experimental protocols were reviewed and approved by the Animal Care and Use Committee at Seoul National University (SNU-130321-1). 8-week-old male SD rats starved overnight were orally administered with 0.5 ml of neutralization solution (0.4 ml of PBS and 0.1 ml of 7.5 % NaHCO3) to reduce the stomach acidity, and after 30 min, the rats were gavaged with 1 mg of recombinant hGHs dissolved in
123
Mol Biotechnol
1 ml of PBS. After allowing gastric retention of the drugs for 1 h, the animals were anesthetized by the abdominal injection of Zoletil (29 mg/kg of BW) and Rompun (4 mg/kg of BW). The extracted ileum was fixed with 4 % PFA and dehydrated with 20 % sucrose solution at 4 °C overnight. The samples were frozen with the Tissue-Tek OCT compound (Miles Laboratories Inc., IN, USA) at -70 °C for 24 h. Sections with a thickness of 14 lm were then cut and attached to gelatin-coated slide glasses. The tissue samples were incubated with blocking solution (5 % goat serum, 1 % BSA, and 0.5 % Tween20 in PBS) for 1 h and successively treated with primary rabbit polyclonal anti-hGH antibody (1:100) (Abcam, Cambridge, UK) for 2 h, TRITC-conjugated UEA-1 lectin (1:50) (Sigma, MO, USA) for 20 min, secondary Alexa 488-conjugated goat anti-rabbit antibody (1:100) for 1 h, and DAPI (1:1,000) for 5 min. The immunostained tissue samples were observed using a confocal laser scanning microscope (LSM710, Carl Zeiss, Oberkochen, Germany). In Vivo Functional Validation of Recombinant hGHs The purified recombinant hGHs were dissolved in PBS to a concentration of 1 mg/ml, and 0.5 ml of the aliquots were then orally administered to 8-week-old male SD rats according to the group assignment after the neutralization of gastric acid as described above for the in vivo functional validation of the recombinant hGHs. Blood samples (100 ll) were collected from the tail vein 1 h before and 2, 4, 6, 8, and 24 h after the oral administration of the recombinant hGHs. The serum proteins were quantified by the BCA assay, and an indirect ELISA of the extracted sera was then performed to detect the IGF-1 induction level. Each serum sample diluted in carbonate/bicarbonate buffer (50 mM Na2CO3, 50 mM NaHCO3, and pH 9.4) to a final protein concentration of 20 lg/ml was coated onto the polystyrene plate at 4 °C overnight. The antigen-coated plates were blocked with 5 % skim milk (BD Biosciences, NJ, USA) for 2 h and incubated with primary rabbit polyclonal anti-rat IGF-1 antibody (1:1,000) (Abbiotec, CA, USA) for 2 h. The plates were then incubated with secondary HRP-conjugated goat anti-rabbit antibody (1:2,000) (Millipore, MA, USA) for 1 h. Finally, the TMB substrate solution was added for 30 min, and the reaction was stopped with 50 ll of 2 M H2SO4. Three washes were performed before each step. The optical density (OD) was measured at 450 nm using a microplate reader (Infinite M200 Pro, Tecan, Zu¨rich, Switzerland). To study the effect of the recombinant hGHs on body weight gain, 0.5 mg of the hGHs dissolved in 0.5 ml of PBS were orally administered every second day for 4 weeks to 4-week-old SD rats (four animals per group,
123
101.4 ± 0.7 g) with ad libitum access to feed and water. The body weights of the SD rats were measured every week for a period of 5 weeks. Statistical Analysis The results are expressed as the means and SEM unless indicated otherwise. ANOVA and independent two-samples t test were used to assess the significance of the differences in the results. The PC OriginPro 8 software program (OriginLab Corp., MA, USA) was used for all of the statistical analyses.
Results Construction and Expression of the Recombinant hGHs in P. pastoris To confer intestinal epithelial permeability to hGHs, vectors were constructed to express hGHs fused with the TP peptide previously identified by peroral phage display screening [19]. Because peptide fusion may affect the important characteristics or functions of hGH, TP was fused to either the N or C terminus of hGH to yield recombinant N-TP-hGH and C-TP-hGH, respectively, with a G3S linker between the TP and hGH to prevent mutual interference (Fig. 1). A vector expressing hGH with no fusion partner was used as a control. The secreted recombinant hGHs were produced in BMMYC medium for 24 h with methanol induction and purified by HIC. As shown in Fig. 2a, all of the recombinant hGHs were simply recovered by a single step of chromatography as concentrated forms. In Western blot analysis, all of the purified proteins were detected by antihGH antibody as single bands. However, unexpectedly, anti-TP antibody detected only C-TP-hGH (Fig. 2b) although N-TP-hGH and C-TP-hGH showed similar molecular weight together, which were slightly higher compared with the hGH having no TP-peptide ligand (Fig. 2a). An average weight of 0.79 grams of the purified recombinant hGHs was obtained from a liter of culture media. In Vitro Functional Validation of the Recombinant hGHs The identities of the recombinant hGHs were verified through Western blot analysis using anti-hGH antibody and anti-TP antibody. All of the recombinant hGHs produced from P. pastoris were detected by the anti-hGH antibody. However, the anti-TP antibody detected only C-TP-hGH and not N-TP-hGH under non-reducing conditions
Mol Biotechnol
Fig. 2 Production and purification of recombinant hGHs. a SDSPAGE for HIC purification of hGHs. The sizes of hGH and C-TPhGH (or N-TP-hGH) are approximately 22 and 23 kDa, respectively. Lane M molecular weight markers, S culture supernatant, F sample
flowthrough, W washing fraction, E elution fraction. b Western blot analysis. Anti-hGH and anti-TP antibodies were used for the detection of the recombinant hGHs
We then conducted in vitro cell culture tests using the HepG2 cell line to assess the induction of IGF-1 by the TPconjugated recombinant hGHs compared with the commercial hGH and recombinant hGH. hGH is known to stimulate the proliferation of HepG2 cells accompanied with the production of IGF-1 [24]. As shown in Fig. 3, the IGF-1 levels were significantly increased by all of the recombinant hGHs produced from P. pastoris compared with the PBS-treated control cells. Moreover, the induction of IGF-1 and stimulation of cell proliferation achieved by the recombinant hGHs were similar to those obtained with the commercial recombinant hGH (chGH). Consequently, the recombinant hGHs exhibited for the capability to induce IGF-1 secretion and proliferation of HepG2 cells, indicating that the conjugation of the TP-peptide ligand to the N or C terminus of hGH does not affect the functions of hGH. Examination of TP Function in the Recombinant hGHs
Fig. 3 In vitro functional validation of growth hormone. HepG2 cells were used for estimation of IGF-1 induction (a) and cell proliferation (b). A total of 5 9 104 cells were seeded per well and incubated with 0.5 lg of the recombinant hGHs. The recombinant hGHs presented similar growth hormone activity compared with commercial recombinant hGH (chGH). ** P \ 0.01
(Fig. 2b). We assumed that this result may reflect a conformational difference in the TP between N-TP-hGH and C-TP-hGH based on its different position.
To confirm the transcytotic function of the TP conjugated to the recombinant hGHs at the intestinal epithelia, we traced the recombinant hGHs in the intestinal villi of rats by immunohistochemistry. One milligram of the recombinant hGHs were orally administered, and the ileum was extracted 1 h post-treatment and immunostained with antihGH antibody and anti-UAE-1 lectin. As shown in Fig. 4, higher absorption of C-TP-hGH into the lamina propria region of the ileum was observed compared with that found for N-TP-hGH and hGH itself. The results indicate that the TP ligand of C-TP-hGH is capable of translocating hGH across the intestinal epithelia. In contrast, the TP of N-TPhGH lost its targeting function likely due to a conformational change in the TP, such as inadequate disulfide bonds,
123
Mol Biotechnol
Fig. 4 Immunostained ileal villi of rats after oral administration of the recombinant hGHs. The nuclei, goblet cells and mucus layer, and recombinant hGHs were stained by DAPI (blue), UEA-1 lectin (red) and anti-hGH antibody (green), respectively. Scale bar 50 lm (Color figure online)
that occurred during protein folding when conjugated to the N terminus of hGH. In Vivo Functional Validation of the Recombinant hGHs To confirm the in vivo function of the recombinant hGHs, the level of IGF-1 induction in rats was assessed because hGH has cross-reactivity in other species, including rat, mouse, bovine, and swine [25]. After the recombinant hGHs were orally administered to the rats, their blood was sampled to monitor the serum IGF-1 level. As shown in Fig. 5a, the IGF-1 level obtained for the rats administered
123
C-TP-hGH was 1.35-fold higher than that found for the PBS-treated control 6 h after oral administration. The IGF1 level in the N-TP-hGH and hGH groups was 1.1-fold higher than the control group that only PBS was administered with no significant difference between them, which is consistent with the above-mentioned results that only TP located at the C terminus of hGH maintains its function of intestinal translocation (Fig. 4), even though N-TP-hGH was also revealed to function as a growth hormone due to its in vitro induction of IGF-1 in HepG2 cells (Fig. 3). To validate the basic fact that high IGF-1 induction, as a primary mediator of the effects of recombinant hGHs, promotes the growth performance, we measured the body
Mol Biotechnol
Fig. 5 Analysis of the in vivo function of the recombinant hGHs after oral administration in rats. a Assessment of IGF-1 induction. The IGF-1 level is expressed fold increases relative to the level obtained for the PBS group (negative control). b Body weight gain over time
weight of rats for a period of 5 weeks after the oral administration of the recombinant hGHs (Fig. 5b). As shown in figure, the rats gained approximately 36 g of body weight per week in all of the groups. In addition, the C-TP-hGH group showed approximately 10 % higher weight gain tendency compared with the PBS, hGH, and N-TP-hGH groups despite no statistical significance. Recombinant hGH or N-TP-hGH had no effect on weight gain because it resulted in body weight gains similar to those observed in the control PBS group. The results indicated that orally administered C-TP-hGH exerted a higher growth-promoting effect due to the enhanced translocation of hGH across the intestinal epithelia by the TP moiety in the C-TP-hGH. We also screened the immunogenicity of the recombinant hGHs to assess their side effects and found that anti-drug antibody was not induced during 4 weeks of treatment, suggesting the safety of the recombinant hGHs (data not shown).
Discussion The oral administration of protein drugs remains an attractive alternative for parenteral delivery despite its critical limitations, such as low bioavailability due to enzymatic degradation and poor penetration across the intestinal tract. The development of novel delivery systems that can increase the intestinal membrane permeability is essential for improving the bioavailability of protein drugs and thus increasing their acceptance for clinical applications. We previously identified a peptide ligand, designated TP, through in vivo phage display screening that could facilitate the translocation of a cargo (or fusion partner)
from the intestinal lumen to the lamina propria region across the intestinal barrier. The oral administration of the M13 bacteriophage encoding TP on its surface showed that the TP efficiently delivered and guided the translocation of the M13 bacteriophage across the intestinal epithelia by targeting goblet cells via an unknown mechanism [19]. Thus, we noted the potential of using the TP-peptide ligand for the development of an efficient oral drug delivery system. In this study, we validated the ability of using the TP peptide as a transcytotic moiety for a protein drug to enhance its absorption efficiency across the intestinal barrier. The hGH was selected as the model protein drug and was produced by P. pastoris as a recombinant protein directly fused with the TP-peptide ligand on its N or C terminus, and the functions of the resulting recombinant proteins were then assayed in vitro and in vivo. Pichia pastoris appeared to be a competent host cell for the production of the recombinant hGHs, and the production and secretion of the target proteins reached the gram scale per liter of culture media even through flask culture. Moreover, the purification and concentration of the target proteins from the culture supernatant were readily accomplished by one-step HIC with butyl-resin (Fig. 2a). As determined through Western blot analysis, all of the recombinant hGHs produced from P. pastoris, regardless of their conjugation to TP, were detected by anti-hGH antibody, as expected. However, interestingly, only C-TP-hGH was detected by anti-TP antibody (Fig. 2b). To ascertain a possibility of TPpeptide missing during protein expression in P. pastoris, N-terminal sequencing was performed with N-TP-hGH and we confirmed successful introduction of TP-peptide ligand in N-TP-hGH at its N-terminal region (Protein Chemistry Lab., Department of Biochemistry, Texas A&M University,
123
Mol Biotechnol
data not shown). We inferred that the N-terminal conjugation of TP to hGH may result in undesirable disulfide bond formation between the TP and certain internal cysteine residue of hGH instead of forming the intact loop shape of TP, resulting in its lack of recognition by the anti-TP antibody. Protein–protein fusion may unintentionally affect the functional domain of each protein via conformational changes. It is well known that many cytokines and growth factors with a common 4-helix bundle structural framework, including hGH, are sensitive to modifications of their amino acid sequence that might influence their structure [26]. Specifically, the third a-helix structure of hGH is important for the growth-promoting function of hGH [25]. Therefore, we assessed the biological functions of the TPconjugated hGHs in vitro and in vivo. To validate the function of the recombinant proteins, we tested the level of IGF-1 induction as a primary mediator of the effect of hGH. The recombinant hGHs were capable of inducing IGF-1 secretion and stimulating cell proliferation to levels similar to those observed with chGH, suggesting that the conjugation of the TP to both the N and C terminus of hGH did not have any negative effect on hGH function, although we did not evaluate possible conformational changes in hGH in the TP-conjugated recombinant hGHs (Fig. 3). In contrast, the in vivo analyses demonstrated that TP showed its expected transcytotic activity only when conjugated to the C terminus of hGH. As shown in Fig. 4, after oral administration, C-TP-hGH showed the most prominent green fluorescent signals in the lamina propria of villi compared with the other test groups, which suggests that the introduction of TP to hGH only at its C terminus could maintain its transcytotic activity across the intestinal barrier. As mentioned based on the Western blot data (Fig. 2b), the N-terminal conjugation of TP to hGH likely resulted in an improper structural conformation, potentially due to disulfide bond switchovers. In other words, it is generally recognized that differences in the termini forces on the N or C terminus could induce changes in the stability and flexibility of terminally conjugated fusion partners [27, 28]. Because the function of a protein is determined by its structure, it is hypothesized that the C-terminally conjugated TP met sufficient terminal force to retain its functional structure, whereas the structural balance in the N-terminally conjugated TP may be broken, resulting in the TP losing its function due to inadequate terminal force. Consistent with the above-described results, the oral administration of C-TP-hGH resulted in higher IGF-1 induction and growth promotion than commercial hGH and N-TP-hGH (Fig. 5). We inferred that this result is due to the transcytosis activity of the TP, i.e., to the translocation from the intestinal lumen to the lamina propria via specific
123
recognition of the TP ligand by unknown receptors in goblet cells of the intestinal epithelia. In this study, although we could not show significantly higher body weight gain with oral administration of 0.5 mg/dose of purified C-TP-hGH compared with control groups in rat model, we believe that significant growth increment could be achieved after dose optimization of the C-TP-hGH in further research. One of the challenges associated with the development of a protein drug is its immunogenicity because antibodies can affect the efficacy of the drug in multiple ways, including reducing the life time of the drug and neutralizing its activity. Fortunately, anti-drug antibody was not detected after the oral administration of the recombinant hGHs, which suggests the maintenance of the pharmacokinetics of our drugs through several administrations. It is thus possible that the TP fusion partner will be a powerful ligand that may aid the adsorption of orally administered hGH as well as another protein drugs, such as insulin, in the intestine through the conjugation of TP to polymeric nanoparticles [29]. Additionally, this strategy could be applied to other human medicines and enhancers of growth and milk production in the livestock industry. Acknowledgments This work was supported by the National Research Foundation of Korea (NRF) grant funded by the Korea government (MEST) (No. 2011-0029416). We also acknowledge the National Instrumental Centre for Environmental Management (NICEM) and National Center for Inter-University Research Facilities (NCIRF). Jun-Yeong Lee was supported by BK21 program.
References 1. Frokjaer, S., & Otzen, D. E. (2005). Protein drug stability: A formulation challenge. Nature Review Drug Discovery, 4, 298–306. 2. Marx, V. (2005). Watching peptide drugs grow up. Chemical & Engineering News, 83, 17–24. 3. Aungst, B. J. (2012). Absorption enhancers: Applications and advances. AAPS Journal, 14, 10–18. 4. Maculotti, K., Tira, E. M., Sonaggere, M., Perugini, P., Conti, B., Modena, T., & Pavanetto, F. (2009). In vitro evaluation of chondroitin sulphate-chitosan microspheres as carrier for the delivery of proteins. Journal of Microencapsulation, 26, 535–543. 5. Yun, Y., Cho, Y. W., & Park, K. (2013). Nanoparticles for oral delivery: Targeted nanoparticles with peptidic ligands for oral protein delivery. Advanced Drug Delivery Reviews, 65, 822–832. 6. Kumar, P., & Mishra, B. (2008). Colon targeted drug delivery systems—an overview. Current Drug Delivery, 5, 186–198. 7. Maroni, A., Zema, L., Del Curto, M. D., Foppoli, A., & Gazzaniga, A. (2012). Oral colon delivery of insulin with the aid of functional adjuvants. Advanced Drug Delivery Reviews, 64, 540–556. 8. Zhang, L., & Bulaj, G. (2012). Converting peptides into drug leads by lipidation. Current Medicinal Chemistry, 19, 1602–1618. 9. Hsieh, P.-W., Hung, C.-F., & Fang, J.-Y. (2009). Current prodrug design for drug discovery. Current Pharmaceutical Design, 15, 2236–2250.
Mol Biotechnol 10. Jana, S., Mandlekar, S., & Marathe, P. (2010). Prodrug design to improve pharmacokinetic and drug delivery properties: Challenges to the discovery scientists. Current Medicinal Chemistry, 17, 3874–3908. 11. Koren, E., & Torchilin, V. P. (2012). Cell-penetrating peptides: Breaking through to the other side. Trends in Molecular Medicine, 18, 385–393. 12. Dutt Vadlapudi, A., Krishna Vadlapatla, R., & Mitra, A. K. (2012). Sodium dependent multivitamin transporter (SMVT): A potential target for drug delivery. Current Drug Targets, 13, 994–1003. 13. Bai, Y., Ann, D. K., & Shen, W.-C. (2005). Recombinant granulocyte colony-stimulating factor-transferrin fusion protein as an oral myelopoietic agent. Proceedings of the National Academy of Sciences United States of America, 102, 7292–7296. 14. Lim, C.-J., & Shen, W.-C. (2005). Comparison of monomeric and oligomeric transferrin as potential carrier in oral delivery of protein drugs. Journal of Controlled Release, 106, 273–286. 15. Russell-Jones, G. (1996). The potential use of receptor-mediated endocytosis for oral drug delivery. Advanced Drug Delivery Reviews, 20, 83–97. 16. Swaan, P. W. (1998). Recent advances in intestinal macromolecular drug delivery via receptor-mediated transport pathways. Pharmaceutical Research, 15, 826–834. 17. Higgins, D. R., & Cregg, J. M. (1998). Methods in molecular biology: Pichia protocols. Introduction to Pichia pastoris (pp. 1–15). New York: Humana Press. 18. Cregg, J. M., Cereghino, J. L., Shi, J., & Higgins, D. R. (2000). Recombinant protein expression in Pichia pastoris. Molecular Biotechnology, 16, 23–52. 19. Kang, S. K., Woo, J. H., Kim, M. K., Woo, S. S., Choi, J. H., Lee, H. G., et al. (2008). Identification of a peptide sequence that improves transport of macromolecules across the intestinal mucosal barrier targeting goblet cells. Journal of Biotechnology, 135, 210–216.
20. Thaker, V., Haagensen, A. L., Carter, B., Fedorowicz, Z., & Houston, B. W. (2013). Recombinant growth hormone therapy for cystic fibrosis in children and young adults. Cochrane Database Systematic Reviews, 6, CD008901. 21. Stephany, R. W. (2010). Hormonal growth promoting agents in food producing animals, Doping in sports: Biochemical principles, effects and analysis (pp. 355–367). New York: Springer. 22. Sousa, C. M. F., & Passarinha, L. (2013). REVIEW: Pichia pastoris: A recombinant microfactory for antibodies and human membrane proteins. Journal of Microbiology and Biotechnology, 23, 587–601. 23. Lee, C. H., Woo, J. H., Cho, K. K., Kang, S. H., Kang, S. K., & Choi, Y. J. (2007). Expression and characterization of human growth hormone–Fc fusion proteins for transcytosis induction. Biotechnology and Applied Biochemistry, 46, 211–217. 24. Andus, T., Bauer, J., & Gerok, W. (1991). Effects of cytokines on the liver. Hepatology, 13, 364–375. 25. Chen, W. Y., Chen, N., Yun, J., Wagner, T. E., & Kopchick, J. J. (1994). In vitro and in vivo studies of antagonistic effects of human growth hormone analogs. Journal of Biological Chemistry, 269, 15892–15897. 26. Chaiken, I. M., & Williams, W. V. (1996). Identifying structurefunction relationships in four-helix bundle cytokines: Towards de novo mimetics design. Trends in Biotechnology, 14, 369–375. 27. Kirkitadze, M. D., & Barlow, P. N. (2001). Structure and flexibility of the multiple domain proteins that regulate complement activation. Immunological Reviews, 180, 146–161. 28. Wright, P. E., & Dyson, H. J. (1999). Intrinsically unstructured proteins: Re-assessing the protein structure-function paradigm. Journal of Molecular Biology, 293, 321–331. 29. Jin, Y., Song, Y., Zhu, X., Zhou, D., Chen, C., Zhang, Z., & Huang, Y. (2012). Goblet cell-targeting nanoparticles for oral insulin delivery and the influence of mucus on insulin transport. Biomaterials, 33, 1573–1582.
123
RESEARCH
Production of Recombinant Human Growth Hormone Conjugated with a Transcytotic Peptide in Pichia pastoris for Effective Oral Protein Delivery Jun-Yeong Lee • Sang-Kee Kang • Hui-Shan Li • Chang-Yun Choi • Tae-Eun Park • Jin-Duck Bok Seung-Ho Lee • Chong-Su Cho • Yun-Jaie Choi
•
Ó Springer Science+Business Media New York 2014
Abstract Among the possible delivery routes, the oral administration of a protein is simple and achieves high patient compliance without pain. However, the low bioavailability of a protein drug in the intestine due to the physical barriers of the intestinal epithelia is the most critical problem that needs to be solved. To overcome the low bioavailability of a protein drug in the intestine, we aimed to construct a recombinant Pichia pastoris expressing a human growth hormone (hGH) fusion protein conjugated with a transcytotic peptide (TP) that was screened through peroral phage display to target goblet cells in the intestinal epithelia. The TP-conjugated hGH was successfully produced in P. pastoris in a secreted form at concentrations of up to 0.79 g/l. The function of the TPJun-Yeong Lee and Sang-Kee Kang have contributed equally to this work. J.-Y. Lee (&) H.-S. Li C.-Y. Choi T.-E. Park Y.-J. Choi (&) Department of Agricultural Biotechnology, Seoul National University, Seoul 151-921, Republic of Korea e-mail: [email protected] Y.-J. Choi e-mail: [email protected] H.-S. Li e-mail: [email protected] C.-Y. Choi e-mail: [email protected]
conjugated hGH was validated by in vitro and in vivo assays. The transcytotic function of the TP through the intestinal epithelia was verified only in the C terminus conjugated hGH, which demonstrated the induction of IGF-1 in a HepG2 cell culture assay, a higher translocation of recombinant hGH into the ileal villi after oral administration in rats and both IGF-1 induction and higher body weight gain in rats after oral administration. The present study introduces the possibility for the development of an effective oral protein delivery system in the pharmaceutical and animal industries through the introduction of an effective TP into hGH. Keywords Conjugated protein drug Human growth hormone Pichia pastoris Transcytotic peptide Oral drug
J.-D. Bok e-mail: [email protected] S.-H. Lee Department of Nano-Bioengineering, College of Life Science and Bioengineering, University of Incheon, Incheon 406-772, Republic of Korea e-mail: [email protected] C.-S. Cho Y.-J. Choi Research Institute for Agriculture and Life Science, Seoul National University, Seoul 151-921, Republic of Korea e-mail: [email protected]
T.-E. Park e-mail: [email protected] S.-K. Kang J.-D. Bok Institute of Green-Bio Science & Technology, Seoul National University, Pyeongchanggun, Gangwondo 232-916, Republic of Korea e-mail: [email protected]
123
Mol Biotechnol
Introduction With the rapid progress in the fields of molecular biology and biotechnology in recent decades, protein drugs, rather than chemical drugs, have become a subject of special interest because of their several advantages, such as low cytotoxicity, minimized side effects, selective specificity, and minimal non-specific and drug–drug interactions [1, 2]. Most of the commercially available protein drugs are delivered by traditional routes, such as intramuscular, subcutaneous, and intravenous injections, because of their poor oral bioavailability. However, oral administration is sometimes preferred to any other routes due to several advantages, such as patient compliance, easy administration, and low cost of production, but low oral bioavailability is attributed to pre-systemic enzymatic degradation and poor absorption in the intestinal tract. Therefore, several strategies, such as formulation [3–5], site-specific delivery to colon [6, 7], chemical modification [1, 8], prodrug derivatization [9, 10], cell-penetrating peptides [11], membrane transporter [12], and receptor targeting [13, 14], have been tested to enhance the oral bioavailability of protein drugs. Among them, the receptor-mediated delivery of the protein has attracted much attention due to a number of beneficial traits. The modification of a protein drug with specific ligands confers higher oral bioavailability by site-specific targeting and intracellular passage of the drug, which was normally prevented by the intestinal barrier [15, 16]. Yeast is one of the most robust industrial fermentation organisms for the expression of therapeutic proteins compared with other eukaryotic expression system [17]. Among yeasts, P. pastoris as a popular methylotrophic yeast has been used to express recombinant proteins for both basic research and industrial application due to several key reasons: it is easy to genetically manipulate and grows rapidly on inexpensive media; it expresses foreign protein at a high level; and it performs post-translational modifications during protein expression, such as disulfide bond formation, glycosylation, and proteolysis, similarly to higher eukaryotic organisms [18]. In this study, we aimed to construct recombinant P. pastoris expressing a human growth hormone (hGH) fusion protein conjugated with a transcytotic peptide (TP) that could facilitate the translocation of its partner across the intestinal epithelia by targeting goblet cells. The TP is a hydrophilic and loop-shaped C7C-type peptide ligand with the amino acid sequence CSKSSDYQC, which was identified through the in vivo phage display screening in our previous study [19]. hGH was selected as a model protein drug because it has been broadly used as a medicine to treat human diseases, such as GH deficiency syndrome and cystic fibrosis of the lung [20], and as a growth and milk production enhancer in
123
livestock [21]. P. pastoris was used as a host cell for hGH expression because it exhibits a powerful capacity to meet the required target protein production due to simple recovery and purification steps [22].
Materials and Methods Construction of Recombinant hGH Expression Vectors Expression vectors were constructed using a commercial vector, pPICZa B (Invitrogen, CA, USA), to produce three recombinant hGHs (N-TP-hGH: TP conjugated at the N terminus of hGH, C-TP-hGH: TP conjugated at the C terminus of hGH, and hGH: hGH with no fusion partner). The human growth hormone gene, hGH1 (GenBank: NM_0005156), was amplified by PCR from the hGH1 expression vector constructed in our previous study [23]. The oligonucleotide sets encoding TP and G3S-linker were chemically synthesized (The Midland Certified Reagent Company, TX, USA) and used to generate TPG3S for N-TP-hGH and G3S-TP for C-TP-hGH (Table 1). Complementarily annealed double-strand TP-G3S or G3STP was ligated with the N or C terminus of the hGH1 gene, and each fusion gene was then inserted into the pPICZa B vector between the PstI and XbaI restriction enzyme sites (Fig. 1). The nucleotide sequence of each cloned gene in the expression vector was confirmed using ABI 3700, an automatic fluorescent sequencing system (Perkin Elmer and Applied Biosystem, CA, USA). Transformation of P. pastoris and Expression of Recombinant hGHs We used the P. pastoris X-33 yeast strain as the host for recombinant protein production. The yeast transformants were cultivated in 250 ml of YPD broth (BD Biosciences, NJ, USA) containing 0.05 % Zeocin antibiotic (Invitrogen, CA, USA) at 30 °C for 48 h. The P. pastoris cells were collected by centrifugation at 4509g and 4 °C for 15 min. Recombinant hGH expression was induced in 500 ml of BMMYC (1 % yeast extract, 2 % peptone, 100 mM dibasic potassium phosphate buffer (pH 6), 1.34 % yeast nitrogen base w/o amino acids, 4 9 10-5 % biotin (pH 6.5), 0.5 % methanol and 1 % casamino acids) for 24 h with 0.05 % methanol feeding at 12 h post-culture. The supernatant was collected by centrifugation at 6509g and 4 °C for 20 min. Purification of Recombinant hGHs Hydrophobic interaction chromatography (HIC) was performed for the purification of the recombinant hGHs using
Mol Biotechnol Table 1 Synthetic oligonucleotides for generation of C-TP-G3S and N-TP-G3S Gene name
Forward primer
Reverse primer
TP-G3S
TGTTCTAAGTCTTCTGACTACCAA TGTGGTGGTGGTTCT
GAACCACCACCACATTGGTAGTCA GAAGACTTAGAACATGCA
G3S-TP
CGGTGGTGGTTCTGCTTGTTCTAACTCTT CTGACTACCAATGTGGTTGAT
CTAGATCAACCACATTGGTAGTCAGAAG ACTTAGAACAAGCAGAACCACCAC
TA, USA), at 4 °C overnight. After washing, the membrane was incubated with goat anti-rabbit secondary antibody conjugated to horseradish peroxidase (1:5,000) (Millipore, MA, USA) for 1 h, developed with the Amersham ECL prime Western blotting detection reagent (GE Healthcare, Little Chalfont, UK) and visualized using the ChemiDoc MP imaging system (Bio-Rad, CA, USA). In Vitro Functional Validation of Recombinant hGHs
Fig. 1 Construction of expression vectors for recombinant hGH, N-TP-hGH, and T-TP-hGH. a-Factor is a signal sequence for protein secretion in yeast, and G3S (three glycines and one serine) is the molecular linker between the TP and hGH
a chromatography column (diameter 25 mm, BIO-RAD, CA, USA) packed with 6 ml of butyl-resin (Toyopearl 650 M series, Tosoh Bioscience, Tokyo, Japan) and equilibrated with binding buffer containing 1.75 M sodium sulfate, 20 mM Tris–HCl, and 1 mM EDTA (pH 8.0). The culture supernatant was also adjusted to 1.75 M sodium sulfate and then loaded onto the pre-equilibrated column. After washing extensively with the binding buffer, the protein bound to the resin was eluted with an elution buffer containing 5 % glycerol, 20 mM Tris–HCl, and 1 mM EDTA (pH 8.0) at a flow rate of 2 ml/min. The purified hGHs were detected by SDS-PAGE under non-reducing conditions and quantified using the BCA assay (Thermo Scientific, MA, USA). Western Blot Analysis The protein bands from the SDS-PAGE gel were transferred to a PVDF membrane (GE Healthcare, Little Chalfont, UK). The membrane was blocked with 5 % skim milk (BD Biosciences, NJ, USA) at room temperature for 1 h and then incubated with rabbit anti-hGH polyclonal antibody (Abcam, Cambrigde, UK) or rabbit anti-TP polyclonal antibody (1:1,000), which was obtained through the systemic immunization of chemically synthesized TP peptide (ACSKSSDYQCG) into rabbits (Biosynthesis Inc.,
The human hepatoma cell line (HepG2 cells) was maintained in Gibco Opti-MEM (Life Technologies, MA, USA) supplemented with 10 % fetal bovine serum (Hyclone, Little Chalfont, UK) at 37 °C under 5 % CO2 in a humidified atmosphere, and the medium was changed twice a week. To validate the biological function of the recombinant hGHs, HepG2 cells were seeded at a density of 5 9 104 cells per well in 12-well plates, grown for 36 h, and then incubated in 2 ml of serum-free medium for an additional 6 h. After several washing steps, 2 ml of serumfree medium with 0.5 lg of recombinant hGHs or commercial hGH (R&D systems, MN, USA) was added, and the cells were incubated for 24 h. The amount of IGF-1 in the collected supernatant was determined using a human IGF-1 ELISA kit (R&D Systems, MN, USA). The cultured cells were trypsinized and counted using a hemocytometer for measurement of the cell proliferation rate. In Vivo Immunohistochemistry For in vivo assays, SD rats were used following the policy and regulations for the care and use of laboratory animals (Laboratory Animal Center, Seoul National University, Korea). The SD rats were maintained in the laboratory animal facility with a temperature of 23 ± 2 °C, a relative humidity of 50 ± 20 %, and a 12-h light/12-h dark cycle. All of the experimental protocols were reviewed and approved by the Animal Care and Use Committee at Seoul National University (SNU-130321-1). 8-week-old male SD rats starved overnight were orally administered with 0.5 ml of neutralization solution (0.4 ml of PBS and 0.1 ml of 7.5 % NaHCO3) to reduce the stomach acidity, and after 30 min, the rats were gavaged with 1 mg of recombinant hGHs dissolved in
123
Mol Biotechnol
1 ml of PBS. After allowing gastric retention of the drugs for 1 h, the animals were anesthetized by the abdominal injection of Zoletil (29 mg/kg of BW) and Rompun (4 mg/kg of BW). The extracted ileum was fixed with 4 % PFA and dehydrated with 20 % sucrose solution at 4 °C overnight. The samples were frozen with the Tissue-Tek OCT compound (Miles Laboratories Inc., IN, USA) at -70 °C for 24 h. Sections with a thickness of 14 lm were then cut and attached to gelatin-coated slide glasses. The tissue samples were incubated with blocking solution (5 % goat serum, 1 % BSA, and 0.5 % Tween20 in PBS) for 1 h and successively treated with primary rabbit polyclonal anti-hGH antibody (1:100) (Abcam, Cambridge, UK) for 2 h, TRITC-conjugated UEA-1 lectin (1:50) (Sigma, MO, USA) for 20 min, secondary Alexa 488-conjugated goat anti-rabbit antibody (1:100) for 1 h, and DAPI (1:1,000) for 5 min. The immunostained tissue samples were observed using a confocal laser scanning microscope (LSM710, Carl Zeiss, Oberkochen, Germany). In Vivo Functional Validation of Recombinant hGHs The purified recombinant hGHs were dissolved in PBS to a concentration of 1 mg/ml, and 0.5 ml of the aliquots were then orally administered to 8-week-old male SD rats according to the group assignment after the neutralization of gastric acid as described above for the in vivo functional validation of the recombinant hGHs. Blood samples (100 ll) were collected from the tail vein 1 h before and 2, 4, 6, 8, and 24 h after the oral administration of the recombinant hGHs. The serum proteins were quantified by the BCA assay, and an indirect ELISA of the extracted sera was then performed to detect the IGF-1 induction level. Each serum sample diluted in carbonate/bicarbonate buffer (50 mM Na2CO3, 50 mM NaHCO3, and pH 9.4) to a final protein concentration of 20 lg/ml was coated onto the polystyrene plate at 4 °C overnight. The antigen-coated plates were blocked with 5 % skim milk (BD Biosciences, NJ, USA) for 2 h and incubated with primary rabbit polyclonal anti-rat IGF-1 antibody (1:1,000) (Abbiotec, CA, USA) for 2 h. The plates were then incubated with secondary HRP-conjugated goat anti-rabbit antibody (1:2,000) (Millipore, MA, USA) for 1 h. Finally, the TMB substrate solution was added for 30 min, and the reaction was stopped with 50 ll of 2 M H2SO4. Three washes were performed before each step. The optical density (OD) was measured at 450 nm using a microplate reader (Infinite M200 Pro, Tecan, Zu¨rich, Switzerland). To study the effect of the recombinant hGHs on body weight gain, 0.5 mg of the hGHs dissolved in 0.5 ml of PBS were orally administered every second day for 4 weeks to 4-week-old SD rats (four animals per group,
123
101.4 ± 0.7 g) with ad libitum access to feed and water. The body weights of the SD rats were measured every week for a period of 5 weeks. Statistical Analysis The results are expressed as the means and SEM unless indicated otherwise. ANOVA and independent two-samples t test were used to assess the significance of the differences in the results. The PC OriginPro 8 software program (OriginLab Corp., MA, USA) was used for all of the statistical analyses.
Results Construction and Expression of the Recombinant hGHs in P. pastoris To confer intestinal epithelial permeability to hGHs, vectors were constructed to express hGHs fused with the TP peptide previously identified by peroral phage display screening [19]. Because peptide fusion may affect the important characteristics or functions of hGH, TP was fused to either the N or C terminus of hGH to yield recombinant N-TP-hGH and C-TP-hGH, respectively, with a G3S linker between the TP and hGH to prevent mutual interference (Fig. 1). A vector expressing hGH with no fusion partner was used as a control. The secreted recombinant hGHs were produced in BMMYC medium for 24 h with methanol induction and purified by HIC. As shown in Fig. 2a, all of the recombinant hGHs were simply recovered by a single step of chromatography as concentrated forms. In Western blot analysis, all of the purified proteins were detected by antihGH antibody as single bands. However, unexpectedly, anti-TP antibody detected only C-TP-hGH (Fig. 2b) although N-TP-hGH and C-TP-hGH showed similar molecular weight together, which were slightly higher compared with the hGH having no TP-peptide ligand (Fig. 2a). An average weight of 0.79 grams of the purified recombinant hGHs was obtained from a liter of culture media. In Vitro Functional Validation of the Recombinant hGHs The identities of the recombinant hGHs were verified through Western blot analysis using anti-hGH antibody and anti-TP antibody. All of the recombinant hGHs produced from P. pastoris were detected by the anti-hGH antibody. However, the anti-TP antibody detected only C-TP-hGH and not N-TP-hGH under non-reducing conditions
Mol Biotechnol
Fig. 2 Production and purification of recombinant hGHs. a SDSPAGE for HIC purification of hGHs. The sizes of hGH and C-TPhGH (or N-TP-hGH) are approximately 22 and 23 kDa, respectively. Lane M molecular weight markers, S culture supernatant, F sample
flowthrough, W washing fraction, E elution fraction. b Western blot analysis. Anti-hGH and anti-TP antibodies were used for the detection of the recombinant hGHs
We then conducted in vitro cell culture tests using the HepG2 cell line to assess the induction of IGF-1 by the TPconjugated recombinant hGHs compared with the commercial hGH and recombinant hGH. hGH is known to stimulate the proliferation of HepG2 cells accompanied with the production of IGF-1 [24]. As shown in Fig. 3, the IGF-1 levels were significantly increased by all of the recombinant hGHs produced from P. pastoris compared with the PBS-treated control cells. Moreover, the induction of IGF-1 and stimulation of cell proliferation achieved by the recombinant hGHs were similar to those obtained with the commercial recombinant hGH (chGH). Consequently, the recombinant hGHs exhibited for the capability to induce IGF-1 secretion and proliferation of HepG2 cells, indicating that the conjugation of the TP-peptide ligand to the N or C terminus of hGH does not affect the functions of hGH. Examination of TP Function in the Recombinant hGHs
Fig. 3 In vitro functional validation of growth hormone. HepG2 cells were used for estimation of IGF-1 induction (a) and cell proliferation (b). A total of 5 9 104 cells were seeded per well and incubated with 0.5 lg of the recombinant hGHs. The recombinant hGHs presented similar growth hormone activity compared with commercial recombinant hGH (chGH). ** P \ 0.01
(Fig. 2b). We assumed that this result may reflect a conformational difference in the TP between N-TP-hGH and C-TP-hGH based on its different position.
To confirm the transcytotic function of the TP conjugated to the recombinant hGHs at the intestinal epithelia, we traced the recombinant hGHs in the intestinal villi of rats by immunohistochemistry. One milligram of the recombinant hGHs were orally administered, and the ileum was extracted 1 h post-treatment and immunostained with antihGH antibody and anti-UAE-1 lectin. As shown in Fig. 4, higher absorption of C-TP-hGH into the lamina propria region of the ileum was observed compared with that found for N-TP-hGH and hGH itself. The results indicate that the TP ligand of C-TP-hGH is capable of translocating hGH across the intestinal epithelia. In contrast, the TP of N-TPhGH lost its targeting function likely due to a conformational change in the TP, such as inadequate disulfide bonds,
123
Mol Biotechnol
Fig. 4 Immunostained ileal villi of rats after oral administration of the recombinant hGHs. The nuclei, goblet cells and mucus layer, and recombinant hGHs were stained by DAPI (blue), UEA-1 lectin (red) and anti-hGH antibody (green), respectively. Scale bar 50 lm (Color figure online)
that occurred during protein folding when conjugated to the N terminus of hGH. In Vivo Functional Validation of the Recombinant hGHs To confirm the in vivo function of the recombinant hGHs, the level of IGF-1 induction in rats was assessed because hGH has cross-reactivity in other species, including rat, mouse, bovine, and swine [25]. After the recombinant hGHs were orally administered to the rats, their blood was sampled to monitor the serum IGF-1 level. As shown in Fig. 5a, the IGF-1 level obtained for the rats administered
123
C-TP-hGH was 1.35-fold higher than that found for the PBS-treated control 6 h after oral administration. The IGF1 level in the N-TP-hGH and hGH groups was 1.1-fold higher than the control group that only PBS was administered with no significant difference between them, which is consistent with the above-mentioned results that only TP located at the C terminus of hGH maintains its function of intestinal translocation (Fig. 4), even though N-TP-hGH was also revealed to function as a growth hormone due to its in vitro induction of IGF-1 in HepG2 cells (Fig. 3). To validate the basic fact that high IGF-1 induction, as a primary mediator of the effects of recombinant hGHs, promotes the growth performance, we measured the body
Mol Biotechnol
Fig. 5 Analysis of the in vivo function of the recombinant hGHs after oral administration in rats. a Assessment of IGF-1 induction. The IGF-1 level is expressed fold increases relative to the level obtained for the PBS group (negative control). b Body weight gain over time
weight of rats for a period of 5 weeks after the oral administration of the recombinant hGHs (Fig. 5b). As shown in figure, the rats gained approximately 36 g of body weight per week in all of the groups. In addition, the C-TP-hGH group showed approximately 10 % higher weight gain tendency compared with the PBS, hGH, and N-TP-hGH groups despite no statistical significance. Recombinant hGH or N-TP-hGH had no effect on weight gain because it resulted in body weight gains similar to those observed in the control PBS group. The results indicated that orally administered C-TP-hGH exerted a higher growth-promoting effect due to the enhanced translocation of hGH across the intestinal epithelia by the TP moiety in the C-TP-hGH. We also screened the immunogenicity of the recombinant hGHs to assess their side effects and found that anti-drug antibody was not induced during 4 weeks of treatment, suggesting the safety of the recombinant hGHs (data not shown).
Discussion The oral administration of protein drugs remains an attractive alternative for parenteral delivery despite its critical limitations, such as low bioavailability due to enzymatic degradation and poor penetration across the intestinal tract. The development of novel delivery systems that can increase the intestinal membrane permeability is essential for improving the bioavailability of protein drugs and thus increasing their acceptance for clinical applications. We previously identified a peptide ligand, designated TP, through in vivo phage display screening that could facilitate the translocation of a cargo (or fusion partner)
from the intestinal lumen to the lamina propria region across the intestinal barrier. The oral administration of the M13 bacteriophage encoding TP on its surface showed that the TP efficiently delivered and guided the translocation of the M13 bacteriophage across the intestinal epithelia by targeting goblet cells via an unknown mechanism [19]. Thus, we noted the potential of using the TP-peptide ligand for the development of an efficient oral drug delivery system. In this study, we validated the ability of using the TP peptide as a transcytotic moiety for a protein drug to enhance its absorption efficiency across the intestinal barrier. The hGH was selected as the model protein drug and was produced by P. pastoris as a recombinant protein directly fused with the TP-peptide ligand on its N or C terminus, and the functions of the resulting recombinant proteins were then assayed in vitro and in vivo. Pichia pastoris appeared to be a competent host cell for the production of the recombinant hGHs, and the production and secretion of the target proteins reached the gram scale per liter of culture media even through flask culture. Moreover, the purification and concentration of the target proteins from the culture supernatant were readily accomplished by one-step HIC with butyl-resin (Fig. 2a). As determined through Western blot analysis, all of the recombinant hGHs produced from P. pastoris, regardless of their conjugation to TP, were detected by anti-hGH antibody, as expected. However, interestingly, only C-TP-hGH was detected by anti-TP antibody (Fig. 2b). To ascertain a possibility of TPpeptide missing during protein expression in P. pastoris, N-terminal sequencing was performed with N-TP-hGH and we confirmed successful introduction of TP-peptide ligand in N-TP-hGH at its N-terminal region (Protein Chemistry Lab., Department of Biochemistry, Texas A&M University,
123
Mol Biotechnol
data not shown). We inferred that the N-terminal conjugation of TP to hGH may result in undesirable disulfide bond formation between the TP and certain internal cysteine residue of hGH instead of forming the intact loop shape of TP, resulting in its lack of recognition by the anti-TP antibody. Protein–protein fusion may unintentionally affect the functional domain of each protein via conformational changes. It is well known that many cytokines and growth factors with a common 4-helix bundle structural framework, including hGH, are sensitive to modifications of their amino acid sequence that might influence their structure [26]. Specifically, the third a-helix structure of hGH is important for the growth-promoting function of hGH [25]. Therefore, we assessed the biological functions of the TPconjugated hGHs in vitro and in vivo. To validate the function of the recombinant proteins, we tested the level of IGF-1 induction as a primary mediator of the effect of hGH. The recombinant hGHs were capable of inducing IGF-1 secretion and stimulating cell proliferation to levels similar to those observed with chGH, suggesting that the conjugation of the TP to both the N and C terminus of hGH did not have any negative effect on hGH function, although we did not evaluate possible conformational changes in hGH in the TP-conjugated recombinant hGHs (Fig. 3). In contrast, the in vivo analyses demonstrated that TP showed its expected transcytotic activity only when conjugated to the C terminus of hGH. As shown in Fig. 4, after oral administration, C-TP-hGH showed the most prominent green fluorescent signals in the lamina propria of villi compared with the other test groups, which suggests that the introduction of TP to hGH only at its C terminus could maintain its transcytotic activity across the intestinal barrier. As mentioned based on the Western blot data (Fig. 2b), the N-terminal conjugation of TP to hGH likely resulted in an improper structural conformation, potentially due to disulfide bond switchovers. In other words, it is generally recognized that differences in the termini forces on the N or C terminus could induce changes in the stability and flexibility of terminally conjugated fusion partners [27, 28]. Because the function of a protein is determined by its structure, it is hypothesized that the C-terminally conjugated TP met sufficient terminal force to retain its functional structure, whereas the structural balance in the N-terminally conjugated TP may be broken, resulting in the TP losing its function due to inadequate terminal force. Consistent with the above-described results, the oral administration of C-TP-hGH resulted in higher IGF-1 induction and growth promotion than commercial hGH and N-TP-hGH (Fig. 5). We inferred that this result is due to the transcytosis activity of the TP, i.e., to the translocation from the intestinal lumen to the lamina propria via specific
123
recognition of the TP ligand by unknown receptors in goblet cells of the intestinal epithelia. In this study, although we could not show significantly higher body weight gain with oral administration of 0.5 mg/dose of purified C-TP-hGH compared with control groups in rat model, we believe that significant growth increment could be achieved after dose optimization of the C-TP-hGH in further research. One of the challenges associated with the development of a protein drug is its immunogenicity because antibodies can affect the efficacy of the drug in multiple ways, including reducing the life time of the drug and neutralizing its activity. Fortunately, anti-drug antibody was not detected after the oral administration of the recombinant hGHs, which suggests the maintenance of the pharmacokinetics of our drugs through several administrations. It is thus possible that the TP fusion partner will be a powerful ligand that may aid the adsorption of orally administered hGH as well as another protein drugs, such as insulin, in the intestine through the conjugation of TP to polymeric nanoparticles [29]. Additionally, this strategy could be applied to other human medicines and enhancers of growth and milk production in the livestock industry. Acknowledgments This work was supported by the National Research Foundation of Korea (NRF) grant funded by the Korea government (MEST) (No. 2011-0029416). We also acknowledge the National Instrumental Centre for Environmental Management (NICEM) and National Center for Inter-University Research Facilities (NCIRF). Jun-Yeong Lee was supported by BK21 program.
References 1. Frokjaer, S., & Otzen, D. E. (2005). Protein drug stability: A formulation challenge. Nature Review Drug Discovery, 4, 298–306. 2. Marx, V. (2005). Watching peptide drugs grow up. Chemical & Engineering News, 83, 17–24. 3. Aungst, B. J. (2012). Absorption enhancers: Applications and advances. AAPS Journal, 14, 10–18. 4. Maculotti, K., Tira, E. M., Sonaggere, M., Perugini, P., Conti, B., Modena, T., & Pavanetto, F. (2009). In vitro evaluation of chondroitin sulphate-chitosan microspheres as carrier for the delivery of proteins. Journal of Microencapsulation, 26, 535–543. 5. Yun, Y., Cho, Y. W., & Park, K. (2013). Nanoparticles for oral delivery: Targeted nanoparticles with peptidic ligands for oral protein delivery. Advanced Drug Delivery Reviews, 65, 822–832. 6. Kumar, P., & Mishra, B. (2008). Colon targeted drug delivery systems—an overview. Current Drug Delivery, 5, 186–198. 7. Maroni, A., Zema, L., Del Curto, M. D., Foppoli, A., & Gazzaniga, A. (2012). Oral colon delivery of insulin with the aid of functional adjuvants. Advanced Drug Delivery Reviews, 64, 540–556. 8. Zhang, L., & Bulaj, G. (2012). Converting peptides into drug leads by lipidation. Current Medicinal Chemistry, 19, 1602–1618. 9. Hsieh, P.-W., Hung, C.-F., & Fang, J.-Y. (2009). Current prodrug design for drug discovery. Current Pharmaceutical Design, 15, 2236–2250.
Mol Biotechnol 10. Jana, S., Mandlekar, S., & Marathe, P. (2010). Prodrug design to improve pharmacokinetic and drug delivery properties: Challenges to the discovery scientists. Current Medicinal Chemistry, 17, 3874–3908. 11. Koren, E., & Torchilin, V. P. (2012). Cell-penetrating peptides: Breaking through to the other side. Trends in Molecular Medicine, 18, 385–393. 12. Dutt Vadlapudi, A., Krishna Vadlapatla, R., & Mitra, A. K. (2012). Sodium dependent multivitamin transporter (SMVT): A potential target for drug delivery. Current Drug Targets, 13, 994–1003. 13. Bai, Y., Ann, D. K., & Shen, W.-C. (2005). Recombinant granulocyte colony-stimulating factor-transferrin fusion protein as an oral myelopoietic agent. Proceedings of the National Academy of Sciences United States of America, 102, 7292–7296. 14. Lim, C.-J., & Shen, W.-C. (2005). Comparison of monomeric and oligomeric transferrin as potential carrier in oral delivery of protein drugs. Journal of Controlled Release, 106, 273–286. 15. Russell-Jones, G. (1996). The potential use of receptor-mediated endocytosis for oral drug delivery. Advanced Drug Delivery Reviews, 20, 83–97. 16. Swaan, P. W. (1998). Recent advances in intestinal macromolecular drug delivery via receptor-mediated transport pathways. Pharmaceutical Research, 15, 826–834. 17. Higgins, D. R., & Cregg, J. M. (1998). Methods in molecular biology: Pichia protocols. Introduction to Pichia pastoris (pp. 1–15). New York: Humana Press. 18. Cregg, J. M., Cereghino, J. L., Shi, J., & Higgins, D. R. (2000). Recombinant protein expression in Pichia pastoris. Molecular Biotechnology, 16, 23–52. 19. Kang, S. K., Woo, J. H., Kim, M. K., Woo, S. S., Choi, J. H., Lee, H. G., et al. (2008). Identification of a peptide sequence that improves transport of macromolecules across the intestinal mucosal barrier targeting goblet cells. Journal of Biotechnology, 135, 210–216.
20. Thaker, V., Haagensen, A. L., Carter, B., Fedorowicz, Z., & Houston, B. W. (2013). Recombinant growth hormone therapy for cystic fibrosis in children and young adults. Cochrane Database Systematic Reviews, 6, CD008901. 21. Stephany, R. W. (2010). Hormonal growth promoting agents in food producing animals, Doping in sports: Biochemical principles, effects and analysis (pp. 355–367). New York: Springer. 22. Sousa, C. M. F., & Passarinha, L. (2013). REVIEW: Pichia pastoris: A recombinant microfactory for antibodies and human membrane proteins. Journal of Microbiology and Biotechnology, 23, 587–601. 23. Lee, C. H., Woo, J. H., Cho, K. K., Kang, S. H., Kang, S. K., & Choi, Y. J. (2007). Expression and characterization of human growth hormone–Fc fusion proteins for transcytosis induction. Biotechnology and Applied Biochemistry, 46, 211–217. 24. Andus, T., Bauer, J., & Gerok, W. (1991). Effects of cytokines on the liver. Hepatology, 13, 364–375. 25. Chen, W. Y., Chen, N., Yun, J., Wagner, T. E., & Kopchick, J. J. (1994). In vitro and in vivo studies of antagonistic effects of human growth hormone analogs. Journal of Biological Chemistry, 269, 15892–15897. 26. Chaiken, I. M., & Williams, W. V. (1996). Identifying structurefunction relationships in four-helix bundle cytokines: Towards de novo mimetics design. Trends in Biotechnology, 14, 369–375. 27. Kirkitadze, M. D., & Barlow, P. N. (2001). Structure and flexibility of the multiple domain proteins that regulate complement activation. Immunological Reviews, 180, 146–161. 28. Wright, P. E., & Dyson, H. J. (1999). Intrinsically unstructured proteins: Re-assessing the protein structure-function paradigm. Journal of Molecular Biology, 293, 321–331. 29. Jin, Y., Song, Y., Zhu, X., Zhou, D., Chen, C., Zhang, Z., & Huang, Y. (2012). Goblet cell-targeting nanoparticles for oral insulin delivery and the influence of mucus on insulin transport. Biomaterials, 33, 1573–1582.
123
