International Journal of Medical Microbiology 305 (2015) 20–26

Contents lists available at ScienceDirect

International Journal of Medical Microbiology journal homepage: www.elsevier.com/locate/ijmm

Probiotic Escherichia coli Nissle 1917 reduces growth, Shiga toxin expression, release and thus cytotoxicity of enterohemorrhagic Escherichia coli Mashkoor Mohsin a,c , Sebastian Guenther a , Peter Schierack b , Karsten Tedin a , Lothar H. Wieler a,∗ a

Institute of Microbiology and Epizootics, Centre for Infection Medicine, Freie Universität Berlin, Berlin, Germany Faculty of Natural Sciences, Brandenburg Technical University Cottbus-Senftenberg, Senftenberg, Germany c Institute of Microbiology, University of Agriculture, Faisalabad, Pakistan b

a r t i c l e

i n f o

Article history: Received 30 May 2014 Received in revised form 24 August 2014 Accepted 18 October 2014 Keywords: EHEC Probiotic Nissle 1917 Shiga toxins Gene expression Cytotoxicity

a b s t r a c t Due to increased release or production of Shiga toxin by Enterohemorrhagic Escherichia coli (EHEC) after exposure to antimicrobial agents, the role of antimicrobial agents in EHEC mediated infections remains controversial. Probiotics are therefore rapidly gaining interest as an alternate therapeutic option. The well-known probiotic strain Escherichia coli Nissle 1917 (EcN) was tested in vitro to determine its probiotic effects on growth, Shiga toxin (Stx) gene expression, Stx amount and associated cytotoxicity on the most important EHEC strains of serotype O104:H4 and O157:H7. Following co-culture of EcN:EHEC in broth for 4 and 24 h, the probiotic effects on EHEC growth, toxin gene expression, Stx amount and cytotoxicity were determined using quantitative real time-PCR, Stx-ELISA and Vero cytotoxicity assays. Probiotic EcN strongly reduced EHEC numbers (cfu) of O104:H4 up to (68%) and O157:H7 to (72.2%) (p < 0.05) in LB broth medium whereas the non-probiotic E. coli strain MG1655 had no effect on EHEC growth. The level of stx expression was significantly down-regulated, particularly for the stx2a gene. The stx down-regulation in EcN co-culture was not due to reduced numbers of EHEC. A significant inhibition in Stx amounts and cytotoxicity were also observed in sterile supernatants of EcN:EHEC co-cultures. These findings indicate that probiotic EcN displays strong inhibitory effects on growth, Shiga toxin gene expression, amount and cytotoxicity of EHEC strains. Thus, EcN may be considered as a putative therapeutic candidate, in particular against EHEC O104:H4 and O157:H7. © 2014 Elsevier GmbH. All rights reserved.

Introduction Enterohemorrhagic E. coli (EHEC) are important foodborne human pathogens responsible for significant human infections with disease forms ranging from mild to bloody diarrhea, hemorrhagic colitis and hemolytic uremic syndrome (HUS) (Tarr et al., 2005). EHEC strains continue to cause severe diarrheal and HUS outbreaks worldwide, as exemplified by German HUS-outbreak strain E. coli O104:H4 in 2011 (Bielaszewska et al., 2011; Muniesa et al., 2012).

∗ Corresponding author. Present address. Centre for Infection Medicine, Institute of Microbiology and Epizootics, Freie Universität Berlin, Robert-von-Ostertag-Str. 7-13, 14163 Berlin, Germany. E-mail address: [email protected] (L.H. Wieler). http://dx.doi.org/10.1016/j.ijmm.2014.10.003 1438-4221/© 2014 Elsevier GmbH. All rights reserved.

The pathogenicity of EHEC is mainly due to the presence of virulence factors such as Shiga toxin 1 (Stx1) and/or 2 (Stx2), also referred to as verocytotoxins because of their cytotoxic action on Vero cells (Konowalchuk et al., 1977). The Shiga toxin gene (stx) is encoded in the genome of lambdoid phages integrated into the bacterial chromosome and their expression is controlled by late phage gene promoter pR (Shimizu et al., 2009). Shiga toxin belongs to the AB5 family of toxins that consists of the enzymatically active A-subunit within a pentameric complex of B-subunits (O’Brien et al., 1992). The B-subunit is involved in the binding of the toxin to globo-series glycosphingolipids on the surface of host vascular endothelial cells (Bauwens et al., 2013; Betz et al., 2012) whereas the A-subunit, which has N-glycosidase activity, cleaves adenine residues in the rRNA of host cell ribosomes causing protein synthesis inhibition and cell death (Bauwens et al., 2011).

M. Mohsin et al. / International Journal of Medical Microbiology 305 (2015) 20–26

21

Table 1 Primers and real-time PCR conditions used in this study. Primers

Sequence (5 –> 3 )

Target

References

PCR conditions

STX1-SG-F STX1-SG-F STX2-SG-F STX2-SG-R IC-1 F IC-10 R

CATTACAGACTATTTCATCAGGAGGTA TCGTTCAACAATAAGCCGTAGATTA GCGGTTTTATTTGCATTAGC TCCCGTCAACCTTCACTGTA GACCACTACCAGCAGAAC CTTGTACAGCTCGTCCATGC

stx1

Chui et al. (2010)

95 ◦ C/10 min; 40 cycles of 95 ◦ C/30 s; 55 ◦ C/1 m; 72 ◦ C/30 s

stx2

Chui et al. (2010)

IC-RNA

Hoffmann et al. (2006)

The term EHEC has been applied to STEC serotypes that share the same clinical, epidemiological and pathogenetic characteristics with the prototype strain E. coli O157:H7 (Karmali et al., 2010). EHEC O157:H7 is one of the predominant STEC strains responsible for several worldwide food-transmitted epidemics (Pennington, 2011). Among the non-O157 EHEC, serogroups O26, O103, O111, O91 and O145 contribute significantly to cases of diarrhea and HUS (Karch et al., 2005). The German outbreak in 2011 was found to be due to an unusual EHEC of serotype O104:H4 which has emerged as an important pathogen with a reported total of 3,842 cases with 53 deaths. The outbreak E. coli O104:H4 strain is a genetic hybrid of EHEC (stx2a ) and enteroaggregative E. coli (EAEC) (aggR) and harbors a plasmid encoding an extended-spectrum beta lactamase (ESBL). The strain showed aggregative adherence pattern (stackedbrick) on Hep-2 cells similar to typical EAEC strains due to the presence of aggregative adherence fimbriae 1 (AAF/1) (Mellmann et al., 2011). In addition, this strain produces high amounts of amyloid curli fibres at 37◦ C, but is cellulose-negative. Since curli fibres have a strong proinflammatory effect, with cellulose counteracting inflammation, the outbreak O104:H4 strain may enhance not only adherence but may also contribute to inflammation (Richter et al., 2014). Unlike typical STEC, an animal reservoir for the outbreak EHEC O104:H4 could not be established (Wieler et al., 2011). This foodborne outbreak strain was likely transmitted via contaminated sprout seeds (Buchholz et al., 2011). To date, there is no consensus regarding the treatment of EHEC infections. The use of antimicrobial agents in the treatment of EHEC associated infections is controversial because of reported increased Shiga toxin release after antibiotic exposure and due to the emergence of antibiotic resistance (Bielaszewska et al., 2012; Mohsin et al., 2010; Mora et al., 2005). Therefore, alternate preventive or therapeutic strategies for EHEC mediated diseases need to be investigated. Probiotics are live microorganisms that have been found to provide beneficial effects by different mechanisms including reduced adhesion and invasion of pathogens due to competitive exclusion, anti-inflammatory activities, competition for nutrients, bacteriocin production and reduced apoptosis of host cells (Britton and Versalovic, 2008; Maltby et al., 2013). Lactic acid bacteria (LAB) have been found to reduce EHEC adhesion and Shiga toxin release. LAB caused a decrease in Shiga toxin gene expression but had no direct killing effect on STEC O157:H7 (Carey et al., 2008). Another study showed that human digestive microbiota, particularly Bacteroides thetaiotaomicron, inhibited Shiga toxin gene transcription of EHEC O157:H7 (de Sablet et al., 2009). E. coli Nissle 1917 (EcN) is a probiotic strain of serotype O6:K5:H1. EcN has been shown to be highly effective for maintaining remission in ulcerative colitis patients (Jacobi and Malfertheiner, 2011). EcN has also been reported to reduce the adhesion and invasion to mammalian cells by several enteric pathogens, including Salmonella, Shigella, Yersinia, Listeria, adherent-invasive E. coli, and atypical enteropathogenic E. coli (Altenhoefer et al., 2004; Kleta et al., 2014; Schierack et al., 2011). Recent in vitro data demonstrated the EcN mediated inhibition of

EHEC adhesion, growth and amounts of Shiga toxin (Reissbrodt et al., 2009; Rund et al., 2013). The present study was designed to investigate the in vitro effects of probiotic E. coli Nissle 1917 strains on growth and stx gene expression of EHEC O104:H4 and O157:H7 using a quantitative real time-PCR approach. The influence of probiotic EcN on Shiga toxin amount and cytotoxicity from sterile supernatants of EHEC was also investigated. Materials and methods Bacterial strains Probiotic strain EcN was kindly provided by G. Breves (Hannover, Germany). EHEC O157:H7 strain EDL933 producing both Stx1a and Stx2a was taken from Institute for Microbiology and Epizootics, Freie Universität Berlin whereas the HUS-outbreak strain RKI II-2027 (O104:H4, Stx2a producer) was kindly provided by Angelika Fruth, Robert Koch-Institute, Wernigerode, Germany. The E. coli MG1655 originally obtained from C. A. Gross (San Francisco, California, USA) served as non-probiotic control. The E. coli strain H5316 is a microcin-sensitive indicator strain kindly provided by K. Hantke (Tübingen, Germany). Co-culture EHEC and probiotic EcN The EHEC strains, EcN and MG1655 were initially grown in LB broth overnight at 37 ◦ C with shaking at 200 rpm. The following day, the cultures were subcultured by dilution into fresh LB broth at 37 ◦ C and grown to an optical density OD600 = 0.3 adjusted by dilution to provide 2 × 104 cfu/ml. For co-culture experiments, probiotic EcN and EHEC were inoculated simultaneously at equal ratios (approximately 2 × 103 cfu each) in 20 ml LB and/or brain heart infusion (BHI) broth and co-incubated at 37 ◦ C with shaking at 200 rpm for 4 and 24 h. Similar co-incubation cultures of E. coli MG1655 with EHEC were used as a non-probiotic control. For each experiment, EHEC incubated in the absence of probiotic bacteria was used as an additional control. Real-time PCR for quantification of EHEC Quantitative SYBR Green real-time PCR (q-real time-PCR) was used to determine probiotic effects on EHEC absolute numbers (cfu/ml). Initially, the Shiga toxin genes (stx) were targeted to prepare external standard curves from EHEC strains EDL933 (stx1a , stx2a ) and HUS-outbreak strain RKI II-2027 O104:H4 (stx2a ) by q-real time-PCR using previously described primers and thermal cycler conditions (Table 1) (Chui et al., 2010). A range of known numbers of cfu/ml (determined by parallel serial dilution and plating) of EHEC were used for DNA extraction and the resulting DNA was used as a template for amplification in a Roche LightCycler 480 (Roche Applied Science, Basel, Switzerland), and plotted as a standard curve of critical threshold (Ct) value against each 10-fold serial dilution. The standard curve was derived from three independent, duplicate reactions.

22

M. Mohsin et al. / International Journal of Medical Microbiology 305 (2015) 20–26

DNA extraction was performed after growth of cultures in LB broth for 4 or 24 h using MasterPureTM Purification Kit (Epicentre Biotechnologies,Madison, WI, USA). For the quantification of EHEC, stx genes were amplified with real time-PCR from co-cultures and monocultures. The Ct value which corresponds to stx genes of each sample was used to calculate the total number of EHEC cfu/ml extrapolated from Ct values from a standard curve using Roche LC480 software. Each experiment was run three times, independently, in duplicate reactions.

were filter sterilized using 0.2 ␮m pore size filters. Subsequently, the sterile supernatants were used for the quantification of Shiga toxin amount using a commercial Ridascreen Verotoxin ELISA (r-biopharm, Darmstadt, Germany) as recommended by the manufacturer. The positive control was included in the kit whereas filtered BHI medium was used as a negative control. Spectrophotometric readings for the ELISA were taken at OD450nm. The amount of toxin released from EHEC co-cultured with probiotic EcN was determined relative to the amount of toxin released in the control group (EHEC alone) which was designated as 100%.

RNA extraction and addition of exogenous housekeeping gene Vero cytotoxicity assays In order to avoid a bias in the measurement of the stx gene expression experiments due to reduced numbers of EHEC bacteria present in co-cultures with EcN, we equalized the number of EHEC bacteria in the cultures treated with or without probiotic before extraction of RNA. This was performed to determine the direct influence of probiotic EcN on gene expression of the Shiga toxins. The bacterial cultures were stabilized with RNA Protect Bacteria Reagents (Qiagen, Munich, Germany). The cultures were centrifuged at 4 ◦ C at 5000 × g for 10 min and the pellets were lysed in 200 ␮l TE buffer containing lysozyme 15 mg/ml and Proteinase K 100 ␮g/ml (Qiagen). The samples were then incubated at room temperature for 10 min with intermittent vortexing. After lysis, 5 ␮l (8 × 104 copies/␮l) of exogenous heterologous internal controlRNA (IC-RNA, Labor Diagnostik Leipzig, Germany) was added to spike the reactions to normalize the relative stx gene expression in the real time PCR reactions. An exogenous housekeeping gene was used since the co-culture experiments used mixed RNA from two E. coli species (EHEC and EcN), thereby making it impossible to use an endogenous E. coli housekeeping gene. After spiking, the RNA was extracted using the RNeasy mini kit (Qiagen) according to the manufacturer’s instructions. The concentrations and purity of the RNA preparations were determined using absorption determinations at 260/280 nm obtained using a Nanodrop instrument (Thermo Scientific, Washington, USA).

Following ELISA, the sterile supernatants were used for verocytotoxicity assay using vero cells. Vero cells were maintained in tissue culture flasks in DMEM (Biochrom, Germany) supplemented with 10% fetal calf serum at 37 ◦ C in an atmosphere of 5% CO2 . The Vero cell cytotoxicity was determined as described previously (Bielaszewska et al., 2011). Briefly, 1 × 104 Vero cells were seeded in 96-well tissue culture plates (Costar, MA, USA) 24 h prior to toxin exposure. Sterile filtrates prepared for ELISA were serially diluted and exposed to Vero cells for 72 h followed by determination of cytotoxicity using Roche cytotoxicity detection kit (LDH) (Roche, Mannheim, Germany). DMEM was used as negative control. CD50 titer was defined as reciprocal of highest dilution resulting in 50% cytotoxicity in Vero cells. Statistical analysis For real time-PCR and cytotoxicity experiment, at least three, independent experiments were carried out in duplicate reactions. The Shiga toxin ELISA and assays were independently repeated at least twice, and performed in duplicate wells. Student’s t test was performed to determine P values using Statistical Package for the Social Sciences (SPSS Statistics; version 10.0). Results

Reverse transcription and q-real time-PCR for stx gene expression Effect of probiotic EcN on EHEC growth Reverse transcription of RNA for cDNA synthesis was performed using 2 ␮g of RNA template, M-MLV reverse transcriptase, dNTPs, ribonuclease inhibitor and random primers according to manufacturer’s protocol (Promega, Fitchburg, WI USA). Controls included RNA template in mock reactions in the absence of reverse transcriptase. For stx gene expression, the cDNA was subjected to SYBR Green real-time PCR using primers and PCR conditions listed in Table 1. Briefly, 2 ␮l of template cDNA was used in a 20 ␮l final reaction mixture, containing 10 ␮l SYBR Green master mix (Biozyme), 1 ␮l of 10 pmol of each primer, and 6 ␮l of PCR grade H2 O (Millipore). To normalize real-time PCR data, the exogenous housekeeping gene control (IC-RNA) was amplified using the primers listed in Table 1 (Hoffmann et al., 2006). Microcin test The sensitivity of EHEC strains against microcins produced by EcN was tested on agar plate inhibition tests as described previously (Kleta et al., 2006). E. coli strain H5316 served as microcin-sensitive control strain. Shiga toxin ELISA After 4 and 24 h incubation, the bacteria from BHI broth cultures were centrifuged at 10,000 × g for 10 min and supernatants

To determine the effect of probiotic EcN on the growth of EHEC, quantitative real time-PCR was employed. The results showed a strong decrease in EHEC numbers in the presence of the probiotic EcN whereas the non-probiotic control strain E. coli MG1655 did not significantly affect EHEC numbers (Table 2). In the case of HUS-outbreak strain RKI II-2027 (O104:H4), co-cultures with EcN resulted in 49.6% and 67.8% reduction of EHEC numbers at 4 and 24 h, respectively (Table 2). Growth of the EHEC O157:H7 strain EDL933 was also significantly reduced in the presence of probiotic EcN, with the largest decrease of up to 72.2% at 24 h incubation time (Table 2). Effect of EcN on stx gene expression by EHEC The EHEC O104:H4 and O157:H7 strains were tested for stx mRNA expression after co-culture in the presence or absence of EcN at 4 and 24 h. The q-real time PCR data showed a significant decrease in stx2a expression from EHEC O104:H4 co-incubated with EcN compared to O104:H4 alone (Fig. 1). The decrease in stx2a transcription was more noticeable at 24 h (7.2 fold; p < 0.05) (Fig. 1). As shown in Fig. 2, co-culture with the probiotic strain resulted in a considerable reduction (11.5-fold; p < 0.05) in stx2a expression from EHEC O157:H7, particularly at 24 h. In addition to stx2a expression, co-incubation with EcN also resulted in a down-regulation of stx1a expression (2 and 5.4 fold at 4 and 24 h, respectively) (Fig. 2). In

M. Mohsin et al. / International Journal of Medical Microbiology 305 (2015) 20–26

23

Table 2 Effect of EcN on growth of EHEC. 4h

O104:H4 O104:H4 + MG1655 O104:H4 + EcN O157:H7 O157:H7 + MG1655 O157:H7 + EcN

24 h

CFU/mla

% Relative

cfu/ml

% Relative

(2.6 ± 0.33) × 108 (2.44 ± 0.38) × 108 (1.4 ± 0.07) × 108 * (3 ± 0.44) × 109 (2.29 ± 0.78) × 109 (8.91 ± 1.04) × 108 *

100 93.6 50.4 100 79.4 29.6

(2.55 ± 0.46) × 108 (1.91 ± 1.06) × 108 (8 ± 0.11) × 107 * (4.87 ± 1.66) × 109 (3.75 ± 0.88) × 109 (1.36 ± 0.43) × 109 *

100 72.5 32.2 100 76.8 27.8

Data (means ± standard errors) are from three independent experiments. a = Total number of EHEC (cfu/ml) extrapolated from Ct values of standard curve as determined by realtime-PCR. * p < 0.05

Fig. 1. Effect of EcN on stx2a gene expression from EHEC O104:H4 at 4 and 24 h. The q-real time PCR data show the fold change in stx2a expression in co-cultures (EcN or MG1655) relative to EHEC alone and normalized to an exogenous housekeeping gene control. Data (means ± standard errors) are from three independent experiments. * p < 0.05.

contrast, co-culture with the control E. coli MG1655 strain showed no significant effects on stx expression at any time. Effects of microcin EcN produces microcins M and H47 which can have antibacterial activities against other E. coli strains (Patzer et al., 2003). The production of microcins by EcN was indicated by a zone of growth inhibition of the microcin-sensitive indicator strain H5316. However, EcN did not affect the growth of the EHEC strains (Fig. 3).

Fig. 2. Effect of EcN on stx2a and stx1a gene expression from EHEC O157:H7 at 4 and 24 h. The q-real time PCR data show the fold change in expression in co-cultures (EcN or MG1655) relative to EHEC alone and normalized to an exogenous housekeeping gene control. Data (means ± standard errors) are from three independent experiments. * p < 0.05.

Shiga toxin production In order to assess the effect of probiotic EcN on Shiga toxin release from EHEC strains, Verotoxin-ELISA assays were also performed. The results showed a significant reduction of up to 86.1% in Shiga toxin production from EHEC O104:H4 co-incubated with EcN for 24 h (Fig. 4). ELISA determinations also showed a decrease in the amount of Shiga toxin from EHEC O157:H7 co-cultured with probiotic EcN, whereas the control strain MG1655 did not influence Shiga toxin production (Fig. 4).

Fig. 3. Microcin test. LB agar plates were evenly overlaid with 6 ml soft agar containing EHEC strains to be tested. After solidification, Blanc discs (5 mm dia) were placed on and 10 ␮l of E. coli Nissle were dropped. Plates were then incubated at 37 ◦ C for 18 h. Zone of inhibition around disc indicates anti-bacterial activity.

24

M. Mohsin et al. / International Journal of Medical Microbiology 305 (2015) 20–26

Table 3 Effect of EcN on Vero cytotoxicity CD50 titers of sterile supernatants of EHEC mono or co-culture (EcN or MG1655). The cytotoxicity was determined by measuring lactate dehydrogenase release from vero cells after 72 h. The CD50 titer was defined as the reciprocal of the highest dilution resulting in 50% cytotoxicity in Vero cells. Data are means ± standard deviation. 1 p < 0.05 vs EHEC monoculture 2 p < 0.05 vs EHEC:MG1655 co-culture. EHEC Serotypes

4h

24 h

EHEC O157:H7 O104:H4

EHEC:MG1655

652 ± 16.3* 35.6 ± 6.3

2

741 ± 17.7 35.9 ± 4.1

EHEC:EcN 607 ± 18.1 6.9 ± 2.9*1,2

EcN reduces cytotoxic effects The effects of sterile supernatants of EHEC with or without co-incubation with EcN or MG1655 were also compared for cytotoxicity against Vero cells. The cytotoxicity titer (CD50 ) of EHEC O104:H4 co-incubated with probiotic EcN was substantially reduced (5 and 2.8-fold at 4 and 24 h, respectively; p < 0.05) compared to CD50 titer of O104:H4 monoculture (Table 3). Co-incubation of EcN with EHEC O157:H7 showed a statistically significant decrease in CD50 titer (p < 0.05) at 24 h and a non-significant reduction at 4 h in contrast to EHEC O157:H7 monoculture (Table 3). Discussion EHEC serotype O157:H7 has traditionally been associated with severe disease conditions and epidemics. However, EHEC O104:H4 has also become a major public attention since the 2011 German outbreak. Due to the risk of serious disease complications such as HUS caused by increased release of Shiga toxin (Stx) after exposure to certain antimicrobial agents and growing concerns about antibiotic resistance (Bielaszewska et al., 2012; Pedersen et al., 2008), antimicrobial agents are not recommended in EHEC mediated infections. Probiotics may offer an alternative therapeutic option. E. coli Nissle 1917 (EcN) has been used as a probiotic in various gastrointestinal diseases (Henker et al., 2008; Kruis et al., 2004; Von Buenau et al., 2005). However, a possible role in EHEC-mediated infections has only rarely been studied. In the present study, we selected two of the most important EHEC strains, serotypes O104:H4 and O157:H7. The probiotic effect of EcN on EHEC strains was determined for different parameters including in vitro growth, Shiga toxin (stx1a /stx2a ) gene expression, Shiga toxin production and toxin biological activity (Vero cytotoxicity). EcN has previously been shown to significantly inhibit the growth of E. coli O157:H7 (Reissbrodt et al., 2009; Rund et al., 2013)

Fig. 4. Effect of EcN on Shiga toxin release from EHEC strains. Verotoxin-ELISA data showed a significant reduction of up to 86.1% in Stx production from EHEC O104:H4 co-incubated with EcN for 24 h. A decrease in the amount of Shiga toxin from EHEC O157:H7 co-cultured with probiotic EcN was also observed, whereas the control strain MG1655 did not influence Shiga toxin production. p < 0.05. a* = No toxin release at 4 h from EHEC O104:H4.

*2

EHEC

EHEC:MG1655

EHEC:EcN

856 ± 5.4 691 ± 12

790 ± 9.3 625 ± 6.9

429 ± 16*1,2 241 ± 7.3*1,2

and O104:H4 (Rund et al., 2013). The current study revealed similar trends in growth inhibition of EHEC absolute numbers (cfu/ml) as determined by real time PCR. The precise mechanism of this growth inhibition has not been investigated. EcN-linked outer membrane vesicles (OMVs) may be responsible for reduced growth of EHEC in co-culture experiment. In a recent study, EcN proteins released through these OMVs have been predicted to be involved in the probiotic effect such as adhesion to host cells, killing competing bacteria and immune modulating host cells. In silico analysis of 192 EcN outer membrane proteins showed 18 proteins linked to EcN only, being absent in K12 strain MG1655. Some proteins are related to iron uptake system and these could give an advantage to EcN to outgrow and compete with pathogens using similar siderophore, such as EHEC (Aguilera et al., 2014). Whether OMV-identified proteins involved in gene regulation interact with the tested EHEC bacteria remains speculative. The probiotic EcN is able to produce microcins that has antibacterial activities against other E. coli strains (Patzer et al., 2003). However, in our investigations microcins produced by EcN appeared not to be responsible for this inhibition (Fig. 3). These results are consistent with a previous study showing that microcins do not inhibit E. coli O157:H7 (Leatham et al., 2009). Shiga toxins are key virulence factors for EHEC and the stx genes are encoded in the genomes of lysogenic lambdoid bacteriophages (Karch et al., 1999; Smith et al., 2012). It has been well established that many factors contribute to induction of prophages and, consequently, toxin production. The EHEC O157:H7 harbors the genes for both stx1a and stx2a whereas the German outbreak O104:H4 only harbors the stx2a gene. The high degree of nucleotide similarity between the EHEC O157 and O104 prophages have been linked to a possible horizontal gene transfer (Beutin et al., 2013; Muniesa et al., 2012). Probiotics have previously been investigated for their effect on Shiga toxin genes transcription and regulation. Probiotic strains of Lactobacillus, Pediococcus and Bifidobacterium have been reported to down-regulate stx2 mRNA expression in EHEC O157:H7 and this down-regulation was linked to acetate production and decreased pH (Carey et al., 2008). Here, we demonstrate for the first time the effects of the probiotic Nissle 1917 strain on Shiga toxin gene expression from EHEC. Our results showed a significant decrease in Shiga toxin expression, in particular, Stx2a (Figs. 1 and 2). It has previously been reported that EHEC strains producing Stx2 are more frequently implicated in severe complications than Stx1 (Boerlin et al., 1999). In another study, stx2 mRNA transcription was shown to be down-regulated with human microbiota via repression of RecA transcription (de Sablet et al., 2009). Although we did not investigate RecA and SOS-related genes of EHEC in the present study, it is tempting to speculate that probiotic EcN may affect Shiga toxin gene transcription by repressing RecA activation independent of pH, as co-culture with non-probiotic E. coli MG1655 did not down-regulate toxin gene expression. Our results also suggest that stx gene down-regulation was associated with direct effects of EcN on gene transcription rather than reductions in EHEC numbers, as the gene expression studies were corrected for similar EHEC counts in the cultures incubated with or without probiotic before starting gene expression experiments. Further studies with respect to EcN effect on the expression of accessory virulence factors are needed.

M. Mohsin et al. / International Journal of Medical Microbiology 305 (2015) 20–26

The amount of Shiga toxin release is expected to be related to the level of Shiga toxin gene expression. To verify this, we also investigated the effects of EcN on Shiga toxin production in both EHEC O104:H4 and O157:H7 using Verotoxin-ELISA assays. The amount of toxin from EHEC O104:H4 was significantly reduced (86.1%) in 24 h co-culture experiments with EcN compared to monocultures. However, little or no amount of Shiga toxin was produced at 4 h. EHEC O104:H4 overall produced lower amounts of Shiga toxin compared to EDL933 (Laing et al., 2012). Our results are also in agreement with a recent study where EcN significantly reduced Stx2 amount from EHEC O104:H4 (Rund et al., 2013). EcN and another E. coli strain 1307 isolated from stool sample was shown to have significantly reduced growth and Shiga toxin amount regardless of Shiga toxin type or serotypes (Reissbrodt et al., 2009). Unlike EcN, E. coli 1307 lacks fitness factors/virulence factors which might promote the growth of pathogenic bacteria. In a recent study, EcN has been shown to significantly reduce the secretion of virulence associated proteins in atypical EPEC (Kleta et al., 2014). It was proposed that inhibitory actions of EcN could be based on interfering with global mechanisms of bacterial pathogenesis. Inhibition in Shiga toxin release may be an effective mechanism for prevention of EHEC infection and HUS. Future studies should focus on the mechanism of actions of EcN and E. coli 1307 on major EHEC serotypes and virulence gene expression. In the present study, the reduction in the amount of Stx was also observed in culture supernatants of EHEC O157:H7 co-cultured with EcN at both 4 and 24 h. However, while similar observations with EcN have previously been reported (Reissbrodt et al., 2009; Rund et al., 2013), these prior reports did not investigate stx gene expression. We proved reduction in stx gene expression after comparing the same numbers of CFU with and without probiotic incubation. Therefore, the down regulation of stx gene expression is a more potential factor for reduced Stx amount and verocytotoxicity as compared to reduced CFU. The Vero cytotoxicity assay remains the gold standard for determining the biological activity of Shiga toxin (Schmidt et al., 1999). Probiotic strains of Bifidobacteria and Lactobacilli have been reported to reduce Stx-induced cytotoxicity (Kim et al., 2006; Tahamtan et al., 2011). To the best of our knowledge, the probiotic EcN has never been studied for its effects against Shiga toxin-associated cytotoxicity. Significant decreases were found in CD50 titers of EHEC:EcN co-cultures compared to the cytotoxicity of EHEC alone. This effect is likely due to the reduced levels of Shiga toxin in the supernatants of EcN:EHEC co-cultures as shown in ELISA determinations. In all experiments, co-culture supernatants of EHEC and the control E. coli K-12 strain MG1655 showed no effects on CD50 titers (Table 3). In conclusion, our in vitro data suggest that probiotic EcN may limit EHEC infections by inhibiting both EHEC growth and Shiga toxin gene expression. These observations were also supported by data showing decreased amounts of Shiga toxin release and associated cytotoxicity. Reduction of Shiga toxin may be a first line of defense in HUS prevention for EHEC infected patients. Shiga toxin is an important mediator of HUS and strategies aimed at reducing Shiga toxin expression or its activity are expected to reduce HUS incidence. This is especially relevant considering that antibiotics are often contraindicated in EHEC infections. However, further studies are required to elucidate the factor/s responsible for its probiotic effect. On the basis of these findings, we suggest that the probiotic E. coli Nissle 1917 strain could be considered a potential therapeutic candidate for the amelioration of EHEC diseases, in particular caused by strains of serotypes O104:H4 and O157:H7. Acknowledgements Mashkoor Mohsin was supported by a Georg-Forster Research Fellowship for postdoctoral researchers from the Alexander von

25

Humboldt Foundation, Germany and this work was supported by the German Research Foundation (DFG) through grant SFB852/1 and the Federal Ministry of Education (BMBF) grant FBI-Zoo (01Kl1012A). References Altenhoefer, A., Oswald, S., Sonnenborn, U., Enders, C., Schulze, J., Hacker, J., Oelschlaeger, T.A., 2004. The probiotic Escherichia coli strain Nissle 1917 interferes with invasion of human intestinal epithelial cells by different enteroinvasive bacterial pathogens. FEMS Immunol. Med. Microbiol. 40, 223–229. Aguilera, L., Toloza, L., Giménez, R., Odena, A., Oliveira, E., Aguilar, J., Badia, J., Baldomà, L., 2014. Proteomic analysis of outer membrane vesicles from the probiotic strain Escherichia coli Nissle 1917. Proteomics 14, 222–229. Bauwens, A., Betz, J., Meisen, I., Kemper, B., Karch, H., Müthing, J., 2013. Facing glycosphingolipid–Shiga toxin interaction: dire straits for endothelial cells of the human vasculature. Cell. Mol. Life Sci. 70, 425–457, http://dx.doi.org/10.1007/s00018-012-1060-z. Bauwens, A., Bielaszewska, M., Kemper, B., Langehanenberg, P., von Bally, G., Reichelt, R., Mulac, D., Humpf, H.U., Friedrich, A.W., Kim, K.S., Karch, H., Müthing, J., 2011. Differential cytotoxic actions of Shiga toxin 1 and Shiga toxin 2 on microvascular and macrovascular endothelial cells. Thromb. Haemost. 10, 515–528, http://dx.doi.org/10.1160/TH10-02-0140. Betz, J., Bauwens, A., Kunsmann, L., Bielaszewska, M., Mormann, M., Humpf, H.-U., Karch, H., Friedrich, A.W., Müthing, J., 2012. Uncommon membrane distribution of Shiga toxin glycosphingolipid receptors in toxin-sensitive human glomerular microvascular endothelial cells. Biol. Chem. 393, 133–147. Beutin, L., Hammerl, J.A., Reetz, J., Strauch, E., 2013. Shiga toxin-producing Escherichia coli strains from cattle as a source of the Stx2a bacteriophages present in enteroaggregative Escherichia coli O104:H4 strains. Int. J. Med. Microbiol. 303, 595–602, http://dx.doi.org/10.1016/j.ijmm.2013.08.001. Bielaszewska, M., Idelevich, E.A., Zhang, W., Bauwens, A., Schaumburg, F., Mellmann, A., Peters, G., Karch, H., 2012. Effects of antibiotics on Shiga toxin 2 production and bacteriophage induction by epidemic Escherichia coli O104: H4 strain. Antimicrob. Agents Chemother. 56, 3277–3282. Bielaszewska, M., Mellmann, A., Zhang, W., Köck, R., Fruth, A., Bauwens, A., Peters, G., Karch, H., 2011. Characterisation of the Escherichia coli strain associated with an outbreak of haemolytic uraemic syndrome in Germany, 2011: a microbiological study. Lancet Infect. Dis. 11, 671–676. Boerlin, P., McEwen, S.A., Boerlin-Petzold, F., Wilson, J.B., Johnson, R.P., Gyles, C.L., 1999. Associations between virulence factors of Shiga toxin-producing Escherichia coli and disease in humans. J. Clin. Microbiol. 37, 497–503. Britton, R.A., Versalovic, J., 2008. Probiotics and gastrointestinal infections. Interdiscip. Perspect. Infect. Dis., 290769, http://dx.doi.org/10.1155/2008/290769. Buchholz, U., Bernard, H., Werber, D., Böhmer, M.M., Remschmidt, C., Wilking, H., Deleré, Y., an der Heiden, M., Adlhoch, C., Dreesman, J., 2011. German outbreak of Escherichia coli O104: H4 associated with sprouts. N. Engl. J. Med. 365, 1763–1770. Carey, C.M., Kostrzynska, M., Ojha, S., Thompson, S., 2008. The effect of probiotics and organic acids on Shiga-toxin 2 gene expression in enterohemorrhagic Escherichia coli O157: H7. J. Microbiol. Methods 73, 125–132. Chui, L., Couturier, M.R., Chiu, T., Wang, G., Olson, A.B., McDonald, R.R., Antonishyn, N.A., Horsman, G., Gilmour, M.W., 2010. Comparison of Shiga toxin-producing Escherichia coli detection methods using clinical stool samples. J. Mol. Diagn. 12, 469–475. de Sablet, T., Chassard, C., Bernalier-Donadille, A., Vareille, M., Gobert, A.P., Martin, C., 2009. Human microbiota-secreted factors inhibit shiga toxin synthesis by enterohemorrhagic Escherichia coli O157: H7. Infect. Immun. 77, 783–790. Henker, J., Laass, M.W., Blokhin, B.M., Maydannik, V.G., Bolbot, Y.K., Elze, M., Wolff, C., Schreiner, A., Schulze, J., 2008. Probiotic Escherichia coli Nissle 1917 versus placebo for treating diarrhea of greater than 4 days duration in infants and toddlers. Pediatr. Infect. Dis. J. 27, 494–499. Hoffmann, B., Depner, K., Schirrmeier, H., Beer, M., 2006. A universal heterologous internal control system for duplex real-time RT-PCR assays used in a detection system for pestiviruses. J. Virol. Methods 136, 200–209. Jacobi, C.A., Malfertheiner, P., 2011. Escherichia coli Nissle 1917 (Mutaflor): new insights into an old probiotic bacterium. Dig. Dis. 29, 600–607. Karch, H., Schmidt, H., Janetzki-Mittmann, C., Scheef, J., Kröger, M., 1999. Shiga toxins even when different are encoded at identical positions in the genomes of related temperate bacteriophages. Mol. Gen. Genet. MGG 262, 600–607. Karch, H., Tarr, P.I., Bielaszewska, M., 2005. Enterohaemorrhagic Escherichia coli in human medicine. Int. J. Med. Microbiol. 295, 405–418. Karmali, M.A., Gannon, V., Sargeant, J.M., 2010. Verocytotoxin-producing Escherichia coli(VTEC). Vet. Microbiol. 140, 360–370. Kim, Y., Han, K.S., Imm, J.Y., Oh, S., You, S., Park, S., Kim, S.H., 2006. Inhibitory effects of Lactobacillus acidophilus lysates on the cytotoxic activity of shigalike toxin 2 produced from Escherichia coli O157: H7. Lett. Appl. Microbiol. 43, 502–507. Kleta, S., Steinrück, H., Breves, G., Duncker, S., Laturnus, C., Wieler, L., Schierack, P., 2006. Detection and distribution of probiotic Escherichia coli Nissle 1917 clones in swine herds in Germany. J. Appl. Microbiol. 101, 1357–1366. Kleta, S., Nordhoff, M., Tedin, K., Wieler, L., Kolenda, R., Oswald, S., Oelschlaeger, T.A., Bleiß, W., Schierack, P., 2014. Role of F1 C fimbriae, flagella, and secreted bacterial

26

M. Mohsin et al. / International Journal of Medical Microbiology 305 (2015) 20–26

components in the inhibitory effect of probiotic Escherichia coli Nissle 1917 on atypical enteropathogenic E. coli infection. Infect. Immun. 82, 1801–1812. Konowalchuk, J., Speirs, J., Stavric, S., 1977. Vero response to a cytotoxin of Escherichia coli. Infect. Immun. 18, 775–779. Kruis, W., Friˇc, P., Pokrotnieks, J., Lukáˇs, M., Fixa, B., Kaˇscˇ ák, M., Kamm, M., Weismueller, J., Beglinger, C., Stolte, M., 2004. Maintaining remission of ulcerative colitis with the probiotic Escherichia coli Nissle 1917 is as effective as with standard mesalazine. Gut 53, 1617–1623. Laing, C.R., Zhang, Y., Gilmour, M.W., Allen, V., Johnson, R., Thomas, J.E., Gannon, V.P., 2012. A comparison of Shiga-toxin 2 bacteriophage from classical enterohemorrhagic Escherichia coli serotypes and the German E. coli O104: H4 outbreak strain. PLoS One 7, e37362. Leatham, M.P., Banerjee, S., Autieri, S.M., Mercado-Lubo, R., Conway, T., Cohen, P.S., 2009. Precolonized human commensal Escherichia coli strains serve as a barrier to E. coli O157: H7 growth in the streptomycin-treated mouse intestine. Infect. Immun. 77, 2876–2886. Maltby, R., Leatham-Jensen, M.P., Gibson, T., Cohen, P.S., Conway, T., 2013. Nutritional basis for colonization resistance by human commensal Escherichia coli strains HS and Nissle 1917 against E. coli O157:H7 in the mouse intestine. PLoS One 8, e53957. Mellmann, A., Harmsen, D., Cummings, C.A., Zentz, E.B., Leopold, S.R., Rico, A., Prior, K., Szczepanowski, R., Ji, Y., Zhang, W., 2011. Prospective genomic characterization of the German enterohemorrhagic Escherichia coli O104: H4 outbreak by rapid next generation sequencing technology. PLoS One 6, e22751. Mohsin, M., Haque, A., Ali, A., Sarwar, Y., Bashir, S., Tariq, A., Afzal, A., Iftikhar, T., Saeed, M.A., 2010. Effects of ampicillin, gentamicin, and cefotaxime on the release of Shiga toxins from Shiga toxin-producing Escherichia coli isolated during a diarrhea episode in Faisalabad, Pakistan. Foodborne Pathog. Dis. 7, 85–90. Mora, A., Blanco, J.E., Blanco, M., Alonso, M.P., Dhabi, G., Echeita, A., González, E.A., Bernárdez, M.I., Blanco, J., 2005. Antimicrobial resistance of Shiga toxin (verotoxin)-producing Escherichia coli O157: H7 and non-O157 strains isolated from humans, cattle, sheep and food in Spain. Res. Microbiol. 156, 793–806. Muniesa, M., Hammerl, J.A., Hertwig, S., Appel, B., Brüssow, H., 2012. Shiga toxinproducing Escherichia coli O104: H4: a new challenge for microbiology. Appl. Environ. Microbiol. 78, 4065–4073. O’Brien, A.D., Tesh, V.L., Donohue-Rolfe, A., Jackson, M.P., Olsnes, S., Sandvig, K., Lindberg, A.A., Keusch, G.T., 1992. Shiga toxin: biochemistry, genetics, mode of action, and role in pathogenesis. Curr. Top. Microbiol. Immunol. 180, 65–94. Patzer, S., Baquero, M., Bravo, D., Moreno, F., Hantke, K., 2003. The colicin G, H and X determinants encode microcins M and H47, which might utilize the catecholate siderophore receptors FepA, Cir, Fiu and IroN. Microbiology 149, 2557–2570.

Pedersen, M.G., Hansen, C., Riise, E., Persson, S., Olsen, K.E., 2008. Subtype-specific suppression of Shiga toxin 2 released from Escherichia coli upon exposure to protein synthesis inhibitors. J. Clin. Microbiol. 46, 2987–2991. Pennington, H., 2011. Escherichia coli O104, Germany 2011. Lancet Infect. Dis. 11, 652–653. Reissbrodt, R., Hammes, W.P., Dal Bello, F., Prager, R., Fruth, A., Hantke, K., Rakin, A., Starcic-Erjavec, M., Williams, P.H., 2009. Inhibition of growth of Shiga toxinproducing Escherichia coli by nonpathogenic Escherichia coli. FEMS Microbiol. Lett. 290, 62–69. Richter, A.M., Povolotsky, T.L., Wieler, L.H., Hengge, R., 2014. Cyclic-di-GMP signaling and biofilm-related properties of the Shiga toxin-producing 2011 German outbreak Escherichia coli O104:H4. EMBO Mol. Med., http://dx.doi.org/ 10.15252/emmm.201404309 [Epub ahead of print]. Rund, S.A., Rohde, H., Sonnenborn, U., Oelschlaeger, T.A., 2013. Antagonistic effects of probiotic Escherichia coli Nissle 1917 on EHEC strains of serotype O104:H4 and O157:H7. Int. J. Med. Microbiol. 303, 1–8. Schierack, P., Kleta, S., Tedin, K., Babila, J.T., Oswald, S., Oelschlaeger, T.A., Hiemann, R., Paetzold, S., Wieler, L.H., 2011. E. coli Nissle 1917 affects Salmonella adhesion to porcine intestinal epithelial cells. PLoS One 6, e14712. Schmidt, H., Geitz, C., Tarr, P.I., Frosch, M., Karch, H., 1999. Non-O157: H7 pathogenic Shiga toxin-producing Escherichia coli: phenotypic and genetic profiling of virulence traits and evidence for clonality. J. Infect. Dis. 179, 115–123. Shimizu, T., Ohta, Y., Noda, M., 2009. Shiga toxin 2 is specifically released from bacterial cells by two different mechanisms. Infect. Immun. 77, 2813–2823. Smith, D.L., Rooks, D.J., Fogg, P.C., Darby, A.C., Thomson, N.R., McCarthy, A.J., Allison, H.E., 2012. Comparative genomics of Shiga toxin encoding bacteriophages. BMC Genomics 13, 311. Tahamtan, Y., Kargar, M., Namdar, N., Rahimian, A., Hayati, M., Namavari, M., 2011. Probiotic inhibits the cytopathic effect induced by Escherichia coli O157: H7 in Vero cell line model. Lett. Appl. Microbiol. 52, 527–531. Tarr, P.I., Gordon, C.A., Chandler, W.L., 2005. Shiga-toxin-producing Escherichia coli and haemolytic uraemic syndrome. Lancet 365, 1073–1086. Von Buenau, R., Jaekel, L., Schubotz, E., Schwarz, S., Stroff, T., Krueger, M., 2005. Escherichia coli strain Nissle 1917: significant reduction of neonatal calf diarrhea. J. Dairy Sci. 88, 317–323. Wieler, L.H., Semmler, T., Eichhorn, I., Antao, E.M., Kinnemann, B., Geue, L., Karch, H., Guenther, S., Bethe, A., 2011. No evidence of the Shiga toxin-producing E. coli O104: H4 outbreak strain or enteroaggregative E. coli (EAEC) found in cattle faeces in northern Germany, the hotspot of the 2011 HUS outbreak area. Gut Pathog. 3, 17.