Proc. Nati. Acad. Sci. USA

Vol. 89, pp. 8011-8015, September 1992 Biochemistry

Primary structure, import, and assembly of the yeast homolog of succinate dehydrogenase flavoprotein (molecular cloning/mitochondrial biogenesis/Saccharomyces cerevisiae)

NORBERT SCHULKE*, GUNTER BLOBEL, AND DEBKUMAR PAIN The Rockefeller University, Laboratory of Cell Biology, Howard Hughes Medical Institute, New York, NY 10021

Contributed by Gunter Blobel, May 28, 1992

We have isolated a homolog for the flavoproABSTRACT tein subunit of succinate dehydrogenase [succinate:(acceptor) oxidoreductase, EC 1.3.99.1] from Saccharomyces cerevisiae and used the obtained peptide sequences to clone and characterize the corresponding gene. It contained an open reading frame of 1923 base pairs and encoded a protein of 640 amino acids (MA, 70,238) that showed -49% and -28% identity with the Escherichia coli and Baciflus subtilis enzymes, respectively. AU features of the FAD cofactor binding site were completely conserved. Comparison of the deduced protein sequence with the N-terminal sequence determined from the isolated protein revealed an N-terminal extension of 28 amino acids that presumably represents a mitochondrial signal sequence. After in vitro transcription and translation, the preprotein was efficiently imported into isolated yeast mitochondria, cleaved to its mature form, and assembled into the membrane-bound succinate dehydrogenase complex.

MATERIALS AND METHODS Purification of SDH-Fp from S. cerevisiae. Isolated mitochondria (100 mg of protein) were converted to mitoplasts (at 10 mg/ml) in HE buffer [20 mM Hepes-KOH, pH 7.4/5 mM EDTA/1 mM dithiothreitol (DTT)/1 mM phenylmethylsulfonyl fluoride (PMSF)/50 units of Trasylol per ml/5 pg each of antipain, chymostatin, leupeptin, and pepstatin per ml] and subsequently sonicated as described (5, 6). Aliquots (500 .ul) of the sonicated mitoplasts were layered over a 500-,ul cushion of 250 mM sucrose in HE buffer and centrifuged at 356,000 x g for 30 min at 4°C in a Beckman TL-100.2 fixed angle rotor. For salt extraction, the pellet fractions containing total mitochondrial membranes were resuspended in 4 ml of 0.5 M KOAc in HE buffer and incubated for 30 min. The samples (500-,l aliquots) were then centrifuged at 356,000 x g for 30 min at 4°C through a 250 mM sucrose cushion (500 ,ul each) in HE buffer containing 0.5 M KOAc. To extract peripheral membrane proteins, salt-extracted membranes were resuspended in 2 ml of 0.1 M sodium carbonate, pH 11.5/5 mM EDTA/1 mM DTT/1 mM PMSF/5 units of Trasylol per ml/5 ,Ag each of antipain, chymostatin, leupeptin, and pepstatin per ml and incubated for 30 min on ice. The carbonate extracted membranes (500-,ul aliquots) were centrifuged at 356,000 x g for 30 min at 4°C through a 250 mM sucrose cushion (500 ,ul each) containing 0.1 M sodium carbonate (pH 11.5), 5 mM EDTA, 1 mM DTT, 1 mM PMSF, 5 units of Trasylol per ml, and 5 ,ug each of antipain, chymostatin, leupeptin, and pepstatin per ml. The supernatant (including the cushion) contained peripheral membrane proteins, including SDH-Fp. CNBr Cleavage and Amino Acid Sequencing. Proteins of the carbonate extract were precipitated in 10% (wt/vol) trichloroacetic acid, fractionated by SDS/PAGE, transferred to a poly(vinylidine difluoride) membrane (Immobilon-P PVDF; Millipore), and stained as described (7). The protein band representing the putative yeast homolog of SDH-Fp was excised, destained in 50% (vol/vol) methanol and 10% (vol/ vol) acetic acid, air-dried, and subjected to sequencing on a gas-phase sequenator (Applied Biosystems). CNBr cleavage was performed as described for 2 h at room temperature (8). The cleavage products were separated by SDS/PAGE, transferred to a PVDF membrane, and processed for protein sequencing as described above. PCR and Cloning of the Gene. Degenerate sense [SDH-N1,

Four respiratory complexes in mitochondria transfer electrons from a donor substrate to an electron acceptor and the energy released during the electron transfer is used for synthesis of ATP (1). One of these is complex II or succinatecoenzyme Q reductase. The major component of this complex is succinate dehydrogenase [SDH; succinate:(acceptor) oxidoreductase, EC 1.3.99.1]. It catalyzes the oxidation of succinate to fumarate and transfers the released electrons to

ubiquinone. In beef heart mitochondria, SDH consists of two polypeptides. The catalytically active part is formed by two peripheral membrane proteins (1). The smaller of these two polypeptides (27 kDa) contains only iron-sulfur clusters and is referred to as the iron-sulfur protein. The larger component (70 kDa) contains the iron-sulfur clusters and, as the only subunit of the complex, covalently bound FAD. It is therefore referred to as flavoprotein (SDH-Fp). SDH is anchored to the inner mitochondrial membrane by two integral membrane proteins of 13.5 and 15.5 kDa, which are involved in transfer of electrons to ubiquinone (1). The primary structure of two prokaryotic representatives of the SDH family has been established (2, 3), but only a partial genomic clone of yeast SDH-Fp has been isolated by the PCR so far (4). In this paper, we describe the isolation and characterization of a full-length genomic clone for SDH-Fp from Saccharomyces cerevisiae.t The deduced amino acid sequence revealed high similarity with SDH-Fp from prokaryotic sources (2, 3). The in vitro translated SDH-Fp precursor was efficiently imported into isolated yeast mitochondria and processed to its mature form. Like the endogenous protein, imported SDH-Fp was associated with mitochondrial membranes.

5'-GCGAATTCGAAAC(C/T)CA(A/G)GGITC(A/C/G/ T)GT(A/C/G/T)AA(C/T)GG-3'] and antisense [SDH-C1, 5'-GCGTCGAC(A/G/T)AT(A/G)TG(A/G)TA(C/T)TT(A/ C/G/T)CC(A/G)TC(A/C/G/T)GC-3'; SDH-C2, 5'-

GCGTCGACGT(A/C/G/T)GTCAT(A/G)TA(A/G)TG(A/

Abbreviations: PMSF, phenylmethylsulfonyl fluoride; SDH, succinate dehydrogenase; SDH-Fp, flavoprotein subunit of SDH; STI, soybean trypsin inhibitor; DTT, dithiothreitol. *To whom reprint requests should be addressed. tThe sequence reported in this paper has been deposited in the GenBank data base (accession no. M94874).

The publication costs of this article were defrayed in part by page charge payment. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. §1734 solely to indicate this fact.

8011

8012

Biochemistry: Schiilke et al.

Proc. Nad. Acad. Sci. USA 89 (1992)

G/T)AT-3'] oligonucleotide primers containing additional restriction sites were synthesized according to the obtained amino acid sequences (see Fig. 2) and considering the codon usage for S. cerevisiae (9). PCR was performed as described (10). The amplification products of the expected length were isolated and subcloned into the EcoRI/Sal I sites of pBluescript SK(+) (Stratagene); then their sequence was determined (11). A 66-base-pair (bp) insert of one of the clones (pNS1) encoding the N-terminal peptide was used for further

studies. The [32P]dCTP-labeled insert of pNS1 was used to screen a genomic Agtll library of S. cerevisiae (12). The BamHI/ Dra I fragment of one of the plaque-purified clones (ANS7) corresponding to the entire coding region for SDH-Fp was subcloned into the BamHI/EcoRV sites of pBluescript SK(+) (designated as pNS15) and sequenced (11). DNA sequence analysis was performed by using the DNAstar software programs (DNAstar, Madison, WI). Import of SDH-Fp Precursor into Isolated Yeast Mitochondra. The plasmid pNS15 was linearized with Ava I and transcribed using the MEGAscript T3 in vitro transcription kit (Ambion, Austin, TX) for 4 h at 370C. 35S-labeled precursor was synthesized in a nuclease-treated rabbit reticulocyte cell-free system (Promega) following the manufacturer's protocol. Import of the precursor into isolated mitochondria (100 ,&g) was performed as described (6). After import, the samples were chilled on ice and incubated with various concentrations of trypsin in HS buffer (20 mM Hepes-KOH, pH 7.4/0.6 M sorbitol) for 30 min on ice. Trypsin digestion was stopped by addition of-60 1. of a mixture of soybean trypsin inhibitor (STI) (20 mg/ml)/Trasylol (100 units/ml)/0.5 mM PMSF in HS buffer. The samples were incubated on ice for 10 min and then diluted with 0.9 ml of HS buffer containing 0.1 mg of bovine serum albumin per ml and 0.2 mM PMSF. The mitochondria were collected by centrifugation at 16,000 x g for 2 min at 4°C. The pellet fractions were processed for SDS/PAGE and fluorography as described (13). Mitochondrial Subfractlonadon. After protein import and incubation with trypsin (at 0.1 mg/ml) mitochondrial pellets (200 ug for each treatment) were resuspended in 100 t1 df HE buffer containing 50 pg of STI per ml and 100 units of Trasylol per ml and alternatively subjected to three different treatments. The first sample was used to assess the membrane-bound state of the imported polypeptide. The resuspended mitochondria were diluted with 1 ml of HE buffer containing 50 pg of STI per ml and 100 units of Trasylol per ml, incubated on ice for 15 min, and sonicated as described above for isolation of the endogenous protein. The second sample was used to assess the salt extractibility of the imported protein from the mitochondrial membranes. After dilution and sonication (see above), 4 M NaCl was added to a final concentration of 0.5 M, and the sample was incubated for 15 min on ice. The third sample was used to assess the carbonate extractibility of the imported protein from the membranes. The resuspended mitochondria were diluted with 1 ml of 0.1 M sodium carbonate (pH 11.5) (containing 5 mM EDTA, 1 mM DTT, 1 mM PMSF, 5 units of Trasylol per ml, 50 Mg of STI per ml, and 5 pg each of antipain, chymostatin, leupeptin, and pepstatin per ml) and incubated for 15 min on ice. After the appropriate treatment, all samples were centrifuged at 356,000 x g for 20 min at 40C. The supernatant and pellet fractions were processed for SDS/PAGE and fluorography as described above. RESULTS Isolation of SDH-Fp and Partial Peptide Sequences. Isolation of the yeast homolog of SDH-Fp was based on the observation that SDH-Fp is -aperipheral membrane protein of complex II in the mitochondrial inner membrane (14). The size of the yeast SDH-Fp was expected to be 65-70 kDa by analogy to SDH-Fp from Escherichia coli, Bacillus subtilis,

I

4

i

-1

I

97.4 66.2 42.7

31.0 21 .5

14.4

vow

FIG. 1. Proteins of mitochondria and subfractions separated by SDS/PAGE and stained with Coomassie blue. Fractionation was done as described. Lanes: 1, size standards (kDa); 2, total mitochondria (20 Ag); 3, matrix and intermembrane space proteins (equivalent to 40 pg of mitochondria); 4, peripheral membrane proteins extracted by high salt (equivalent to 100 pg of mitochondria); 5, integral membrane proteins (equivalent to 40 pg of mitochondria); 6, carbonate extracted membrane proteins (equivalent to 100 pg of mitochondria). Arrow points to the yeast homolog of SDH-Fp in the carbonate extractable membrane protein fraction used for further study.

and beef heart mitochondria (1). Yeast mitochondrial membranes were subjected to sequential extractions with high salt and carbonate at pH 11.5. A subset of about 15 major proteins was extracted by carbonate (Fig. 1, lane 6) with one major protein in the 66-kDa region. Further fractionation by different chromatographic methods (ion-exchange, hydrophobic, and reversed-phase chromatography) showed no apparent contaminating proteins in this region as judged by SDS/ PAGE (data not shown). The N-terminal sequence (25 residues) of the 66-kDa polypeptide (see Fig. 2) showed no homology to known yeast proteins. However, peptide sequences obtained from CNBr-derived fragments (Fig. 2) were almost identical to positions 69-85 and 387-403 of SDH-Fp from E. coli. This suggested that the isolated protein indeed represented the yeast homolog of SDH-Fp. Sequencing of a Genotnic Clone for SDH-Fp. Two sets of PCR amplifications were performed with yeast genomic DNA as the template, SDH-N1 as the sense primer, and either SDH-C1 or SDH-C2 as the antisense primer (Fig. 2). Each reaction resulted in a single product of 66 and -400 bp, respectively (data not shown), suggesting that the peptide sequence corresponding to all three primers was contained within a single polypeptide. A yeast genomic Agtll library was screened for SDH-Fp using the 32P-labeled 66-bp probe. A BamHI/Dra I fragment (2923 bp) of the insert of one of the clones (ANS7) was sequenced (Fig. 3). Between the later assigned nucleotides 1 and 1923, it contained the entire coding region of the yeast homolog of SDH-Fp. In addition, a search

N-terminus

ZTQGSVNGSASRSADGICYNIIDNZY SDH-C1

SDH-N1

SDH-C2

CNBr 1

(X) ?DTVKGSDLGDQDSI

1111111

E. coli

CNBr 2

M

11

(M) ??GEAA?VSVHGANRLGAN

H1 E. coli

1111

YDTVKGSDYIGDQDAIEYMCKT

F

1111111111

AVGEIACVSVHGANRLGGN

FIG. 2. Partial sequences of the N terminus and of two CNBr fragments of the isolated yeast SDH-Fp homolog. Arrows denote location and direction of primers used in the PCR. Question marks indicate residues that could not be identified. Corresponding homologous sequences from E. coli are shown for comparison.

Proc. Natl. Acad. Sci. USA 89 (1992)

Biochemistry: Schulke et al.

GGATCCGGGCCTCTTCTATTGGTTGTTTGTTTGCTCAAACCCGTTATATA

-272 -2 22 - 111

CTAACCAGTAGTATACTTTGCACTT 3Z~TAGTAGACACP TTCAGGCATCCTCGACTCTAACCTTTTGCCACGTCGAGGCGGCTTGAAGCTTAAATAGCACE TCGATATTCTTTTCACTAATCTCCTCCCCAACCCCTTATTGAAGATAAAAAGAAAGAAAGAAAGAAAGAAAAAATCCAATTTCATAGTACGAAGAAGAACGAGAATAAAG

1 -28

ATG CTA TCG CTA AAA AAA TCA GCG CTC TCC AAG TTG ACT TTG CTC AGA AAC ACA AGA ACA TTT ACA TCG TCA GCT TTG GTG CGC met leu ser leu lys lys ser ala leu ser lys leu thr leu leu arg asn thr arg thr phe thr ser ser ala leu val arg

85 1

8013

VCAA

ACG CAG GGC TCT GTA AAC GGT TCC GCG TCC AGA TCT GCA GAC GGG AAG TAC CAC ATA ATA GAT CAC GAG TAT GAC TGT GTG

gin thr gin gly ser val asn gly ser ala ser arg ser ala asp gly lys tyr his ile ile asp his glu tyr asp cys val GTA ATC GGT GCC GGT GGT GCC GGC CTT AGA GCG GCC TTT GGT CTT GCC GAG GCG GGC TAC AAG ACT GCT TGT ATA TCC AAG CTT

169 29

val ile gly ala gly gly ala gly leu arg ala ala phe gly leu ala glu ala gly tyr lys thr ala cys ile ser lys leu

253 57

TTC CCC ACC AGA TCC CAC ACT GTT GCT GCT CAG GGT GGT ATC AAT GCC GCT CTG GGA AAT ATG CAC AAG GAT AAC TGG AAA TGG phe pro thr arg ser his thr val ala ala gin gly gly ile asn ala ala leu gly asn met his lys asp asn trp lys trp

337 85

CAT ATG TAC GAT ACT GTG AAA GGA TCT GAT TGG CTA GGT GAC CAG GAC TCC ATC CAT TAC ATG ACC AGG GAA GCG CCC AAA TCG his met tyr asp thr val lys gly ser asp trp leu gly asp gin asp ser ile his tyr met thr arg glu ala pro lys ser

421 113

ATC ATT GAA CTG GAA CAC TAT GGT GTT CCT TTT TCA AGA ACT GAA AAC GGT AAG ATC TAC CAA AGA GCC TTT GGT GGT CAG ACC ile ile glu leu glu his tyr gly val pro phe ser arg thr glu asn gly lys ile tyr gin arg ala phe gly gly gin thr

505 141

AAG GAG TAC GGT AAG GGT GCT CAG GCC TAT AGA ACA TGC GCT GTC GCA GAC AGG ACA GGA CAT GCT CTT TTA CAC ACG CTT TAT lys glu tyr gly lys gly ala gin ala tyr arg thr cys ala val ala asp arg thr gly his ala leu leu his thr leu tyr

589 169

GGC CAA GCT TTA AGA CAT GAC ACA CAT TTC TTT ATT GAG TAC TTT GCC CTC GAT CTG TTG ACC CAT AAT GGC GAG GTC GTT GGT gly gin ala leu arg his asp thr his phe phe ile glu tyr phe ala leu asp leu leu thr his asn gly glu val val gly

673 197

GTC ATC GCT TAT AAT CAG GAA GAC GGT ACC ATC CAC AGA TTC AGA GCA CAC AAG ACC ATT ATT GCC ACT GGT GGC TAT GGT AGA val ile ala tyr asn gin glu asp gly thr ile his arg phe arg ala his lys thr ile ile ala thr gly gly tyr gly arg

757 225

GCA TAC TTC TCT TGT ACC TCT GCT CAC ACA TGT ACG GGT GAC GGT AAT GCC ATG GTT TCG CGT GCT GGT TTC CCC TTG CAA GAT ala tyr phe ser cys thr ser ala his thr cys thr gly asp gly asn ala met val ser arg ala gly phe pro leu gin asp

841 253

TTA GAG TTT GTT CAA TTC CAT CCT TCA GGT ATA TAT GGG TCT GGT TGC TTA ATC ACT GAA GGT GCT CGT GGT GAA GGT GGT TTT leu glu phe val gin phe his pro ser gly ile tyr gly ser gly cys leu ile thr glu gly ala arg gly glu gly gly phe

925 281

TTG GTT AAT TCT GAA GGT GAA AGA TTC ATG GAA CGT TAC GCT CCT ACG GCC AAG GAT CTA GCT TGT AGA GAT GTC GTT TCC AGA leu val asn ser glu gly glu arg phe met glu arg tyr ala pro thr ala lys asp leu ala cys arg asp val val ser arg

1009 309

GCA ATC ACC ATG GAG ATC AGA GAA GGC AGA GGT GTT GGT AAG AAA AAG GAC CAC ATG TAC TTA CAA TTG AGC CAT CTA CCT CCG ala ile thr met glu ile arg glu gly arg gly val gly lys lys lys asp his met tyr leu gin leu ser his leu pro pro

1093 337

GAA GTT CTA AAG GAA AGA TTG CCA GGT ATC TCT GAA ACA GCA GCC ATT TTT GCT GGT GTA GAC GTC ACC AAG GAA CCT ATT CCC glu val leu lys glu arg leu pro gly ile ser glu thr ala ala ile phe ala gly val asp val thr lys glu pro ile pro

1177 365

ATT ATT CCT ACC GTC CAC TAT AAC ATG GGT GGT ATT CCC ACG AAG TGG AAT GGT GAG GCA TTA ACC ATT GAT GAA GAA ACT GGC ile ile pro thr val his tyr asn met gly gly ile pro thr lys trp asn gly glu ala leu thr ile asp glu glu thr gly

1261 393

GAA GAC AAG GTT ATT CCC GGT TTA ATG GCT TGT GGT GAA GCC GCT TGT GTT TCT GTC CAT GGT GCC AAT AGA TTA GGT GCC AAT glu asp lys val ile pro gly leu met ala cys gly glu ala ala cys val ser val his gly ala asn arg leu gly ala asn

1345 421

TCC TTG TTG GAT CTT GTT GTC TTT GGT CGT GCT GTT GCC CAT ACG GTT GCT GAC ACT TTA CAG CCT GGG TTG CCA CAC AAA CCA ser leu leu asp leu val val phe gly arg ala val ala his thr val ala asp thr leu gin pro gly leu pro his lys pro

1429 449

CTA CCT TCT GAT TTG GGT AAA GAA TCC ATC GCA AAC TTG GAT AAA CTA AGA AAT GCT AAT GGT TCA AGA TCT ACG GCA GAA ATT leu pro ser asp leu gly lys glu ser ile ala asn leu asp lys leu arg asn ala asn gly ser arg ser thr ala glu ile

1513 477

AGA ATG AAT ATG AAA CAA ACT ATG CAA AAG GAT GTT TCC GTC TTT AGA ACA CAA TCA TCT TTA GAT GAA GGT GTT CGG AAC ATT arg met asn met lys gin thr met gin lys asp val ser val phe arg thr gin ser ser leu asp glu gly val arg asn ile

1597 505

ACT GCA GTA GAG AAG ACC TTT GAT GAT GTG AAG ACG ACC GAT AGA TCA ATG ATC TGG AAT TCT GAC TTG GTT GAA ACT CTG GAG thr ala val glu lys thr phe asp asp val lys thr thr asp arg ser met ile trp asn ser asp leu val glu thr leu glu

1681 533

CTA CAG AAC TTA TTA ACC TGT GCC TCC CAA ACA GCT GTT TCC GCT GCT AAT AGA AAG GAA TCC CGT GGT GCT CAT GCA AGA GAG leu gin asn leu leu thr cys ala ser gin thr ala val ser ala ala asn arg lys glu ser arg gly ala his ala arg glu

1765 GAT TAT CCA AAT AGA GAT GAC GAA CAT TGG ATG AAG CAT ACA TTA TCC TGG CAA AAG GAC GTC GCT GCC CCA GTG ACT TTG AAA 561 asp tyr pro asn arg asp asp glu his trp met lys his thr leu ser trp gin lys asp val ala ala pro val thr leu lys 1849 589

1935 2046 2157 2268 2379 2490 2601

TAC AGA AGG GTT ATC GAT CAC ACT TTG GAC GAA AAG GAA TGT CCT TCC GTA CCT CCA ACT GTA AGA GCC TAC TAA TTTGAACCTCA tyr arg arg val ile asp his thr leu asp glu lys glu cys pro ser val pro pro thr val arg ala tyr *

TTGTATTTTACGGAAAAGAATATCATACTCTTCTTTAATTGCACTTTTTTTGTGCGTTTGCACTTTTTTACCACTGACTCACTAATTTGTATATATACCTATTAATATACA TTTACATAAAGTTTCTTCTTATACATACTCTATTTATTTAGTTATTTATTAACTTACTATTTATTTATTTATTTATTTATTTATTTATTACTTTCAATTTTTTATCGAGGC ATTTCCTTAGTTCTCCAATTTTTTTTCTCATTAGCCAGATGTGTGTTTTTCTGGCCCTCACAAAA

AATCACCACAACGTCATGGCGAACGTAAATATGTAACTAAA

AATTAAGATGGGCAGACATTTATCATTTTGCTTATGACTAAATTGCGAATTGCTGTACAAGGGTGCTGTCATGGTCAGCTAAACCAAATTTATAAAGAAGTGTCACGAATC CATGCGAAGACTCCCATCGATCTATTAATTATTCTTGGAGATTTTCAAAGTATTCGTGATGGTCAGGATTTTAAGTCAATAGCCATACCACCAAAATATCAAAGACTCGGT GATTTCATATCATACTACAATAATGAGATTGAAGCCCCAGTCCCTACTATTTTTATTGGCGGTAATCATGAATCGATGAGACATTTAATGCTTCTGCCACATGGTGGTTAT GTAGCAAAGAACATTTTTTATATGGGATACTCTAACGTTATATGGTTTMA

FIG. 3. Nucleotide sequence of the gene coding for the yeast homolog of SDH-Fp and its deduced amino acid sequence. The first nucleotide and the first amino acid residue of the mature protein are designated as position 1. Amino acid residues of the signal peptide are given by negative numbers. Stop codon is indicated by an asterisk. Arrowhead denotes the cleavage site for mitochondrial signal peptidase. TATA-like sequences (15) at positions -137 to -141 and -155 to -161 are boxed. Residues corresponding to peptide sequences obtained from isolated protein by Edman degradation (Fig. 2) are underlined (broken lines indicate unidentified residues). Open reading frame coding for the N-terminal part of the "debranching" enzyme (16) starts at position 2300.

of the GenBank data base (17) for homologous sequences at the 3' end of the insert revealed an open reading frame (from nucleotides 2300-2651) coding for part of the recently identified "debranching" enzyme (16). This indicates a side-by-side location of the two genes on the chromosome. Analysis of the Amino Acid Sequence of SDH-Fp. The 1923-bp open reading frame encoded a protein of 640 amino acids with a calculated molecular weight of 70,238. Compar-

ison of the deduced N-terminal amino acid sequence (Fig. 3) to the N-terminal sequence obtained by amino acid sequencing (Fig. 2) revealed an N-terminal extension of 28 amino acids in the predicted gene product. This presequence represents a typical mitochondrial signal sequence with a preponderance of basic (arginine and lysine) and hydroxylated (serine and threonine) residues and a lack of acidic residues (glutamic and aspartic acids). After translocation into the

S.

cere

E. B.

co/ I subt

S.

ceroe

E. B. S.

E. B.

S. E. B.

Proc. Nad. Acad. Sci. USA 89 (1992)

Biochemistry: Schulke et al.

8014

Y-' ' r.1HEYDVVIGAG-AGLPAA:'-

:- L. T...r7 { LLR R AL . FL-

i

; FDA VV -A GAG GGA

., AL _ Tv A;A GA NGI E-A:G: A'-' SZ K] F P TR S HV VAQG Nv_'iWkW7 W .^ Jt / T ,3QD. ';v col f ISG :. AL-.....S:KVFPTRSHTVSAQGGI': VALGNfT -E- DN -WEWHMYDTVKGSD':r- QD r 1 TVG'QDI 1 subt Vc; A: L'VPS KRSH;.ZHV2AQ(GT N(';AV7-.iY''7 --WE HEH'D-F.T. L

'

cere co/ i

subt cere

col i subt

SRTE IY F K-GK QA'-r R -iAD rLL-IvP K AC RT HA L HT,L`.:EL1,IiHMYGLPFSRL:L.EITYQRFCG.,Qs.'K1i r; --.", QAARTAAADRTGHALL ! '\7TCCQLLY7L: R1:-QC; . RxFG;--------A.,AVM

'

Y YAYIL I" 1 iN G WG~,77AYNC.E I F Rhi I: I A G Y R S.1 l i* IA... ARAVrLATGGAGRiYcs WYALDLVKNQDGAVVGCTI'AL C E G.Y FNAEINT.GDG*:: .; ,WFi/ ;AvL[)DrRrCRGTVAQN1T~rlQT :;Fy/--hvTMATG-PC~ii.&;TNi G

E B.

coil subt

r!E lQi P b~-IYG---c-L7- EGAP-GEUG'--- N^ GE"FMERvA- ---2-AKS}A< SR KD C R GEGG- >,^ r- NKHGERFMERYA- -p iAK7LA.-RD; ,I;'R, \we ,IEMWQFH P T -zAG--AG-VTE En-H/ TATP_-Gr:KLRLM7:Ec5.AFRGEGC;.T.. Y ....GI - -

S.

cere

-

B.

subt

S. cere

E. co/i

RLPGI :.7AIFAG-VD7KEP-PTTPk H.HMYYIGQLSHLPEVL-

.bi

-,

,

FIG. 4.

INMGG-(-TK

C LDLVV;FGRAVbrA v'*S. cere r; PGD:J"J p SLMACGEAACVSVS.ANRLGANlSL E. coi P:-C3W hFAl.7PGLFAVGEIACVSVTHANRLGGNSLLDLFWEGRAA- :subt GLFAAGECD-YS14HG(~~~~~~~NELETS~~~bS77Y7OMVA B. B. subt - ''|vrwIPGLFAAGECE"-S.Hf-yC-,NRL, -~SLLc',"-,' \'''.sE~s.vf+AGa A

Algmnt of SDH-Fp

homologs from S. cerevisiae, E.

VLFS R LP GI E. T:. `VD P VKEP I VP P TCH I .I T ---VYLZ';LSHK?`Pkr_! 'T--YE7'G-T '[-'

G. WG P: HPKT KL DH G

coli

(2), and B. subtilis (3). Num-

indicate amino right bers on the of each

w

protein start-

acid residue

S S: "A' Z~ing .S~';'r S -'.

;

i

either with the

iiitn

e

thionine (E. coli, B. subtilis) or NAN(SP.~~~~~3 cere ?AIIRYUMKQTMQKLVSVFR A" R;Is'a>-,' Te MSqQ P4L;.CK/.I-;`^. .M S. S. ce re 4;L!: :1S L RINAING c HS: VSVF R-; L: I L- ; ~~~~~with thefirst residue of the mature :ARK L.....SFFWDA A T c:E N E. V

-

col

B.

subt

S.

cere

E.

co I

i B.subtubt'

S. cere E. coil B.

subt

-

WI.

j

-->..

Arrow(S. cerevisiae). -head denotes signal peptidase

tet pror ,-,-in .->.swr. Vt-0lFS~gREI7. -KgLL.K -|Vsgs|Ra HKvL2w:;, ;F-

. - .:: AL S -;!'AVSAANREsJRGAMARX^9;D;YRD.DEIIWMKHTlI,-..r: ETLELQL`L. RR. EC L EL NL:-IL. -' L'AY AT AVSAliF'RT'ESRRAHS R D F'P RDRDDEMaWLCH'':R.: S ND:..........L...T......KH........>.......: FTP QFI.53-NML;TNfASRVY2L7AyYNP.NLE-S lGAHYKPDYP

cleavage site. Identical residues are shaded. Dashed lines indicate

-

.

identity.idpstmtdPoly-oy peptide sequences were aligned by

gaps...to -maximize

.

ECR:.,'__'VPP:V_IRA Y I.PTPAF'PKIrIy

using the AALIGN program of DNAstar software.

S ilP-RYS -. -,i:vA'

organelle, the presequence is cleaved off, generating the mature protein of 612 amino acids with a calculated molecular weight of 67,119. The amino acid sequence determined by N-terminal peptide sequencing differed at position 1 from the deduced mature sequence (glutamic acid instead of glutamine) of the mature protein. This may be due to strain differences of the yeasts used for isolation of the SDH-Fp protein and for constructing the Agtll library or to deamidation during sample preparation for peptide sequencing. The amino acid sequences for the two CNBr fragments (Fig. 2) derived from the isolated protein were found to be identical to the deduced sequence and correspond to residues 86-108 and 401-420 of the mature protein, respectively (Fig. 3). Comparison of the Yeast Homolog with SDH-Fp from Other Organisms. Sequence comparison of the yeast protein with the homologs inE. coli (2) and B. subtilis (3) revealed 49% and 28% identity, respectively. The FAD binding sites assigned to the N terminus of the prokaryotic enzymes (positions 10-66 in E. coli and positions 6-64 in B. subtilis) and to an internal segment (positions 358-387 in E. coli and positions 356-375 in B. subtilis) are well conserved in yeast (positions 27-83 and 374-404, respectively; Fig. 4). Histidine residues in SDH-Fp have been postulated to perform a proton donor-acceptor function in the electron transfer reaction (18). A- total of six histidines have been conserved in the three homologs of SDH-Fp. These include His-62 in yeast (Fig. 4), which is presumably involved in the covalent attachment of flavin (2, 3, 19), and His-259 in the tripeptide His-Pro-Ser (positions 259-261 in yeast; Fig. 4), which is very similar to the tentatively assigned active site His-Pro-Thr found in disulfide oxidoreductases (20). It has also been suggested that a thiol group is essential for SDH-Fp activity, substrate binding, or both (21). However, none of the cysteine residues is conserved in the three homologs. Cys-257 in SDH-Fp and Cys-248 in fumarate reductase (an enzyme that catalyzes the reverse reaction in vivo) of E. coli have been proposed to be essential for activity (2).

However, this cysteine is replaced by alanine, in both yeast (position 274) and B. subtilis (position 253). It is noteworthy that a striking difference is found only in the N termini of the SDH-Fp homologs (Fig. 4). The yeast homolog is synthesized as a precursor on cytoplasmic ribosomes and has to be imported specifically into mitochondria. The N-terminal extension presumably serves as a mitochondrial signal sequence that is not present in the prokaryotic SDH-Fp (Fig. 4). 35SIn Vitro Import and Mtohdria labeled SDH-Fp precursor was synthesized in a reticulocyte cell-free translation system (Fig. 5, lane 2). When incubated with isolated mitochondria, the precursor was efficiently imported and processed to its mature form (lane 3). The mature form, but not the precursor, sedimenting with the mitochondria was resistant to externally added trypsin (lanes 4-8). Only in the presence of detergent was the mature form degraded (lane 9). Like endogenous SDH-Fp, most of the imported ___

Xu

o

E

ur

mg/ml Trypsin

o c:

o

--

-

c

pSBH-i p

mSUH-Fp

1

2

3

4

5

6

7

8

9

FIG. 5. Import of pSDH-Fp into isolated yeast mitochondria. Mitochondria were incubated with rabbit reticulocyte lysate containing the newly synthesized pSDH-Fp, sedimented, and subsequently treated with the indicated concentrations of trypsin. Lanes: 1, 14C-labeled bovine serum albumin as size standard (kDa); 2, 50% of pSDH-Fp used for each import experiment; 3, mitochondrial pellet after import; 4-8, mitochondrial pellets after postimport treatment with the indicated concentration of trypsin; 9, mitochondrial pellet after postimport treatment with trypsin (1 mg/mi) in the presence of 0.5% Triton X-100. pSDH-Fp, precursor form of SDH-Fp; mSDHFp, mature form of SDH-Fp.

Biochemistry: Schfilke et al. 0.1 mg/ml Trypsin

-a

_0

la

Proc. Natl. Acad. Sci. USA 89 (1992) .

x

_ ° _, q

U,

pSOH-Fp

m~fw..-.s..

mSDH-Fp

:.

5 6 7 8 9 FIG. 6. Submitochondrial localization of imported SDH-Fp. After protein import and trypsin treatment (at 0.1 mg/ml), mitochondria

1

2

3

4

sonicated and incubated, in the absence of salt, in the presence of 0.5 M NaCl, or in the presence of 0.1 M sodium carbonate (pH 11.5). Incubation mixtures were sedimented to yield supernatant (S) and pellet (P) fractions. Lanes: 1, 50%o of the pSDH-Fp used for each import experiment; 2, mitochondrial pellet after import; 3, mitochondrial pellet after postimport treatment with trypsin; 4-9, supernatant (S) and pellet (P) fractions of mitochondrial membranes. pSDH-Fp, precursor form of SDH-Fp; mSDH-Fp, mature form of SDH-Fp.

were

protein was associated with mitochondrial membranes (Fig. 6, compare lanes 4 and 5). The imported membrane-associated protein could be extracted from the membranes at alkaline pH (lanes 8 and 9) but not by high salt (compare lanes 4 and 5 with lanes 6 and 7), suggesting that the imported protein was assembled as a peripheral membrane protein.

DISCUSSION The primary structure of SDH-Fp has previously been determined from two prokaryotes, E. coli (2) and B. subtilis (3). Here we report the primary structure of yeast mitochondrial SDH-Fp deduced from the DNA sequence of a genomic clone. The yeast mitochondrial SDH-Fp contains a typical N-terminal signal sequence that is cleaved after import into mitochondria. The primary structure of the resulting "mature" form of the protein is 49% and 28% identical when compared to E. coli and B. subtilis, respectively. The prokaryotic proteins are only 32% identical to each other. Maximum identity was found at the N terminus of the mature proteins that contain the flavin attachment site. All the components of the FAD-binding fold were highly conserved. Comparison of different FAD-binding proteins revealed a structural motif ((-sheet/a-helix/p-sheet) to be involved in the interaction with the AMP portion of the FAD cofactor (22). Amino acids present in the yeast homolog at positions 27-54 are capable of forming such a (3a,8 motif (Fig. 4). The second region presumably interacting with the AMP portion of FAD was located in yeast at positions 374-404 (Fig. 4). The covalent attachment site for the flavin cofactor in SDH-Fp of beef heart mitochondria was identified to be a histidine at the N terminus (19). Such a histidine residue is found in the yeast protein at position 62 (Fig. 4). In addition to His-62, other conserved histidine residues of SDH-Fp might be involved in a proton donor-acceptor function (18, 23). For example, the tripeptide His-Pro-Thr of the bacterial SDH-Fp is thought to be present in or near the active site by analogy to another flavin-containing enzyme disulfide oxidoreductase (2, 3, 20). Such a tripeptide is also present in the yeast protein (His-Pro-Ser at positions 259-261), the only difference being the conservative replacement of threonine by serine (Fig. 4). The enzymatic activity of several Fp homologs from different species is sensitive toward thiol-modifying reagents (2, 21). Inactivation ofthe enzymes can be prevented by malonate and other substrate analogs. Cys-257 in the E. coli protein has been tentatively assigned to be essential for activity (2). In contrast, the B. subtilis enzyme is insensitive toward thiol-modifying reagents and this particular cysteine is replaced by alanine (3).

8015

Such a Cys-Ala replacement is also found in the yeast protein (Fig. 4), suggesting a comparable insensitivity toward thiol modification. This remains to be shown. Another possibility is that the observed inhibition of activity of the E. coli enzyme by thiol-modifying reagents results from a secondary effecte.g., blocking accessibility ofthe substrate to the nearby active site by steric hindrance. Consistent with this possibility is the observation that the arginine following the cysteine (in E. coli) or the alanine (in B. subtilis) cannot be replaced by any other amino acid without loss of enzymatic activity (24). The cloned yeast gene is an additional useful tool to address questions like posttranslational modification (cofac-

tor attachment), import into mitochondria, and subsequent assembly into a functionally active complex. As a first step toward these goals, we have tested the import of SDH-Fp

precursor into isolated yeast mitochondria. The protein was efficiently imported, processed to its mature form, and assembled into a peripheral membrane-bound state, consistent with its proper location as a member of complex II at the inner mitochondrial membrane.

Note Added in Proof. Robinson and Lemire (25) have recently published the sequence for the yeast SDH-Fp gene. This sequence has an identical open reading frame to that given in this paper. However, the following discrepancies were noted in the 3' noncoding region: insertion of C at position 1997 in our sequence and replacement of CC by TT in our sequence at positions 2310 and 2311. We thank R. Young (Whitehead Institute, Cambridge, MA) for his yeast Agtl1 library; S. Mische and The Rockefeller University Protein Sequencing Facility for carrying out the protein sequence determinations and synthesis of oligonucleotides; and Drs. K. Bauer, R. Erdmann, H. Murakami, C. Nicchitta, and D. Schnell for their

help on PCR, molecular cloning, fruitful discussions, and critical reading of the manuscript. N.S. was supported by a postdoctoral fellowship of the Deutsche Forschungsgemeinschaft. 1. Hatefi, Y. (1985) Annu. Rev. Biochem. 54, 1015-1069. 2. Wood, D., Darlinson, M. G., Wilde, R. J. & Guest, J. R. (1984) Biochem. J. 222, 519-534. 3. Phillips, M. K., Hederstedt, L., Hasnain, S., Rutberg, L. & Guest, J. R. (1987) J. Bacteriol. 169, 864-873. 4. Robinson, K. M., von Kieckebusch-Guck, A. & Lemire, B. D. (1991) J. Biol. Chem. 266, 21347-21350. 5. Murakami, H., Pain, D. & Blobel, G. (1988) J. Cell Biol. 107,

2051-2057. 6. Pain, D., Murakami, H. & Blobel, G. (1990) Nature (London) 347, 444 449. 7. Schnell, D., Blobel, G. & Pain, D. (1990) J. Cell Biol. 111, 1825-1838. 8. Nikodem, V. & Fresco, R. (1979) Anal. Biochem. 97, 382-386. 9. Maruyama, T., Gojobori, T., Aota, S. & Ikemura, T. (1986) Nucleic Acids Res. 14, rlSl-r197. 10. Murakami, H., Blobel, G. & Pain, D. (1990) Nature (London) 347, 488-491. 11. Sanger, F., Nicklen, S. & Coulson, A. R. (1977) Proc. Natl. Acad. Sci. USA 74, 5463-5467. 12. Sambrook, J., Fritsch, E. F. & Maniatis, T. (1989) Molecular Cloning: A Laboratory Manual (Cold Spring Harbor Lab., Cold Spring Harbor, NY), 2nd Ed. 13. Waters, M. G. & Blobel, G. (1986) J. Cell Biol. 102, 1543-1550. 14. DePierre, J. W. & Ernster, L. (1977) Annu. Rev. Biochem. 46, 201-262. 15. Struhl, K. (1987) Cell 49, 295-297. 16. Chapman, K. B. & Boeke, J. D. (1991) Cell 65, 483-492. 17. Bilofsky, H. S. & Burks, C. (1988) Nucleic Acids Res. 16, 1861-1864. 18. Vik, S. B. & Hatefi, Y. (1981) Proc. Natl. Acad. Sci. USA 78, 6749-6753. 19. Kenney, W. C., Walker, W. H. & Singer, T. P. (1972) J. Biol. Chem. 247, 4510-4513. 20. Rice, D. W., Schultz, G. E. & Guest, J. R. (1984) J. Mol. Biol. 174, 483-496. 21. Kenney, W. C., Mowery, P. C., Seng, L. R. & Singer, T. P. (1976) J. Biol. Chem. 251, 2369-2373. 22. Wierenga, R. K., Terpstra, P. & Hol, W. G. J. (1986) J. Mol. Biol. 187, 101-107. 23. Hederstedt, L. & Hatefi, Y. (1986) Arch. Biophys. Biochem. 247, 346-354. 24. Hederstedt, L. & Heddn, L. -. (1989) Biochem. J. 260, 491-497. 25. Robinson, K. M. & Lemire, B. D. (1992) J. Biol. Chem. 267, 10101-10107.