Gene Therapy (2014) 21, 751–758 © 2014 Macmillan Publishers Limited All rights reserved 0969-7128/14 www.nature.com/gt
ORIGINAL ARTICLE
Prevention of hypoxic pulmonary hypertension by hypoxia-inducible expression of p27 in pulmonary artery smooth muscle cells Y Luo1,2,3,4,5, B Zhang4,5, H-Y Dong4,5, Y Liu4,5, Z-C Li4,5, M-Q Dong4,5 and Y-Q Gao1,2,3 Hypoxia-induced proliferation of pulmonary artery smooth muscle cells (SMCs) is important in the development of hypoxic pulmonary hypertension (HPH). We constructed a lentivirial vector containing a smooth muscle-specific promoter and six copies of hypoxia response element to co-drive the expression of p27, the key cyclin-dependent kinase inhibitor that blocks the G1 to S phase transition in cell cycle progression, in pulmonary artery SMCs in hypoxia. Then in vivo we examined the prevention effects of the vector on HPH in mice and in vitro the specificity on the hypoxia-inducible expression of p27 in pulmonary artery SMCs. Hypobaric hypoxia for 4 weeks resulted in significant increases in the right ventricular systolic pressure, the ratio of right ventricle to left ventricle plus septal weight and the muscularization of pulmonary vessels in mice. Administration of the vector before hypoxia significantly prevented the effects of hypoxia. In vitro, the vector exhibited hypoxic inducibility and relatively specific expression in pulmonary artery SMCs, inhibited the hypoxia-induced proliferation of pulmonary artery SMCs and arrested more cells at G0/G1 phase. These results demonstrate that the hypoxia-inducible p27 expression prevents the development of HPH in mice. Gene Therapy (2014) 21, 751–758; doi:10.1038/gt.2014.49; published online 29 May 2014
INTRODUCTION Hypoxic pulmonary hypertension (HPH) is still a fatal disease characterized by progressive pulmonary artery constriction and remodeling. The remodeling in pulmonary arteries, which is mainly caused by the hypoxia-induced aberrant proliferation of pulmonary artery smooth muscle cells (PASMCs), leads to the persistent increase in pulmonary vascular resistance and deterioration of HPH. Therefore, the inhibition of hypoxia-induced PASMC proliferation may prevent pulmonary artery remodeling and the progress of HPH. The cell proliferation is controlled by the interaction of cyclindependent kinases (CDKs) and CDK inhibitors. P27 (p27kip1) is the key CDK inhibitor that blocks the G1–S transition in cell cycle progression and is involved in the regulation of diverse cell proliferation, including PASMCs.1–6 Yu et al.7,8 found that p27 was the only CDK inhibitor involved in the inhibition of heparin on PASMC proliferation and HPH in mice. We also found that p27 is necessary for the inhibition of tanshinone IIA on the hypoxiainduced PASMC proliferation and the pulmonary artery remodeling in rats.9,10 Therefore, we hypothesize that p27 may provide a specific target for the prevention and treatment of the diseases induced by aberrant proliferation of PASMCs as HPH. For the diseases lacking effective therapies such as HPH, gene therapy may be an alternative.11 However, one of the fundamental problems of gene therapy is the lack of ideal methods to control transgene expression accordingly and specifically. In general, non-specific overexpression of therapeutic genes may induce
off-target effects. Therefore, general overexpression of p27 may induce the cell cycle dysfunction of the non-target cells such as hematopoietic stem/progenitor cells and weaken the tissues and cell repair ability.12,13 Hypoxia is a potent signal regulating the expression of various genes, including erythropoietin and vascular endothelial growth factor, by stabilizing the transcriptional complex hypoxia-inducible factor 1-alpha (HIF1-alpha). HIF1-alpha binds to the consensus sequence of hypoxia-response element (HRE) in the flanking region of the hypoxia-regulated genes and promotes these genes’ expression. Therefor, hypoxia can be exploited to specifically activate the transgene expression driven by HRE and/or HIF1-alpha system in the tissues of low oxygen tension.14 Hypoxia is also the trigger of hypoxic PASMC proliferation, pulmonary artery remodeling and the leading cause of HPH, hence hypoxia-inducible expression of target gene in PASMCs may be a feasible strategy for HPH gene therapy. In the present study, we constructed a hypoxia-inducible and SMC-specific lentivirial vector via combining a SM22 promoter and six copies of HRE, which is designed to co-drive the long-term expression of p27 mainly in PASMCs at low oxygen tension. Then in vivo we examined the prevention of the vector on HPH in mice and in vitro the specificity of target expression of p27 in PASMCs and the inducibility of hypoxia. The results showed that the constructed vector exhibited the hypoxia-inducible expression of p27 in PASMCs and significantly prevented the development of HPH in mice.
1 Department of Pathophysiology and High Altitude Physiology, Third Military Medical University, Chongqing, China; 2Key Laboratory of High Altitude Medicine, Ministry of Education, Third Military Medical University, Chongqing, China; 3Key Laboratory of High Altitude Medicine, PLA, Third Military Medical University, Chongqing, China; 4Department of Pathology and Pathophysiology, Fourth Military Medical University, Xi’an, China and 5Lung Injury and Repair Center, Fourth Military Medical University, Xi’an, China. Correspondence: Dr Y-Q Gao, Department of Pathophysiology and High Altitude Physiology, Third Military Medical University, Chongqing, China or Dr M-Q Dong, Department of Pathology and Pathophysiology, Fourth Military Medical University, Changle West Road 169, Xi’an 710032, China. E-mail: [email protected] or [email protected] Received 18 September 2013; revised 25 March 2014; accepted 11 April 2014; published online 29 May 2014
Hypoxia-inducible expression of p27 prevents HPH Y Luo et al
752
RESULTS Lenti-HSP27 exhibited hypoxia-inducible expression of p27 in PASMCs The cell specificity and hypoxia inducibility of the Lenti-HSP27 vector were tested in vitro. The Lenti-HSP27 or Lenti-empty was transducted into PASMCs, pulmonary artery fibroblasts, pulmonary microvascular endothelial cells and pulmonary alveolar epithelial cells via lentivirus infection. The expression of p27-flag was confirmed by immunofluorescence staining and western blotting with anti-flag antibody. Immunofluorescence staining showed that in normoxia the weak positive green staining was seen only in PASMCs but not in fibroblasts, endothelial cells or pulmonary alveolar epithelial cells (21% O2) (Figure 1b). Western blotting showed that the expression level of p27-flag was significantly higher in PASMCs than in the other three cells in normoxia (Figures 1c and d), but a lower level expression of p27-flag was also detected in fibroblasts and pulmonary microvascular endothelial cells, suggesting that the weaker activity of SM22 promoter exists in these two cells. Figure 2a further showed that hypoxia (3%) significantly increased the expression of p27-flag in the Lenti-HSP27 but not Lenti-SP27-infected PASMCs. Furthermore, the expression of p27-flag in the Lenti-HSP27-infected PASMCs is oxygen concentration-dependent: the lower the oxygen concentration, the higher the expression level (Figures 2b and c). These results demonstrated that the SM22 promoter and HREs cooperated, and the constructed Lenti-HSP27 drove the higher expression of the target p27-flag in PASMCs. Lenti-HSP27 exhibited obvious hypoxia inducibility owing to the HREs. Lenti-HSP27 inhibited hypoxia-induced proliferation of rat primary PASMCs and arrested more cells at G0/G1 phase in vitro Then we assessed the effects of Lenti-HSP27 on the cell cycle and the proliferation of rat primary PASMCs in normoxia (21% O2) and in hypoxia (3% O2). Hypoxia promoted PASMCs to enter the cell mitosis cycle and decreased the cell number of PASMCs in the G0/ G1 phase (from 58.1 ± 5.7% to 34.0 ± 6.2%). Lenti-HSP27 totally prevented the effects of hypoxia on the PASMCs cell cycle as it arrested more PASMCs in G1/G0 phase (from 34.0 ± 6.2% to 79.7 ± 9.1%) (all P o 0.05, n = 3, Figure 3a). MTT (3-(4, 5-dimethylthiazal-2-yl)-2, 5-diphenyltetrazoliumbromide) and cell count assay showed that hypoxia significantly accelerated the proliferation of PASMCs, whereas Lenti-HSP27 significantly inhibited the hypoxia-induced proliferation of PASMCs (Figures 3b and c). Lenti-HSP27 had no significant effects on the cell cycle and the proliferation of PASMCs in normoxia (Figure 3). Lenti-HSP27 prevented the HPH development in mice We then explored whether Lenti-HSP27 administration would prevent the development of HPH in mice. Hypoxia for 4 weeks resulted in a significant increase of right ventricle systolic pressure (RVSP; from 28.9 ± 3.2 to 52.9 ± 5.6 mm Hg) and the ratio of RV/(LV+S) (from 0.22 ± 0.02 to 0.42 ± 0.06), which were significantly prevented by Lenti-HSP27 administration (from 52.9 ± 5.6 to 37.3 ± 5.1 for RVSP and from 0.42 ± 0.06 to 0.28 ± 0.04 for the ratio of RV/(LV+S); all P o0.05, n = 6, Figure 4). However, Lenti-HSP27 had no significant effects on the RVSP and the ratio of RV/(LV+S) in normoxia (Figure 4). The hematoxylin and eosin staining of lung tissues are shown in Figure 5a. The obvious muscularization of pulmonary arterioles, which is shown as the increased number of arteries in the lung in the same magnification field, was seen in H+Lenti-empty group mice. Lenti-HSP27 administration decreased the number of arteries in lung in HPH mice. The summarized data of the muscularization and the wall thickness of pulmonary arteries/ arterioles are shown in Figures 5b and c respectively. Lenti-HSP27 administration attenuated the hypoxia-induced thickness of Gene Therapy (2014) 751 – 758
Figure 1. Lenti-HSP27 expressed the highest level of p27-flag in PASMCs in normoxia. (a) The diagram of the constructed vectors. (b, c) Representative immunofluorescence staining (b) and western blotting (c) of p27-flag in PASMCs, pulmonary artery fibroblasts (PAFs), pulmonary microvascular endothelial cells (ECs) and alveolar epithelial cells (AECs) in normoxia. The positive immunofluorescence staining is in green. Beta-actin was used as an internal control. (d) Summarized western blotting data from three independent experiments. The data were normalized by dividing the protein level in PASMCs. Data are represented as mean ± s.e.m. *P o0.05 vs PASMCs group.
medial walls and the muscularization of pulmonary arterioles. In the N+Lenti-empty group, the nonmuscularized and fully muscularized arterioles were 70.1 ± 9.1% and 6.3 ± 1.0%, respectively. In contrast, the HPH mice showed a greater proportion of fully © 2014 Macmillan Publishers Limited
Hypoxia-inducible expression of p27 prevents HPH Y Luo et al
753
Figure 2. Lenti-HSP27 exhibited hypoxia-inducible expression of p27-flag in PASMCs. Representative immunofluorescence staining (a) and western blotting (b) for p27-flag in PASMCs infected with Lenti-HSP27 and Lenti-SP17 under different oxygen concentrations (21% and 3%). The positive immunofluorescence staining is in green. Beta-actin was used as a control. Summarized data from three experiments are shown in panel (c). The data were normalized by dividing the protein level at 21% O2. Lenti-HSP27 expressed p27-flag in an oxygen-concentration-dependent manner in PASMCs. Data are represented as mean ± s.e.m. *P o0.05 vs 21% O2 group.
muscularized arterioles (51.5 ± 4.8%) and a lower proportion with nonmuscularization (18.9 ± 1.7%) in the lungs. Lenti-HSP27 significantly reduced the percentage of fully muscularized arterioles (17.4 ± 3.0%) and increased the percentage of nonmuscularized vessels (59.3 ± 8.6%; all P o 0.05, n = 60), whereas Lenti-HSP27 administration had no significant effects on the medical wall thickness and the muscularization of pulmonary arterioles in the normoxia group mice (Figures 5a–c). Lenti-HSP27 prevented the hypoxia-induced decrease of p27 expression in the pulmonary arteries in HPH mice We isolated the pulmonary arteries and measured the effects of hypoxia and Lenti-HSP27 administration on the expression of p27 in the pulmonary arteries. Western blotting results showed that hypoxia significantly decreased the expression of p27 by 52% (P o 0.05, n = 3). Lenti-HSP27 administration significantly increased © 2014 Macmillan Publishers Limited
Figure 3. Effects of Lenti-HSP27 on the cell cycle and the proliferation of PASMCs in hypoxia. (a) Effects of Lenti-HSP27 on the cell cycle in hypoxia (3% O2). Hypoxia decreased the cell number of PASMCs in the G0/G1 phase, whereas Lenti-HSP27 significantly increased the cell number in G0/G1 phase in hypoxia. (b, c): Effects of Lenti-HSP27 on the proliferation of PASMCs in hypoxia. The results of MTT assay (b) and cell counting (c) showed that hypoxia promoted the proliferation of PASMCs, whereas Lenti-HSP27 significantly inhibited the hypoxia-induced proliferation of PASMCs. Lenti-HSP27 had no obvious effect on the cell cycle and the proliferation of PASMCs in normoxia (21% O2). N: normoxia; H: hypoxia (the same in the following figures). Data are represented as mean ± s.e.m. and from three replicated experiments. *P o0.05 vs N+Lenti-empty group; #Po0.05 vs H+Lenti-emtpy group.
the expression of p27 by fourfold in hypoxia (P o 0.05, n = 3) but had no such effect in normoxia (Figure 6). These results showed that Lenti-HSP27 in vivo drove the expression of p27-flag in pulmonary arteries mainly in hypoxia but not in normoxia. Gene Therapy (2014) 751 – 758
Hypoxia-inducible expression of p27 prevents HPH Y Luo et al
754
Figure 4. Effects of Lenti-HSP27 on the prevention of HPH. Mice were injected with Lenti-HSP27 or Lenti-empty lentivirus via tail vein according to the grouping. Then the animals were maintained in normoxia or hypoxia environments for 4 weeks. Effects on RVSP (a) and RV/(LV+S) (b). Data are represented as mean ± s.e.m. *Po 0.05 vs N+Lenti-empty group; #P o0.05 vs H+Lenti-empty group (n = 6).
Lenti-HSP27 exhibited the specific expression of p27-flag in the pulmonary artery wall in HPH mice We further examined the cellular and organ distribution of p27flag fusion protein in HPH mice administered with Lenti-HSP27 or Lenti-empty via immunohistochemical staining of the tissue sections from the heart, liver, kidney and lung with anti-flag antibody. The representative staining is shown in Figure 7. The positive brown yellow staining was seen in the lung (mainly in the pulmonary artery wall) from the HPH mice administered with Lenti-HSP27 but not with Lenti-empty. No obvious positive staining was seen in the vessels in the heart, liver and kidney in HPH mice administered with either Lenti-HSP27 or Lenti-empty. These results demonstrated that Lenti-HSP27 exhibited the specific expression of p27-flag in the pulmonary artery wall in HPH mice. Lenti-HSP27 showed hypoxia inducibility and inhibited the hypoxia-induced proliferation in primary mouse PASMCs This animal study has shown that the Lenti-HSP27, which is constructed with rat p27 gene sequence, worked in HPH mice. We further investigated in vitro the hypoxia inducibility of Lenti-HSP27 and its inhibition on the hypoxia-induced proliferation in mouse primary PASMCs. As shown in Figures 8a and b, hypoxia significantly decreased the expression of p27 in mouse PASMCs by about 75%, whereas Lenti-HSP27 increased the expression of p27 by 6.5-fold in hypoxia (all P o 0.05, n = 3). Figures 8c and d showed that hypoxia increased the proliferation of mouse PASMCs, whereas Lenti-HSP27 significantly inhibited the hypoxia-induced proliferation of mouse PASMCs. Lenti-HSP27 had no such effects on the proliferation of mouse PASMCs in normoxia. These results demonstrated that Lenti-HSP27 showed hypoxia inducibility and inhibited the hypoxia-induced proliferation in primary mouse PASMCs. DISCUSSION In the present study, we developed a novel lentiviral vector containing SM22-alpha promoter, HRE tandem and p27. The constructed vector exhibited specific hypoxia-inducible expression of target gene in vascular SMCs in vivo and in vitro. We first demonstrated that hypoxia-inducible expression of p27 in PASMCs prevented the development of HPH in mice. Thus these results provide evidences that hypoxia-inducible expression of transgene with SM22-alpha promoter and HREs is a feasible strategy against HPH and p27 is an effective target for HPH gene therapy. Although viral vectors can insert in the host genome at a random location and may lead to uncontrollable results, they have been intensively utilized for gene therapy in the animal studies Gene Therapy (2014) 751 – 758
and clinical trials for their high transduction efficiency. Viral vectors have been used to treat pulmonary hypertension in diverse animal models. Angiotensin-converting enzyme 2 gene transfer with lentiviral vector prevented and reversed RVSP and associated pathophysiology in monocrotaline-induced pulmonary hypertension in mice.11 Targeted adenoviral gene delivery of bone morphogenetic protein receptor type II attenuated HPH and monocrotaline-induced pulmonary hypertension by countering the remodeling effects of transforming growth factor beta in rats.15 Targeted knockdown of pulmonary endothelial tryptophan hydroxylase-1 with adenovirus-mediated shRNA attenuated HPH in rats.16 Previously, HREs were used to enhance the target gene expression in hypoxic cells, whereas it is generally combined with the universal strong promoter, such as cytomegalovirus and thymidine kinase. The vectors composed of HREs and strong promoter showed obvious hypoxia responsiveness in vitro and in vivo. Dachs et al.17 reported that HREs enhanced the expression of cytosine deaminase gene by 5.4-fold in hypoxic tumor cells when combining with phosphoglycerate kinase or thymidine kinase promoter. Shibata et al.18 developed a hypoxia responsive vector by combining five copies of HRE and a cytomegalovirus minimal promoter and found the maximum hypoxia responsiveness (luciferase activity increased over 500-fold) at an oxygen concentration of 0.2% in tumor cells. Engineered neural stem cells utilizing a hypoxia-specific granulocyte-macrophage colonystimulating factor-overexpressing vector improved graft survival and functional recovery in rat spinal cord injury.19 In the present study, we constructed a lentiviral vector (LentiHSP27) using six copies of HRE combining with a tissue-specific promoter (SM22-alpha promoter) to drive the expression of p27, which is the key CDK inhibitor that blocks the G1–S transition in cell cycle progression. Different from the universal strong promoters, theoretically, the SM22-alpha promoter can ensure Lenti-HSP27 give a lower leak expression of p27 in non-SMCs. Our results showed that Lenti-HSP27 exhibited positive expression of p27 in primary PASMCs but not in primary fibroblasts, endothelium cells and alveolar epithelium in normoxia. Moreover, Lenti-HSP27 gave an increased expression of p27 in PASMCs in10% O2 and further increased the expression of p27 at the lower oxygen tension (Figures 1 and 2). In an animal model, Lenti-HSP27 gave a specific expression of p27 in pulmonary artery wall in HPH mice (Figure 7). These results suggest that Lenti-HSP27 show SMC specificity and potent hypoxia responsiveness in vitro and in vivo. Administration of the vector significantly alleviated the RVSP, the ratio of right ventricle to left ventricle plus septum weight and the muscularization of pulmonary vessels in HPH mice. In vitro, the vector significantly arrested PASMCs at G0/G1 phase in hypoxia and inhibited the hypoxia-induced proliferation of PASMCs. © 2014 Macmillan Publishers Limited
Hypoxia-inducible expression of p27 prevents HPH Y Luo et al
755 may reflect one of the different characteristic between the pulmonary vessels and the system circulation vessels in moderate hypoxia, for the hypobaric hypoxia degree (depressurized to 380 mm Hg corresponding to 10% O2) is moderate in the present animal model. Whether the different species (the sequence of HREs, SM22-alpha promoter and p27 are from rat and the animal model is mouse) may be one of the causes is also not known. All these will be explored in our future work. One limitation of the present study is that Lenti-HSP was constructed with rat SM22-alpha promoter and rat p27 cDNA, whereas the vector effect was tested in mice. However, the sequence homogenous of p27 cDNA from rat and mouse is very high (94%). The sequence of rat SM22-alpha promoter is highly homogenous (90%) to one sequence located at 5′ side of transgelin in the chromosome 9 of mouse, which is predicted to be mouse SM22-alpha promoter. Further, we tested the effects of the constructed vector in primary mouse PASMCs. The results showed that Lenti-HSP27 indeed functioned in mouse primary PASMCs (Figure 8). Lenti-HSP27 exhibited hypoxia inducibility and inhibited the hypoxia-induced proliferation of mouse primary PASMCs. Therefore, the conclusion from the animal experiment is reliable. In conclusion, our study indicates the therapeutic potential of hypoxia-inducible expression of transgene with smooth musclespecific promoter and HREs in the prevention of HPH and provides evidence supporting p27 as a target of gene therapy for HPH. MATERIALS AND METHODS Vector construction and lentivirus production
Figure 5. Lenti-HSP27 prevented the pulmonary vessel wall thickness and vessel muscularization in HPH mice. Representative hematoxylin and eosin staining of pulmonary vessels (a). Quantification of pulmonary arterioles wall thickness (b) and muscularization (c). The degree of muscularization of vessels was carried out as described in the Methods section. A total of sixty vessels from six animal (10 vessels per animal) were analyzed in each group in panels (b) and (c), respectively. Data are expressed as mean ± s.e.m. *P o0.05 vs N+ Lenti-empty and N+Lenti-HSP27 groups; #Po 0.05 vs H+Lenti-empty group. NM: nonmuscularized vessels; PM: partially muscularized vessels; FM: fully muscularized vessels.
In addition, it is also difficult to understand how this constructed vector specifically expressed in pulmonary artery, without affecting the vascular SMCs from other organs or airway SMCs (Figure 7). It is known that pulmonary vessels differ very much from system circulation vessels in response to hypoxia. Recently, we also found that the proliferation of PASMCs differed from aortic SMCs in moderate hypoxia (5–10% O2 concentration). Moderate hypoxia significantly promotes the proliferation of PASMCs but not aortic SMCs (not published data). We considered that many causes might induce the present results. For example, it © 2014 Macmillan Publishers Limited
The sequence composed of six copies of HREs (the sequence is: GACTCCACAGTGCATACGTGGGCTTCCACAGGTCGTCTC, which is the hypoxia enhancer derived from the 5′-untranslated region of rat vascular endothelial growth factor), the rat SM22 promoter (transgelin promoter, access number Z48607.1, location: AC_000076.1:45814324–45812885), the fusion sequence of the coding region of rat p27 (access number D83792.1) and the flag tag genes, was synthesized and cloned into the backbone vector pLenti6/Block-iT-DEST using Gateway LR Clonase II Enzyme Mix (Invitrogen, Carlsbad, CA, USA). Therefore, the expression of the fusion protein of p27-flag is under the coordinate control of HREs and SM22 promoter-alpha (pLenti6 -6*HRE-SM22 promoter-p27-flag, referred to as Lenti-HSP27). To confirm the effects of HREs, another similar vector with Lenti-HSP27 but with HREs was constructed (pLenti6 -SM22 promoter-p27flag, referred to as Lenti-SP27). The backbone vector pLenti6/Block-iT-DEST (Lenti-empty) was used as the control vector for the vehicle groups. The diagram of the vectors is shown in panel a of Figure 1. Lentiviral particles containing the Lenti-6*HRE-SM22 promoter-p27-flag or the control vector were produced from 293T cells with ViraSafe Lentiviral Packaging Systems, concentrated with Cell Biolabs’ ViraBind Lentivirus Concentration and Purification Kit and titered with QuickTiter Lentivirus Titer Kit according to the manual (all from Cell Biolabs, San Diego, CA, USA).
Animal experiments All animals were maintained in a 12–12-h light–dark cycle in an airconditioned room (25 °C) and had free access to food and water. All the experiments were approved by the Animal Care and Use Committee of the Fourth Military Medical University and complied with the Declaration of the National Institutes of Health Guide for Care and Use of Laboratory Animals. Adult male C57/BL6 mice (18–22 g) were randomly divided into four groups (normoxia+Lenti-empty, normoxia+Lenti-HSP27, hypoxia+Lentiempty, hypoxia+Lenti-HSP27, all n = 6) and accordingly maintained in normoxia (21% O2) or hypobaric hypoxia (depressurized to 380 mm Hg corresponding to 10% O2) environment for 28 days. A single injection of lentiviral particle (3 × 109 transducing units) containing Lenti-HSP27 or Lenti-empty was given via tail vein at day 0 accordingly.
Pulmonary hemodynamics Mice were anesthetized with phenobarbital (30 mg kg − 1, i.p.). The RVSP was measured according to a right cardiac catheterization procedure and Gene Therapy (2014) 751 – 758
Hypoxia-inducible expression of p27 prevents HPH Y Luo et al
756
Figure 6. Lenti-HSP27 prevented the hypoxia-induced decrease of p27 in the pulmonary arteries in HPH mice. (a) Representative western blotting of p27 for pulmonary arteries from different groups of mice. Beta-actin was used as a control. (b) Summarized data from three experiments. Data were normalized by dividing the protein level from N+Lenti-empty group and represented as mean ± s.e.m. *P o0.05 vs N+Lenti-empty group; #P o0.05 vs H+Lenti-empty group.
Figure 7. Lenti-HSP27 exhibited the specific expression of p27-flag in the pulmonary artery wall in HPH mice. Representative immunohistochemistry staining of p27-flag in the heart (a and e), liver (b and f), kidney (c and g) and lung (d and h) from HPH mice. Panels (a–d) are for the H+Lenti-empty group; panels (e–h) are for the H+Lenti-HSP27 group. Positive staining (brown yellow) of p27-flag was mainly seen in the pulmonary artery wall (panel (h)). Gene Therapy (2014) 751 – 758
© 2014 Macmillan Publishers Limited
Hypoxia-inducible expression of p27 prevents HPH Y Luo et al
757
Figure 8. Lenti-HSP27 showed hypoxia inducibility and inhibited the hypoxia-induced proliferation in mouse primary PASMCs. (a) Representative western blotting for p27 protein in mouse primary PASMCs infected with Lenti-HSP27 or Lenti-empty in normoxia (21%) or hypoxia (3%). Beta-actin was used as a control. Summarized data from three experiments are shown in panel (b). The data were normalized by dividing the protein level in normoxia. Lenti-HSP27 expressed a higher level of p27 protein in hypoxia. The effects of Lenti-HSP27 on the hypoxia-induced proliferation of mouse primary PASMCs are shown in panel (c) (cell counting assay) and panel (d) (MTT assay). Data are represented as mean ± s.e.m. and from three replicated experiments. *P o0.05 vs N+Lenti-empty group; #P o0.05 vs H+Lenti-emtpy group. used as an indicator of pulmonary artery pressure. A polyethylene catheter was inserted into the right ventricle via the right external jugular vein. The other end of the catheter was connected to a transducer, and the pressure tracings were simultaneously recorded on a physiological recorder (PowerLab system, AD Instruments, Castle Hill, NSW, Australia). The data were analyzed by using the Chart program supplied by the system. After right ventricular system pressure measurement, mice were euthanized, and the hearts, the lungs, the livers and the kidneys were harvested for subsequent experiments.
Histology, immunohistochemistry and immunofluorescence staining The right ventricle and the left ventricle with septum were isolated and individually weighted to calculate the ratio of right ventricle weight to left ventricle plus septum weight (RV/(LV+S)). The left lung was fixed in 4% (w/v) paraform, processed into 5-μm paraffin sections and used for morphometric analysis with hematoxylin and eosin staining. Then the muscularization and wall thickness of the pulmonary arterioles with diameter between 20 and 80 μm were analyzed according to the previously reported method.11,20 As for the muscularization of pulmonary arterioles, 60 vessels were analyzed in each group. The vessels were categorized as nonmuscularized (no apparent muscle), partially muscularized (with only a crescent of muscle) or fully muscularized (with a complete medical coat of muscle). Each categorization of vessels was expressed as a percentage of the total vessel numbers. The external diameter and medial wall thickness were measured in 60 muscular arteries for each group for analysis of the medial wall thickness of the pulmonary arterioles. The medial thickness was calculated as follows: percentage of wall thickness = ((medial thickness × 2)/external diameter) × 100. For immunohistochemical staining of p27-flag, the lung, heart, liver and kidney were fixed in 4% (w/v) paraform and processed into 5-μm paraffin sections. The sections were deparaffinized, rehydrated in graded alcohols and blocked by incubating in 0.3% H2O2 for 30 min. Antigen retrieval was performed by treating the slides in citrate buffer in a microwave oven for 10 min. The sections were incubated in normal goat serum for 1 h and then in a moist chamber with polyclonal mouse anti-flag antibody (1:50) at 4 °C overnight. After a complete wash in phosphate-buffered saline (PBS), the sections were incubated in biotin-labeled goat anti-mouse antibody for © 2014 Macmillan Publishers Limited
30 min at 37 °C, rinsed with PBS and incubated with avidin–biotin peroxidase complex for 30 min at 37 °C. The signal was detected using diaminobenzidine and imaged using a microscope (Olympus, Tokyo, Japan). For immunocytofluorescence staining of p27-flag, the cells were fixed in 4% (w/v) paraform for 30 min, and nonspecific binding sites were blocked with 5% bovine serum albumin for 1 h at room temperature and then incubated with ployclonal fluorescein isothiocyanate-conjugated rat antiflag antibody (1:500) over night at 4 °C. The cells were subsequently washed three times with PBS and imaged using a fluorescence microscope (Olympus).
Cell culture Rat primary PASMCs, pulmonary artery fibroblasts and mice primary PASMCs were cultured by tissue explant method.10 The cells were grown in RPMI 1640 medium supplemented with 10% (v/v) fetal bovine serum (Gibco, Melbourne, VIC, Australia). Rat primary pulmonary microvascular endothelial cells were isolated according to the method by Sobczak et al.21 and cultured in the specific Endothelial Cell Medium (ScienCell Research Laboratories, Carlsbad, CA, USA). The cells were cultured in 5% CO2 and 95% air at 37 °C. At confluence, the cells were trypsinized, split in a 1:3 ratio and recultured in the corresponding medium. The third to fifth passage cells were used for the subsequent experiments. The identity of cultured PASMCs, pulmonary fibroblasts and pulmonary endothelial were verified by positive staining for alpha smooth muscle actin, vimentin and VEcadherin, respectively (>90% of cells stained positive). Rat primary pulmonary alveolar epithelial cells were isolated using a conventional method of enzymatic digestion with elastase followed by panning over plates coated with immunoglobulin G to remove macrophages and leukocytes according to the method by Chen et al.22 and cultured in RPMI 1640 medium containing 10% (v/v) fetal bovine serum. The first passage cells were used for experiments. The identity of pulmonary alveolar epithelial cells was verified by positive staining of surfactant protein C (about 90% of cells stained positive).
Cell proliferation assay and cell cycle analysis PASMCs were cultured in 24-well plate to 40% confluence and then infected with lentivirus particles containing Lenti-empty (control) or Gene Therapy (2014) 751 – 758
Hypoxia-inducible expression of p27 prevents HPH Y Luo et al
758
Lenti-HSP27 plus 5 μg ml − 1 polybrene. Twenty-four hours after infection, the medium was changed, and the cells were cultured for another 48 h. Then the infected PASMCs were passaged and used for cell proliferation assay, cell cycle analysis or western blotting accordingly. PASMCs proliferation was measured by MTT assay and cell counting as previously described.9 For the MTT assay, the infected PASMCs were seeded in 96-well plates at a density of 5000 cells each well. After serum starvation for 24 h in serum-free medium, the infected cells were cultured in RPMI 1640 containing 5% fetal bovine serum for 24 h in normoxia (21%) or hypoxia (3%). As a result, there were four groups (the same in the following experiments): normoxia+Lenti-empty, normoxia+Lenti-HSP27, hypoxia+Lenti-empty, and hypoxia+Lenti-HSP27. Then MTT (5 mg ml − 1, 10 μl per well) was added to the plates and incubated for another 4 h at 37 °C. The supernatant was then carefully removed, and dimethyl sulfoxide (75 μl per well) was added to dissolve the formazan crystals. The absorbance of the solubilized product at 490 nm (A490) was measured with microplate spectrophotometer (PowerWave XS, BioTek Inc, Winooski, VT, USA). For cell counting, the infected PASMCs were seeded in 24-well plates at a density of 5 × 104 cells per well and then were treated as the above procedure. At the end of the treatment, they were washed with PBS, harvested by mild trypsinization and counted with a hematocytometer (QiuJin, Shanghai, China). For cell cycle analysis, the infected PASMCs were seeded in six-well plate at a density of 1 × 106 cells per well and then treated as the above procedure. At the end of the treatment, the cells were harvested with 0.25 g l − 1 trypsin from six-well plates, resuspended in 10 μl PBS, added in 1 ml 70% ethanol, centrifuged and washed with cold PBS. Then the cells were resuspended in PBS with 20 μg ml − 1 propidium iodide and 1 mg ml − 1 RNAse. After incubating for 15 min at room temperature, the samples were run on a 7 Laser SORP BD LSR II system (BD Biosciences, San Jose, CA, USA), and data were collected with the DIVA software provided by the system, and analyzed with FlowJo v8.8.6 (Tree Star, San Carlos, CA, USA).
Western blotting analysis The total lysate was obtained from the harvested cells or lung arteries and used for the extraction of protein according to the instructions of Total Protein Extraction Kit (Millipore, Bedford, MA, USA). The lung arteries (the first to the third division) were harvested under a dissecting microscope (Olympus) with a forceps according to the method by Ko et al.23 The adventitia was carefully removed from the isolated arteries under a high magnification microscope (Leica, Narishige Micromanipulator, Wetzlar, Germany). The endothelium was removed by gentle rubbing with stainless steel wire. The protein concentration was determined with BCA protein assay kit (Bio-Rad, Hercules, CA, USA). The samples were separated on denaturing 10% sodium dodecyl sulfate-polyacrylamide gel and transferred to a nitrocellulose membrane. The membrane was blocked with Tris buffered saline containing 5% non-fat dry milk at room temperature for 2 h, followed by incubation with primary antibody against beta-actin, flag tag or p27 overnight at 4 °C. Then, the secondary antibody (anti-mouse immunoglobulin G peroxidase conjugated, 1: 8000) was incubated. The signal detection was performed by using the enhanced chemiluminescence system (Amersham, Arlington Heights, IL, USA) of a commercial ECL kit.
Statistical analysis All values were presented as means ± s.e.m. The statistical differences between groups were evaluated by one-way analysis of variance, followed by Dunnett’s test for multiple comparisons. P-value o0.05 was considered statistically significant.
CONFLICT OF INTEREST The authors declare no conflict of interest.
ACKNOWLEDGEMENTS This work is supported by the China Postdoctoral Science Foundation (2013M532154) and the National Natural Science Foundation of China (Nos. 81201516, 81270328).
Gene Therapy (2014) 751 – 758
REFERENCES 1 Yu L, Quinn DA, Garg HG, Hales CA. Heparin inhibits pulmonary artery smooth muscle cell proliferation through guanine nucleotide exchange factor-H1/RhoA/ Rho kinase/p27. Am J Respir Cell Mol Biol 2011; 44: 524–530. 2 Gao X, Yu L, Castro L, Tucker CJ, Moore AB, Xiao H et al. An essential role of p27 down-regulation in Fenvalerate-induced cell growth in human uterine leiomyoma and smooth muscle cells. Am J Physiol Endocrinol Metab 2012; 303: E1025–E1035. 3 Dong LH, Wen JK, Miao SB, Jia Z, Hu HJ, Sun RH et al. Baicalin inhibits PDGF-BBstimulated vascular smooth muscle cell proliferation through suppressing PDGFRbeta-ERK signaling and increase in p27 accumulation and prevents injuryinduced neointimal hyperplasia. Cell Res 2010; 20: 1252–1262. 4 Sato J, Nair K, Hiddinga J, Eberhardt NL, Fitzpatrick LA, Katusic ZS et al. eNOS gene transfer to vascular smooth muscle cells inhibits cell proliferation via upregulation of p27 and p21 and not apoptosis. Cardiovasc Res 2000; 47: 697–706. 5 Marra DE, Simoncini T, Liao JK. Inhibition of vascular smooth muscle cell proliferation by sodium salicylate mediated by upregulation of p21(Waf1) and p27(Kip1). Circulation 2000; 102: 2124–2130. 6 Fouty BW, Grimison B, Fagan KA, Le Cras TD, Harral JW, Hoedt-Miller M et al. p27(Kip1) is important in modulating pulmonary artery smooth muscle cell proliferation. Am J Respir Cell Mol Biol 2001; 25: 652–658. 7 Yu L, Quinn DA, Garg HG, Hales CA. Gene expression of cyclin-dependent kinase inhibitors and effect of heparin on their expression in mice with hypoxia-induced pulmonary hypertension. Biochem Biophys Res Commun 2006; 345: 1565–1572. 8 Yu L, Quinn DA, Garg HG, Hales CA. Cyclin-dependent kinase inhibitor p27Kip1, but not p21WAF1/Cip1, is required for inhibition of hypoxia-induced pulmonary hypertension and remodeling by heparin in mice. Circ Res 2005; 97: 937–945. 9 Luo Y, Xu DQ, Dong HY, Zhang B, Liu Y, Niu W et al. Tanshinone IIA inhibits hypoxia-induced pulmonary artery smooth muscle cell proliferation via Akt/Skp2/ p27-associated pathway. PLoS One 2013; 8: e56774. 10 Huang YF, Liu ML, Dong MQ, Yang WC, Zhang B, Luan LL et al. Effects of sodium tanshinone II A sulphonate on hypoxic pulmonary hypertension in rats in vivo and on Kv2.1 expression in pulmonary artery smooth muscle cells in vitro. J Ethnopharmacol 2009; 125: 436–443. 11 Yamazato Y, Ferreira AJ, Hong KH, Sriramula S, Francis J, Yamazato M et al. Prevention of pulmonary hypertension by angiotensin-converting enzyme 2 gene transfer. Hypertension 2009; 54: 365–371. 12 Goukassian D, Diez-Juan A, Asahara T, Schratzberger P, Silver M, Murayama T et al. Overexpression of p27(Kip1) by doxycycline-regulated adenoviral vectors inhibits endothelial cell proliferation and migration and impairs angiogenesis. FASEB J 2001; 15: 1877–1885. 13 Ezoe S, Matsumura I, Satoh Y, Tanaka H, Kanakura Y. Cell cycle regulation in hematopoietic stem/progenitor cells. Cell Cycle 2004; 3: 314–318. 14 Rhim T, Lee DY, Lee M. Hypoxia as a target for tissue specific gene therapy. J Control Release 2013; 172: 484–494. 15 Reynolds AM, Holmes MD, Danilov SM, Reynolds PN. Targeted gene delivery of BMPR2 attenuates pulmonary hypertension. Eur Respir J 2012; 39: 329–343. 16 Morecroft I, White K, Caruso P, Nilsen M, Loughlin L, Alba R et al. Gene therapy by targeted adenovirus-mediated knockdown of pulmonary endothelial Tph1 attenuates hypoxia-induced pulmonary hypertension. Mol Ther 2012; 20: 1516–1528. 17 Dachs GU, Patterson AV, Firth JD, Ratcliffe PJ, Townsend KM, Stratford IJ et al. Targeting gene expression to hypoxic tumor cells. Nat Med 1997; 3: 515–520. 18 Shibata T, Giaccia AJ, Brown JM. Development of a hypoxia-responsive vector for tumor-specific gene therapy. Gene Therapy 2000; 7: 493–498. 19 Kim HJ, Oh JS, An SS, Pennant WA, Gwak SJ, Kim AN et al. Hypoxia-specific GM-CSF-overexpressing neural stem cells improve graft survival and functional recovery in spinal cord injury. Gene Therapy 2012; 19: 513–521. 20 Beppu H, Ichinose F, Kawai N, Jones RC, Yu PB, Zapol WM et al. BMPR-II heterozygous mice have mild pulmonary hypertension and an impaired pulmonary vascular remodeling response to prolonged hypoxia. Am J Physiol Lung Cell Mol Physiol 2004; 287: L1241–L1247. 21 Sobczak M, Dargatz J, Chrzanowska-Wodnicka M. Isolation and culture of pulmonary endothelial cells from neonatal mice. J Vis Exp 2010; (46): e2316. 22 Chen J, Chen Z, Narasaraju T, Jin N, Liu L. Isolation of highly pure alveolar epithelial type I and type II cells from rat lungs. Lab Invest 2004; 84: 727–735. 23 Ko EA, Song MY, Donthamsetty R, Makino A, Yuan JX. Tension measurement in isolated rat and mouse pulmonary artery. Drug Discov Today Dis Models 2010; 7: 123–130.
© 2014 Macmillan Publishers Limited
ORIGINAL ARTICLE
Prevention of hypoxic pulmonary hypertension by hypoxia-inducible expression of p27 in pulmonary artery smooth muscle cells Y Luo1,2,3,4,5, B Zhang4,5, H-Y Dong4,5, Y Liu4,5, Z-C Li4,5, M-Q Dong4,5 and Y-Q Gao1,2,3 Hypoxia-induced proliferation of pulmonary artery smooth muscle cells (SMCs) is important in the development of hypoxic pulmonary hypertension (HPH). We constructed a lentivirial vector containing a smooth muscle-specific promoter and six copies of hypoxia response element to co-drive the expression of p27, the key cyclin-dependent kinase inhibitor that blocks the G1 to S phase transition in cell cycle progression, in pulmonary artery SMCs in hypoxia. Then in vivo we examined the prevention effects of the vector on HPH in mice and in vitro the specificity on the hypoxia-inducible expression of p27 in pulmonary artery SMCs. Hypobaric hypoxia for 4 weeks resulted in significant increases in the right ventricular systolic pressure, the ratio of right ventricle to left ventricle plus septal weight and the muscularization of pulmonary vessels in mice. Administration of the vector before hypoxia significantly prevented the effects of hypoxia. In vitro, the vector exhibited hypoxic inducibility and relatively specific expression in pulmonary artery SMCs, inhibited the hypoxia-induced proliferation of pulmonary artery SMCs and arrested more cells at G0/G1 phase. These results demonstrate that the hypoxia-inducible p27 expression prevents the development of HPH in mice. Gene Therapy (2014) 21, 751–758; doi:10.1038/gt.2014.49; published online 29 May 2014
INTRODUCTION Hypoxic pulmonary hypertension (HPH) is still a fatal disease characterized by progressive pulmonary artery constriction and remodeling. The remodeling in pulmonary arteries, which is mainly caused by the hypoxia-induced aberrant proliferation of pulmonary artery smooth muscle cells (PASMCs), leads to the persistent increase in pulmonary vascular resistance and deterioration of HPH. Therefore, the inhibition of hypoxia-induced PASMC proliferation may prevent pulmonary artery remodeling and the progress of HPH. The cell proliferation is controlled by the interaction of cyclindependent kinases (CDKs) and CDK inhibitors. P27 (p27kip1) is the key CDK inhibitor that blocks the G1–S transition in cell cycle progression and is involved in the regulation of diverse cell proliferation, including PASMCs.1–6 Yu et al.7,8 found that p27 was the only CDK inhibitor involved in the inhibition of heparin on PASMC proliferation and HPH in mice. We also found that p27 is necessary for the inhibition of tanshinone IIA on the hypoxiainduced PASMC proliferation and the pulmonary artery remodeling in rats.9,10 Therefore, we hypothesize that p27 may provide a specific target for the prevention and treatment of the diseases induced by aberrant proliferation of PASMCs as HPH. For the diseases lacking effective therapies such as HPH, gene therapy may be an alternative.11 However, one of the fundamental problems of gene therapy is the lack of ideal methods to control transgene expression accordingly and specifically. In general, non-specific overexpression of therapeutic genes may induce
off-target effects. Therefore, general overexpression of p27 may induce the cell cycle dysfunction of the non-target cells such as hematopoietic stem/progenitor cells and weaken the tissues and cell repair ability.12,13 Hypoxia is a potent signal regulating the expression of various genes, including erythropoietin and vascular endothelial growth factor, by stabilizing the transcriptional complex hypoxia-inducible factor 1-alpha (HIF1-alpha). HIF1-alpha binds to the consensus sequence of hypoxia-response element (HRE) in the flanking region of the hypoxia-regulated genes and promotes these genes’ expression. Therefor, hypoxia can be exploited to specifically activate the transgene expression driven by HRE and/or HIF1-alpha system in the tissues of low oxygen tension.14 Hypoxia is also the trigger of hypoxic PASMC proliferation, pulmonary artery remodeling and the leading cause of HPH, hence hypoxia-inducible expression of target gene in PASMCs may be a feasible strategy for HPH gene therapy. In the present study, we constructed a hypoxia-inducible and SMC-specific lentivirial vector via combining a SM22 promoter and six copies of HRE, which is designed to co-drive the long-term expression of p27 mainly in PASMCs at low oxygen tension. Then in vivo we examined the prevention of the vector on HPH in mice and in vitro the specificity of target expression of p27 in PASMCs and the inducibility of hypoxia. The results showed that the constructed vector exhibited the hypoxia-inducible expression of p27 in PASMCs and significantly prevented the development of HPH in mice.
1 Department of Pathophysiology and High Altitude Physiology, Third Military Medical University, Chongqing, China; 2Key Laboratory of High Altitude Medicine, Ministry of Education, Third Military Medical University, Chongqing, China; 3Key Laboratory of High Altitude Medicine, PLA, Third Military Medical University, Chongqing, China; 4Department of Pathology and Pathophysiology, Fourth Military Medical University, Xi’an, China and 5Lung Injury and Repair Center, Fourth Military Medical University, Xi’an, China. Correspondence: Dr Y-Q Gao, Department of Pathophysiology and High Altitude Physiology, Third Military Medical University, Chongqing, China or Dr M-Q Dong, Department of Pathology and Pathophysiology, Fourth Military Medical University, Changle West Road 169, Xi’an 710032, China. E-mail: [email protected] or [email protected] Received 18 September 2013; revised 25 March 2014; accepted 11 April 2014; published online 29 May 2014
Hypoxia-inducible expression of p27 prevents HPH Y Luo et al
752
RESULTS Lenti-HSP27 exhibited hypoxia-inducible expression of p27 in PASMCs The cell specificity and hypoxia inducibility of the Lenti-HSP27 vector were tested in vitro. The Lenti-HSP27 or Lenti-empty was transducted into PASMCs, pulmonary artery fibroblasts, pulmonary microvascular endothelial cells and pulmonary alveolar epithelial cells via lentivirus infection. The expression of p27-flag was confirmed by immunofluorescence staining and western blotting with anti-flag antibody. Immunofluorescence staining showed that in normoxia the weak positive green staining was seen only in PASMCs but not in fibroblasts, endothelial cells or pulmonary alveolar epithelial cells (21% O2) (Figure 1b). Western blotting showed that the expression level of p27-flag was significantly higher in PASMCs than in the other three cells in normoxia (Figures 1c and d), but a lower level expression of p27-flag was also detected in fibroblasts and pulmonary microvascular endothelial cells, suggesting that the weaker activity of SM22 promoter exists in these two cells. Figure 2a further showed that hypoxia (3%) significantly increased the expression of p27-flag in the Lenti-HSP27 but not Lenti-SP27-infected PASMCs. Furthermore, the expression of p27-flag in the Lenti-HSP27-infected PASMCs is oxygen concentration-dependent: the lower the oxygen concentration, the higher the expression level (Figures 2b and c). These results demonstrated that the SM22 promoter and HREs cooperated, and the constructed Lenti-HSP27 drove the higher expression of the target p27-flag in PASMCs. Lenti-HSP27 exhibited obvious hypoxia inducibility owing to the HREs. Lenti-HSP27 inhibited hypoxia-induced proliferation of rat primary PASMCs and arrested more cells at G0/G1 phase in vitro Then we assessed the effects of Lenti-HSP27 on the cell cycle and the proliferation of rat primary PASMCs in normoxia (21% O2) and in hypoxia (3% O2). Hypoxia promoted PASMCs to enter the cell mitosis cycle and decreased the cell number of PASMCs in the G0/ G1 phase (from 58.1 ± 5.7% to 34.0 ± 6.2%). Lenti-HSP27 totally prevented the effects of hypoxia on the PASMCs cell cycle as it arrested more PASMCs in G1/G0 phase (from 34.0 ± 6.2% to 79.7 ± 9.1%) (all P o 0.05, n = 3, Figure 3a). MTT (3-(4, 5-dimethylthiazal-2-yl)-2, 5-diphenyltetrazoliumbromide) and cell count assay showed that hypoxia significantly accelerated the proliferation of PASMCs, whereas Lenti-HSP27 significantly inhibited the hypoxia-induced proliferation of PASMCs (Figures 3b and c). Lenti-HSP27 had no significant effects on the cell cycle and the proliferation of PASMCs in normoxia (Figure 3). Lenti-HSP27 prevented the HPH development in mice We then explored whether Lenti-HSP27 administration would prevent the development of HPH in mice. Hypoxia for 4 weeks resulted in a significant increase of right ventricle systolic pressure (RVSP; from 28.9 ± 3.2 to 52.9 ± 5.6 mm Hg) and the ratio of RV/(LV+S) (from 0.22 ± 0.02 to 0.42 ± 0.06), which were significantly prevented by Lenti-HSP27 administration (from 52.9 ± 5.6 to 37.3 ± 5.1 for RVSP and from 0.42 ± 0.06 to 0.28 ± 0.04 for the ratio of RV/(LV+S); all P o0.05, n = 6, Figure 4). However, Lenti-HSP27 had no significant effects on the RVSP and the ratio of RV/(LV+S) in normoxia (Figure 4). The hematoxylin and eosin staining of lung tissues are shown in Figure 5a. The obvious muscularization of pulmonary arterioles, which is shown as the increased number of arteries in the lung in the same magnification field, was seen in H+Lenti-empty group mice. Lenti-HSP27 administration decreased the number of arteries in lung in HPH mice. The summarized data of the muscularization and the wall thickness of pulmonary arteries/ arterioles are shown in Figures 5b and c respectively. Lenti-HSP27 administration attenuated the hypoxia-induced thickness of Gene Therapy (2014) 751 – 758
Figure 1. Lenti-HSP27 expressed the highest level of p27-flag in PASMCs in normoxia. (a) The diagram of the constructed vectors. (b, c) Representative immunofluorescence staining (b) and western blotting (c) of p27-flag in PASMCs, pulmonary artery fibroblasts (PAFs), pulmonary microvascular endothelial cells (ECs) and alveolar epithelial cells (AECs) in normoxia. The positive immunofluorescence staining is in green. Beta-actin was used as an internal control. (d) Summarized western blotting data from three independent experiments. The data were normalized by dividing the protein level in PASMCs. Data are represented as mean ± s.e.m. *P o0.05 vs PASMCs group.
medial walls and the muscularization of pulmonary arterioles. In the N+Lenti-empty group, the nonmuscularized and fully muscularized arterioles were 70.1 ± 9.1% and 6.3 ± 1.0%, respectively. In contrast, the HPH mice showed a greater proportion of fully © 2014 Macmillan Publishers Limited
Hypoxia-inducible expression of p27 prevents HPH Y Luo et al
753
Figure 2. Lenti-HSP27 exhibited hypoxia-inducible expression of p27-flag in PASMCs. Representative immunofluorescence staining (a) and western blotting (b) for p27-flag in PASMCs infected with Lenti-HSP27 and Lenti-SP17 under different oxygen concentrations (21% and 3%). The positive immunofluorescence staining is in green. Beta-actin was used as a control. Summarized data from three experiments are shown in panel (c). The data were normalized by dividing the protein level at 21% O2. Lenti-HSP27 expressed p27-flag in an oxygen-concentration-dependent manner in PASMCs. Data are represented as mean ± s.e.m. *P o0.05 vs 21% O2 group.
muscularized arterioles (51.5 ± 4.8%) and a lower proportion with nonmuscularization (18.9 ± 1.7%) in the lungs. Lenti-HSP27 significantly reduced the percentage of fully muscularized arterioles (17.4 ± 3.0%) and increased the percentage of nonmuscularized vessels (59.3 ± 8.6%; all P o 0.05, n = 60), whereas Lenti-HSP27 administration had no significant effects on the medical wall thickness and the muscularization of pulmonary arterioles in the normoxia group mice (Figures 5a–c). Lenti-HSP27 prevented the hypoxia-induced decrease of p27 expression in the pulmonary arteries in HPH mice We isolated the pulmonary arteries and measured the effects of hypoxia and Lenti-HSP27 administration on the expression of p27 in the pulmonary arteries. Western blotting results showed that hypoxia significantly decreased the expression of p27 by 52% (P o 0.05, n = 3). Lenti-HSP27 administration significantly increased © 2014 Macmillan Publishers Limited
Figure 3. Effects of Lenti-HSP27 on the cell cycle and the proliferation of PASMCs in hypoxia. (a) Effects of Lenti-HSP27 on the cell cycle in hypoxia (3% O2). Hypoxia decreased the cell number of PASMCs in the G0/G1 phase, whereas Lenti-HSP27 significantly increased the cell number in G0/G1 phase in hypoxia. (b, c): Effects of Lenti-HSP27 on the proliferation of PASMCs in hypoxia. The results of MTT assay (b) and cell counting (c) showed that hypoxia promoted the proliferation of PASMCs, whereas Lenti-HSP27 significantly inhibited the hypoxia-induced proliferation of PASMCs. Lenti-HSP27 had no obvious effect on the cell cycle and the proliferation of PASMCs in normoxia (21% O2). N: normoxia; H: hypoxia (the same in the following figures). Data are represented as mean ± s.e.m. and from three replicated experiments. *P o0.05 vs N+Lenti-empty group; #Po0.05 vs H+Lenti-emtpy group.
the expression of p27 by fourfold in hypoxia (P o 0.05, n = 3) but had no such effect in normoxia (Figure 6). These results showed that Lenti-HSP27 in vivo drove the expression of p27-flag in pulmonary arteries mainly in hypoxia but not in normoxia. Gene Therapy (2014) 751 – 758
Hypoxia-inducible expression of p27 prevents HPH Y Luo et al
754
Figure 4. Effects of Lenti-HSP27 on the prevention of HPH. Mice were injected with Lenti-HSP27 or Lenti-empty lentivirus via tail vein according to the grouping. Then the animals were maintained in normoxia or hypoxia environments for 4 weeks. Effects on RVSP (a) and RV/(LV+S) (b). Data are represented as mean ± s.e.m. *Po 0.05 vs N+Lenti-empty group; #P o0.05 vs H+Lenti-empty group (n = 6).
Lenti-HSP27 exhibited the specific expression of p27-flag in the pulmonary artery wall in HPH mice We further examined the cellular and organ distribution of p27flag fusion protein in HPH mice administered with Lenti-HSP27 or Lenti-empty via immunohistochemical staining of the tissue sections from the heart, liver, kidney and lung with anti-flag antibody. The representative staining is shown in Figure 7. The positive brown yellow staining was seen in the lung (mainly in the pulmonary artery wall) from the HPH mice administered with Lenti-HSP27 but not with Lenti-empty. No obvious positive staining was seen in the vessels in the heart, liver and kidney in HPH mice administered with either Lenti-HSP27 or Lenti-empty. These results demonstrated that Lenti-HSP27 exhibited the specific expression of p27-flag in the pulmonary artery wall in HPH mice. Lenti-HSP27 showed hypoxia inducibility and inhibited the hypoxia-induced proliferation in primary mouse PASMCs This animal study has shown that the Lenti-HSP27, which is constructed with rat p27 gene sequence, worked in HPH mice. We further investigated in vitro the hypoxia inducibility of Lenti-HSP27 and its inhibition on the hypoxia-induced proliferation in mouse primary PASMCs. As shown in Figures 8a and b, hypoxia significantly decreased the expression of p27 in mouse PASMCs by about 75%, whereas Lenti-HSP27 increased the expression of p27 by 6.5-fold in hypoxia (all P o 0.05, n = 3). Figures 8c and d showed that hypoxia increased the proliferation of mouse PASMCs, whereas Lenti-HSP27 significantly inhibited the hypoxia-induced proliferation of mouse PASMCs. Lenti-HSP27 had no such effects on the proliferation of mouse PASMCs in normoxia. These results demonstrated that Lenti-HSP27 showed hypoxia inducibility and inhibited the hypoxia-induced proliferation in primary mouse PASMCs. DISCUSSION In the present study, we developed a novel lentiviral vector containing SM22-alpha promoter, HRE tandem and p27. The constructed vector exhibited specific hypoxia-inducible expression of target gene in vascular SMCs in vivo and in vitro. We first demonstrated that hypoxia-inducible expression of p27 in PASMCs prevented the development of HPH in mice. Thus these results provide evidences that hypoxia-inducible expression of transgene with SM22-alpha promoter and HREs is a feasible strategy against HPH and p27 is an effective target for HPH gene therapy. Although viral vectors can insert in the host genome at a random location and may lead to uncontrollable results, they have been intensively utilized for gene therapy in the animal studies Gene Therapy (2014) 751 – 758
and clinical trials for their high transduction efficiency. Viral vectors have been used to treat pulmonary hypertension in diverse animal models. Angiotensin-converting enzyme 2 gene transfer with lentiviral vector prevented and reversed RVSP and associated pathophysiology in monocrotaline-induced pulmonary hypertension in mice.11 Targeted adenoviral gene delivery of bone morphogenetic protein receptor type II attenuated HPH and monocrotaline-induced pulmonary hypertension by countering the remodeling effects of transforming growth factor beta in rats.15 Targeted knockdown of pulmonary endothelial tryptophan hydroxylase-1 with adenovirus-mediated shRNA attenuated HPH in rats.16 Previously, HREs were used to enhance the target gene expression in hypoxic cells, whereas it is generally combined with the universal strong promoter, such as cytomegalovirus and thymidine kinase. The vectors composed of HREs and strong promoter showed obvious hypoxia responsiveness in vitro and in vivo. Dachs et al.17 reported that HREs enhanced the expression of cytosine deaminase gene by 5.4-fold in hypoxic tumor cells when combining with phosphoglycerate kinase or thymidine kinase promoter. Shibata et al.18 developed a hypoxia responsive vector by combining five copies of HRE and a cytomegalovirus minimal promoter and found the maximum hypoxia responsiveness (luciferase activity increased over 500-fold) at an oxygen concentration of 0.2% in tumor cells. Engineered neural stem cells utilizing a hypoxia-specific granulocyte-macrophage colonystimulating factor-overexpressing vector improved graft survival and functional recovery in rat spinal cord injury.19 In the present study, we constructed a lentiviral vector (LentiHSP27) using six copies of HRE combining with a tissue-specific promoter (SM22-alpha promoter) to drive the expression of p27, which is the key CDK inhibitor that blocks the G1–S transition in cell cycle progression. Different from the universal strong promoters, theoretically, the SM22-alpha promoter can ensure Lenti-HSP27 give a lower leak expression of p27 in non-SMCs. Our results showed that Lenti-HSP27 exhibited positive expression of p27 in primary PASMCs but not in primary fibroblasts, endothelium cells and alveolar epithelium in normoxia. Moreover, Lenti-HSP27 gave an increased expression of p27 in PASMCs in10% O2 and further increased the expression of p27 at the lower oxygen tension (Figures 1 and 2). In an animal model, Lenti-HSP27 gave a specific expression of p27 in pulmonary artery wall in HPH mice (Figure 7). These results suggest that Lenti-HSP27 show SMC specificity and potent hypoxia responsiveness in vitro and in vivo. Administration of the vector significantly alleviated the RVSP, the ratio of right ventricle to left ventricle plus septum weight and the muscularization of pulmonary vessels in HPH mice. In vitro, the vector significantly arrested PASMCs at G0/G1 phase in hypoxia and inhibited the hypoxia-induced proliferation of PASMCs. © 2014 Macmillan Publishers Limited
Hypoxia-inducible expression of p27 prevents HPH Y Luo et al
755 may reflect one of the different characteristic between the pulmonary vessels and the system circulation vessels in moderate hypoxia, for the hypobaric hypoxia degree (depressurized to 380 mm Hg corresponding to 10% O2) is moderate in the present animal model. Whether the different species (the sequence of HREs, SM22-alpha promoter and p27 are from rat and the animal model is mouse) may be one of the causes is also not known. All these will be explored in our future work. One limitation of the present study is that Lenti-HSP was constructed with rat SM22-alpha promoter and rat p27 cDNA, whereas the vector effect was tested in mice. However, the sequence homogenous of p27 cDNA from rat and mouse is very high (94%). The sequence of rat SM22-alpha promoter is highly homogenous (90%) to one sequence located at 5′ side of transgelin in the chromosome 9 of mouse, which is predicted to be mouse SM22-alpha promoter. Further, we tested the effects of the constructed vector in primary mouse PASMCs. The results showed that Lenti-HSP27 indeed functioned in mouse primary PASMCs (Figure 8). Lenti-HSP27 exhibited hypoxia inducibility and inhibited the hypoxia-induced proliferation of mouse primary PASMCs. Therefore, the conclusion from the animal experiment is reliable. In conclusion, our study indicates the therapeutic potential of hypoxia-inducible expression of transgene with smooth musclespecific promoter and HREs in the prevention of HPH and provides evidence supporting p27 as a target of gene therapy for HPH. MATERIALS AND METHODS Vector construction and lentivirus production
Figure 5. Lenti-HSP27 prevented the pulmonary vessel wall thickness and vessel muscularization in HPH mice. Representative hematoxylin and eosin staining of pulmonary vessels (a). Quantification of pulmonary arterioles wall thickness (b) and muscularization (c). The degree of muscularization of vessels was carried out as described in the Methods section. A total of sixty vessels from six animal (10 vessels per animal) were analyzed in each group in panels (b) and (c), respectively. Data are expressed as mean ± s.e.m. *P o0.05 vs N+ Lenti-empty and N+Lenti-HSP27 groups; #Po 0.05 vs H+Lenti-empty group. NM: nonmuscularized vessels; PM: partially muscularized vessels; FM: fully muscularized vessels.
In addition, it is also difficult to understand how this constructed vector specifically expressed in pulmonary artery, without affecting the vascular SMCs from other organs or airway SMCs (Figure 7). It is known that pulmonary vessels differ very much from system circulation vessels in response to hypoxia. Recently, we also found that the proliferation of PASMCs differed from aortic SMCs in moderate hypoxia (5–10% O2 concentration). Moderate hypoxia significantly promotes the proliferation of PASMCs but not aortic SMCs (not published data). We considered that many causes might induce the present results. For example, it © 2014 Macmillan Publishers Limited
The sequence composed of six copies of HREs (the sequence is: GACTCCACAGTGCATACGTGGGCTTCCACAGGTCGTCTC, which is the hypoxia enhancer derived from the 5′-untranslated region of rat vascular endothelial growth factor), the rat SM22 promoter (transgelin promoter, access number Z48607.1, location: AC_000076.1:45814324–45812885), the fusion sequence of the coding region of rat p27 (access number D83792.1) and the flag tag genes, was synthesized and cloned into the backbone vector pLenti6/Block-iT-DEST using Gateway LR Clonase II Enzyme Mix (Invitrogen, Carlsbad, CA, USA). Therefore, the expression of the fusion protein of p27-flag is under the coordinate control of HREs and SM22 promoter-alpha (pLenti6 -6*HRE-SM22 promoter-p27-flag, referred to as Lenti-HSP27). To confirm the effects of HREs, another similar vector with Lenti-HSP27 but with HREs was constructed (pLenti6 -SM22 promoter-p27flag, referred to as Lenti-SP27). The backbone vector pLenti6/Block-iT-DEST (Lenti-empty) was used as the control vector for the vehicle groups. The diagram of the vectors is shown in panel a of Figure 1. Lentiviral particles containing the Lenti-6*HRE-SM22 promoter-p27-flag or the control vector were produced from 293T cells with ViraSafe Lentiviral Packaging Systems, concentrated with Cell Biolabs’ ViraBind Lentivirus Concentration and Purification Kit and titered with QuickTiter Lentivirus Titer Kit according to the manual (all from Cell Biolabs, San Diego, CA, USA).
Animal experiments All animals were maintained in a 12–12-h light–dark cycle in an airconditioned room (25 °C) and had free access to food and water. All the experiments were approved by the Animal Care and Use Committee of the Fourth Military Medical University and complied with the Declaration of the National Institutes of Health Guide for Care and Use of Laboratory Animals. Adult male C57/BL6 mice (18–22 g) were randomly divided into four groups (normoxia+Lenti-empty, normoxia+Lenti-HSP27, hypoxia+Lentiempty, hypoxia+Lenti-HSP27, all n = 6) and accordingly maintained in normoxia (21% O2) or hypobaric hypoxia (depressurized to 380 mm Hg corresponding to 10% O2) environment for 28 days. A single injection of lentiviral particle (3 × 109 transducing units) containing Lenti-HSP27 or Lenti-empty was given via tail vein at day 0 accordingly.
Pulmonary hemodynamics Mice were anesthetized with phenobarbital (30 mg kg − 1, i.p.). The RVSP was measured according to a right cardiac catheterization procedure and Gene Therapy (2014) 751 – 758
Hypoxia-inducible expression of p27 prevents HPH Y Luo et al
756
Figure 6. Lenti-HSP27 prevented the hypoxia-induced decrease of p27 in the pulmonary arteries in HPH mice. (a) Representative western blotting of p27 for pulmonary arteries from different groups of mice. Beta-actin was used as a control. (b) Summarized data from three experiments. Data were normalized by dividing the protein level from N+Lenti-empty group and represented as mean ± s.e.m. *P o0.05 vs N+Lenti-empty group; #P o0.05 vs H+Lenti-empty group.
Figure 7. Lenti-HSP27 exhibited the specific expression of p27-flag in the pulmonary artery wall in HPH mice. Representative immunohistochemistry staining of p27-flag in the heart (a and e), liver (b and f), kidney (c and g) and lung (d and h) from HPH mice. Panels (a–d) are for the H+Lenti-empty group; panels (e–h) are for the H+Lenti-HSP27 group. Positive staining (brown yellow) of p27-flag was mainly seen in the pulmonary artery wall (panel (h)). Gene Therapy (2014) 751 – 758
© 2014 Macmillan Publishers Limited
Hypoxia-inducible expression of p27 prevents HPH Y Luo et al
757
Figure 8. Lenti-HSP27 showed hypoxia inducibility and inhibited the hypoxia-induced proliferation in mouse primary PASMCs. (a) Representative western blotting for p27 protein in mouse primary PASMCs infected with Lenti-HSP27 or Lenti-empty in normoxia (21%) or hypoxia (3%). Beta-actin was used as a control. Summarized data from three experiments are shown in panel (b). The data were normalized by dividing the protein level in normoxia. Lenti-HSP27 expressed a higher level of p27 protein in hypoxia. The effects of Lenti-HSP27 on the hypoxia-induced proliferation of mouse primary PASMCs are shown in panel (c) (cell counting assay) and panel (d) (MTT assay). Data are represented as mean ± s.e.m. and from three replicated experiments. *P o0.05 vs N+Lenti-empty group; #P o0.05 vs H+Lenti-emtpy group. used as an indicator of pulmonary artery pressure. A polyethylene catheter was inserted into the right ventricle via the right external jugular vein. The other end of the catheter was connected to a transducer, and the pressure tracings were simultaneously recorded on a physiological recorder (PowerLab system, AD Instruments, Castle Hill, NSW, Australia). The data were analyzed by using the Chart program supplied by the system. After right ventricular system pressure measurement, mice were euthanized, and the hearts, the lungs, the livers and the kidneys were harvested for subsequent experiments.
Histology, immunohistochemistry and immunofluorescence staining The right ventricle and the left ventricle with septum were isolated and individually weighted to calculate the ratio of right ventricle weight to left ventricle plus septum weight (RV/(LV+S)). The left lung was fixed in 4% (w/v) paraform, processed into 5-μm paraffin sections and used for morphometric analysis with hematoxylin and eosin staining. Then the muscularization and wall thickness of the pulmonary arterioles with diameter between 20 and 80 μm were analyzed according to the previously reported method.11,20 As for the muscularization of pulmonary arterioles, 60 vessels were analyzed in each group. The vessels were categorized as nonmuscularized (no apparent muscle), partially muscularized (with only a crescent of muscle) or fully muscularized (with a complete medical coat of muscle). Each categorization of vessels was expressed as a percentage of the total vessel numbers. The external diameter and medial wall thickness were measured in 60 muscular arteries for each group for analysis of the medial wall thickness of the pulmonary arterioles. The medial thickness was calculated as follows: percentage of wall thickness = ((medial thickness × 2)/external diameter) × 100. For immunohistochemical staining of p27-flag, the lung, heart, liver and kidney were fixed in 4% (w/v) paraform and processed into 5-μm paraffin sections. The sections were deparaffinized, rehydrated in graded alcohols and blocked by incubating in 0.3% H2O2 for 30 min. Antigen retrieval was performed by treating the slides in citrate buffer in a microwave oven for 10 min. The sections were incubated in normal goat serum for 1 h and then in a moist chamber with polyclonal mouse anti-flag antibody (1:50) at 4 °C overnight. After a complete wash in phosphate-buffered saline (PBS), the sections were incubated in biotin-labeled goat anti-mouse antibody for © 2014 Macmillan Publishers Limited
30 min at 37 °C, rinsed with PBS and incubated with avidin–biotin peroxidase complex for 30 min at 37 °C. The signal was detected using diaminobenzidine and imaged using a microscope (Olympus, Tokyo, Japan). For immunocytofluorescence staining of p27-flag, the cells were fixed in 4% (w/v) paraform for 30 min, and nonspecific binding sites were blocked with 5% bovine serum albumin for 1 h at room temperature and then incubated with ployclonal fluorescein isothiocyanate-conjugated rat antiflag antibody (1:500) over night at 4 °C. The cells were subsequently washed three times with PBS and imaged using a fluorescence microscope (Olympus).
Cell culture Rat primary PASMCs, pulmonary artery fibroblasts and mice primary PASMCs were cultured by tissue explant method.10 The cells were grown in RPMI 1640 medium supplemented with 10% (v/v) fetal bovine serum (Gibco, Melbourne, VIC, Australia). Rat primary pulmonary microvascular endothelial cells were isolated according to the method by Sobczak et al.21 and cultured in the specific Endothelial Cell Medium (ScienCell Research Laboratories, Carlsbad, CA, USA). The cells were cultured in 5% CO2 and 95% air at 37 °C. At confluence, the cells were trypsinized, split in a 1:3 ratio and recultured in the corresponding medium. The third to fifth passage cells were used for the subsequent experiments. The identity of cultured PASMCs, pulmonary fibroblasts and pulmonary endothelial were verified by positive staining for alpha smooth muscle actin, vimentin and VEcadherin, respectively (>90% of cells stained positive). Rat primary pulmonary alveolar epithelial cells were isolated using a conventional method of enzymatic digestion with elastase followed by panning over plates coated with immunoglobulin G to remove macrophages and leukocytes according to the method by Chen et al.22 and cultured in RPMI 1640 medium containing 10% (v/v) fetal bovine serum. The first passage cells were used for experiments. The identity of pulmonary alveolar epithelial cells was verified by positive staining of surfactant protein C (about 90% of cells stained positive).
Cell proliferation assay and cell cycle analysis PASMCs were cultured in 24-well plate to 40% confluence and then infected with lentivirus particles containing Lenti-empty (control) or Gene Therapy (2014) 751 – 758
Hypoxia-inducible expression of p27 prevents HPH Y Luo et al
758
Lenti-HSP27 plus 5 μg ml − 1 polybrene. Twenty-four hours after infection, the medium was changed, and the cells were cultured for another 48 h. Then the infected PASMCs were passaged and used for cell proliferation assay, cell cycle analysis or western blotting accordingly. PASMCs proliferation was measured by MTT assay and cell counting as previously described.9 For the MTT assay, the infected PASMCs were seeded in 96-well plates at a density of 5000 cells each well. After serum starvation for 24 h in serum-free medium, the infected cells were cultured in RPMI 1640 containing 5% fetal bovine serum for 24 h in normoxia (21%) or hypoxia (3%). As a result, there were four groups (the same in the following experiments): normoxia+Lenti-empty, normoxia+Lenti-HSP27, hypoxia+Lenti-empty, and hypoxia+Lenti-HSP27. Then MTT (5 mg ml − 1, 10 μl per well) was added to the plates and incubated for another 4 h at 37 °C. The supernatant was then carefully removed, and dimethyl sulfoxide (75 μl per well) was added to dissolve the formazan crystals. The absorbance of the solubilized product at 490 nm (A490) was measured with microplate spectrophotometer (PowerWave XS, BioTek Inc, Winooski, VT, USA). For cell counting, the infected PASMCs were seeded in 24-well plates at a density of 5 × 104 cells per well and then were treated as the above procedure. At the end of the treatment, they were washed with PBS, harvested by mild trypsinization and counted with a hematocytometer (QiuJin, Shanghai, China). For cell cycle analysis, the infected PASMCs were seeded in six-well plate at a density of 1 × 106 cells per well and then treated as the above procedure. At the end of the treatment, the cells were harvested with 0.25 g l − 1 trypsin from six-well plates, resuspended in 10 μl PBS, added in 1 ml 70% ethanol, centrifuged and washed with cold PBS. Then the cells were resuspended in PBS with 20 μg ml − 1 propidium iodide and 1 mg ml − 1 RNAse. After incubating for 15 min at room temperature, the samples were run on a 7 Laser SORP BD LSR II system (BD Biosciences, San Jose, CA, USA), and data were collected with the DIVA software provided by the system, and analyzed with FlowJo v8.8.6 (Tree Star, San Carlos, CA, USA).
Western blotting analysis The total lysate was obtained from the harvested cells or lung arteries and used for the extraction of protein according to the instructions of Total Protein Extraction Kit (Millipore, Bedford, MA, USA). The lung arteries (the first to the third division) were harvested under a dissecting microscope (Olympus) with a forceps according to the method by Ko et al.23 The adventitia was carefully removed from the isolated arteries under a high magnification microscope (Leica, Narishige Micromanipulator, Wetzlar, Germany). The endothelium was removed by gentle rubbing with stainless steel wire. The protein concentration was determined with BCA protein assay kit (Bio-Rad, Hercules, CA, USA). The samples were separated on denaturing 10% sodium dodecyl sulfate-polyacrylamide gel and transferred to a nitrocellulose membrane. The membrane was blocked with Tris buffered saline containing 5% non-fat dry milk at room temperature for 2 h, followed by incubation with primary antibody against beta-actin, flag tag or p27 overnight at 4 °C. Then, the secondary antibody (anti-mouse immunoglobulin G peroxidase conjugated, 1: 8000) was incubated. The signal detection was performed by using the enhanced chemiluminescence system (Amersham, Arlington Heights, IL, USA) of a commercial ECL kit.
Statistical analysis All values were presented as means ± s.e.m. The statistical differences between groups were evaluated by one-way analysis of variance, followed by Dunnett’s test for multiple comparisons. P-value o0.05 was considered statistically significant.
CONFLICT OF INTEREST The authors declare no conflict of interest.
ACKNOWLEDGEMENTS This work is supported by the China Postdoctoral Science Foundation (2013M532154) and the National Natural Science Foundation of China (Nos. 81201516, 81270328).
Gene Therapy (2014) 751 – 758
REFERENCES 1 Yu L, Quinn DA, Garg HG, Hales CA. Heparin inhibits pulmonary artery smooth muscle cell proliferation through guanine nucleotide exchange factor-H1/RhoA/ Rho kinase/p27. Am J Respir Cell Mol Biol 2011; 44: 524–530. 2 Gao X, Yu L, Castro L, Tucker CJ, Moore AB, Xiao H et al. An essential role of p27 down-regulation in Fenvalerate-induced cell growth in human uterine leiomyoma and smooth muscle cells. Am J Physiol Endocrinol Metab 2012; 303: E1025–E1035. 3 Dong LH, Wen JK, Miao SB, Jia Z, Hu HJ, Sun RH et al. Baicalin inhibits PDGF-BBstimulated vascular smooth muscle cell proliferation through suppressing PDGFRbeta-ERK signaling and increase in p27 accumulation and prevents injuryinduced neointimal hyperplasia. Cell Res 2010; 20: 1252–1262. 4 Sato J, Nair K, Hiddinga J, Eberhardt NL, Fitzpatrick LA, Katusic ZS et al. eNOS gene transfer to vascular smooth muscle cells inhibits cell proliferation via upregulation of p27 and p21 and not apoptosis. Cardiovasc Res 2000; 47: 697–706. 5 Marra DE, Simoncini T, Liao JK. Inhibition of vascular smooth muscle cell proliferation by sodium salicylate mediated by upregulation of p21(Waf1) and p27(Kip1). Circulation 2000; 102: 2124–2130. 6 Fouty BW, Grimison B, Fagan KA, Le Cras TD, Harral JW, Hoedt-Miller M et al. p27(Kip1) is important in modulating pulmonary artery smooth muscle cell proliferation. Am J Respir Cell Mol Biol 2001; 25: 652–658. 7 Yu L, Quinn DA, Garg HG, Hales CA. Gene expression of cyclin-dependent kinase inhibitors and effect of heparin on their expression in mice with hypoxia-induced pulmonary hypertension. Biochem Biophys Res Commun 2006; 345: 1565–1572. 8 Yu L, Quinn DA, Garg HG, Hales CA. Cyclin-dependent kinase inhibitor p27Kip1, but not p21WAF1/Cip1, is required for inhibition of hypoxia-induced pulmonary hypertension and remodeling by heparin in mice. Circ Res 2005; 97: 937–945. 9 Luo Y, Xu DQ, Dong HY, Zhang B, Liu Y, Niu W et al. Tanshinone IIA inhibits hypoxia-induced pulmonary artery smooth muscle cell proliferation via Akt/Skp2/ p27-associated pathway. PLoS One 2013; 8: e56774. 10 Huang YF, Liu ML, Dong MQ, Yang WC, Zhang B, Luan LL et al. Effects of sodium tanshinone II A sulphonate on hypoxic pulmonary hypertension in rats in vivo and on Kv2.1 expression in pulmonary artery smooth muscle cells in vitro. J Ethnopharmacol 2009; 125: 436–443. 11 Yamazato Y, Ferreira AJ, Hong KH, Sriramula S, Francis J, Yamazato M et al. Prevention of pulmonary hypertension by angiotensin-converting enzyme 2 gene transfer. Hypertension 2009; 54: 365–371. 12 Goukassian D, Diez-Juan A, Asahara T, Schratzberger P, Silver M, Murayama T et al. Overexpression of p27(Kip1) by doxycycline-regulated adenoviral vectors inhibits endothelial cell proliferation and migration and impairs angiogenesis. FASEB J 2001; 15: 1877–1885. 13 Ezoe S, Matsumura I, Satoh Y, Tanaka H, Kanakura Y. Cell cycle regulation in hematopoietic stem/progenitor cells. Cell Cycle 2004; 3: 314–318. 14 Rhim T, Lee DY, Lee M. Hypoxia as a target for tissue specific gene therapy. J Control Release 2013; 172: 484–494. 15 Reynolds AM, Holmes MD, Danilov SM, Reynolds PN. Targeted gene delivery of BMPR2 attenuates pulmonary hypertension. Eur Respir J 2012; 39: 329–343. 16 Morecroft I, White K, Caruso P, Nilsen M, Loughlin L, Alba R et al. Gene therapy by targeted adenovirus-mediated knockdown of pulmonary endothelial Tph1 attenuates hypoxia-induced pulmonary hypertension. Mol Ther 2012; 20: 1516–1528. 17 Dachs GU, Patterson AV, Firth JD, Ratcliffe PJ, Townsend KM, Stratford IJ et al. Targeting gene expression to hypoxic tumor cells. Nat Med 1997; 3: 515–520. 18 Shibata T, Giaccia AJ, Brown JM. Development of a hypoxia-responsive vector for tumor-specific gene therapy. Gene Therapy 2000; 7: 493–498. 19 Kim HJ, Oh JS, An SS, Pennant WA, Gwak SJ, Kim AN et al. Hypoxia-specific GM-CSF-overexpressing neural stem cells improve graft survival and functional recovery in spinal cord injury. Gene Therapy 2012; 19: 513–521. 20 Beppu H, Ichinose F, Kawai N, Jones RC, Yu PB, Zapol WM et al. BMPR-II heterozygous mice have mild pulmonary hypertension and an impaired pulmonary vascular remodeling response to prolonged hypoxia. Am J Physiol Lung Cell Mol Physiol 2004; 287: L1241–L1247. 21 Sobczak M, Dargatz J, Chrzanowska-Wodnicka M. Isolation and culture of pulmonary endothelial cells from neonatal mice. J Vis Exp 2010; (46): e2316. 22 Chen J, Chen Z, Narasaraju T, Jin N, Liu L. Isolation of highly pure alveolar epithelial type I and type II cells from rat lungs. Lab Invest 2004; 84: 727–735. 23 Ko EA, Song MY, Donthamsetty R, Makino A, Yuan JX. Tension measurement in isolated rat and mouse pulmonary artery. Drug Discov Today Dis Models 2010; 7: 123–130.
© 2014 Macmillan Publishers Limited
