Journal of Medical Virology 37:298-302 (1992)

Prevalence of Hepatitis-C Virus Infection in Children With Chronic Post-Transfusion Hepatitis Elisabeth Puchhammer-Stockl, Hanns Hofmann, Franz M a r t i n Fink, Wolfgang Mor, Sonja Hocker-Schulz, Franz-Xaver Heinz, and Christian K u n z Institu.te of Virology, University of Vienna (E.P.S., H.H., F.-X.H., C.K.) and St. Anna Children’s Hospital (M.F.W.M., S.H.-S.), Vienna, Austria The prevalence of hepatitis-C virus (HCV) infection was investigated in a group of children with chronic post-transfusion hepatitis using a firstand second-generation HCV-antibody ELISA, 2 confirmatory tests (a second-generation recombinant immunoblot assay and a line immunoassay) as well as an HCV-polymerase chain reaction (PCR). In 33% of the children, clear discrepancies were observed between the 4 different HCV-antibody detection assays, indicating that the serological diagnosis of HCV infection is still problematic. HCV RNA was detectable by PCR in only 69% of the antibody positive patients, which may be due to a fluctuation of viraemia during the course of infection. Such a fluctuation was demonstrated in 6 patients from whom serum samples drawn at different times were investigated. In contrast, in 8 of the 15 seronegative patients, HCV infection was identified only by PCR, although the hepatitis had already persisted for more than 2 years. Antibody assays and PCR together detected HCV infection in about 90% of the patients with chronic hepatitis. When markers of hepatitis B infection were also investigated, only 6% of the cases remained undiagnosed.

tect antibodies directed against a nonstructural protein of the virus [Kuo et al., 19891 and exhibit a low detection rate, especially during the early stage of infection [Alter et al., 19891. Recently, second-generation ELISA test systems became available that contain additional viral antigens. Experience gained so far with these systems has shown that they provide increased sensitivity [Craxi e t al., 19911. The polymerase chain reaction (PCR) [Saiki et al., 19881 is a n extremely sensitive method for the detection of viral nucleic acids in clinical material and has been shown to be valuable for routine diagnosis of several viral diseases, especially in cases where diagnosis cannot be made reliably by serological tests [Laure et al., 1988, Puchhammer-Stock1 et al., 19901. Recently, PCR was also used for the detection of HCV RNA in serum as a marker of continuing disease as well as a tool for early diagnosis of infection [Weiner et al., 1990, Garson et al., 19901. Children suffering from malignant disease often receive multiple blood products and therefore frequently acquire post-transfusion hepatitis. We investigated the prevalence of HCV infections in a group of children with chronic post-transfusion hepatitis using different HCV antibody detection assays as well a s PCR.

0 1992 Wiley-Liss, Inc.

Serum samples from 68 children who had received multiple blood transfusions in the course of treatment of malignant diseases were investigated. All of the children suffered from chronic hepatitis for at least 2 years. The diagnosis of chronic hepatitis was made when the alanine aminotransferase (ALT) levels were elevated to a t least 2.5 times the upper limit of the normal range (i.e., 53 U/1 or higher) for a period of at least 6 months. Serum samples from 10 otherwise healthy children

KEY WORDS: hepatitis-c virus, polymerase chain reaction, HCV antibody ELISA, HCV antibody confirmatory tests

INTRODUCTION

Non-A non-B hepatitis is one of the most common transfusion-associated diseases [Dienstag e t al., 19831. Since the identification of hepatitis-C virus (HCV) as the major causative agent of non-A non-B hepatitis [Choo et al., 19891, diagnostic tests for the detection of HCV antibodies have been established [Kuo et al., 19891. However, first-generation test systems only de0 1992 WILEY-LISS, INC.

M A T E R I A L S AND METHODS

Accepted for publication January 29, 1992. Address reprint requests to Elisabeth Puchhammer-Stockl, Institute of Virology, University of Vienna, Kinderspitalgasse 15, A-1095 Vienna, Austria.

Diagnosis of Chronic HCV Infection

299

with rubella infection and from 39 healthy students were used a s negative controls for the PCR.

Polymerase Chain Reaction Sample preparation was carried out as described by Garson et al. [19901. In brief, 500 pl of serum was diluted with ddH,O to 1ml and 500 p1 of 30%polyethylene glycol 8000 in 0.1 M NaCl and 50 U of RNAse inhibitor (Boehringer Mannheim). After 40 min on ice, the sample was centrifuged for 10 min a t 14,000 x g and the pellet was resuspended in 250 p1 buffer containing 50 mM NaC1, 10 mM Tris.Cl,pHB, and 1 mM EDTA. Twenty p1 0.1 M EDTA, 1 M sodium acetate pH 5, and 40 p,l 10% sodium dodecyl sulphate were added, and the mixture was vigourously vortexed before phenolkhloroform extraction and ethanol precipitation [Sambrook et al., 19891. The precipitate was pelleted, desiccated under vacuum, and resuspended in 20 pl ddH,O. Ten p1 of this solution were subjected to reverse transcription in a solution containing 50 U RNase inhibitor, 50 pM of each dNTP, 5 pmol of the antisense primer C4: CAACACTACTCGGCTAGCAGT (Nucleotides 229-239) [Okamoto et al., 19901, 4 pl reverse transcription buffer (BRL), and 20 U of reverse transcriptase M-MLV (BRL). The PCR was then carried out with 10 pl of this sample in a solution containing 50 mM KC1, 10 mM Tris.CI pH 8.3, 2 mM MgCl,, 200 pM of each dNTP (dATP,dCTP,dGTP,TTP), 10 prnol of the primers C3: GGCGACACTCCACCATAGAT (Nucleotides 1-20) [Okamoto e t al., 19901, and C4. Thirty-five PCR cycles were performed (90 sec.94Ci2 min 40Ci 2 rnin 68C) in a Perkin-Elmer thermal cycler, using 2 U of Taq Polymerase (Perkin-Elmer-Cetus, Norwalk, CT) [Saiki et al., 19881. A second round of amplification was then carried out with 2 p1 of the first amplification reaction and 20 pmol of each of a pair of nested primers: C3i: CTGTGAGGAACTACTGTCTT (Nucleotides 28-47), C4i: CATTGAGCGGGTTTATCCAA(Nucleotides 181200) [Okamoto et al., 19901, and another 30 PCR cycles were carried out under identical PCR conditions. The amplified products were identified by agarose gel electrophoresis in a 4% agarose gel (3% NuSieve, 1% SeaKem; FMC, BioProducts) stained with ethidium bromide and also by slot blot hybridization as previously described [Stockl et al., 19891. The oligonucleotide C6: AGCCATAGTGGTCTGCGGAA(Nucleotides 119-138) [Okamoto et al., 19901was used as a probe. All oligonucleotides were produced by Genosys Biotechnologies (Houston, TX).

0 :HCV-PCR

:HCV nested PCR

i

0

10000 3

1

1000:

0

8

8

0

0

0

0 0

a

100 E

10

I

I

1

1:lO

1:lOO

1:lOOO

factor Vlll concentrate dilutions

+ serum samples

Fig.1. Quantitative analysis of the hybridization of HCV-specific fragments amplified by PCR and “nested” PCR. HCV PCR (01, and HCV “nested” PCR ( 0 ) results from dilutions of a factor VIII concentrate containing HCV (left part) as well as from serum samples (right part). + : children with chronic posttransfusion hepatitis. -: negative control patients

HBV Markers Hepatitis B surface and e antigens and their antibodies were measured using ELISA (Abbott Labs, Chicago, IL).

RESULTS Establishment of PCR For the establishment of the PCR, a factor VIII concentrate was used, which was shown to contain infectious hepatitis C virus by inoculation of chimpanzees. In the first series of experiments, different dilutions of this concentrate in a negative serum sample were subjected to PCR using the oligonucleotides C3 and C4 (see Materials and Methods), which flank a 249-bp-long sequence of the conserved 5’ noncoding region of the hepatitis-C virus genome as primers. This region was selected because it exhibited the highest degree of conservation within the whole HCV genome [Takamizawa et al., 19911. The results obtained were evaluated quantitatively by determining the amount of radioactively labelled probe bound after hybridization. However, as shown in Fig. 1, the number of counts obtained corresponded only to background levels. To increase sensitivity, the use of a n additional PCR reaction was evaluated with a nested set of primers. Positive signals were obtained up to a dilution of 1:lOO (Fig. 1).In addition, sera were tested from 6 patients HCV Serology with chronic NANB hepatitis th a t contained HCV-speHCV specific antibodies were measured using the cific antibodies. HCV was detected in most of these Abbott first-and second-generation ELISA test kits samples only by a n additional PCR reaction using based on viral antigens C 100-3, and C 33 and core, nested primers (Fig.1). To control the specificity of this respectively. All sera were tested in duplicate. assay, 49 HCV-antibody negative persons were investiAs confirmatory tests, the INNO-line immunoassay gated (see Materials and Methods). None yielded a pos(LIA) (Innogenetics) and a second-generation recombi- itive PCR result. Examples of hybridization results obtained with patients and controls are shown in Fig. 2. nant immunoblot assay (RIBA) (Chiron) were used.

Puchhammer-Stock1 et al.

300

TABLE 11. Comparison of Serological Data Obtained With 4 Different Antibody Detection Assays From 25 PCR Positive and 17 PCR Negative Serum Samples PCR positive (n = 25) n = 18 n=l n n n n

=3 =l = l =l

negative (n = 17) n=7 n = l n = l n=2 n=3

ELISA1

ELISA2

LIA

+ +

+ + + +

+ + + +

-

RIBA

-

+ + -

n=l n = 9

Enough serum was available from 42 patients to carry out 2 supplementary tests, a LIA (Innogenetics) and a RIBA (Chiron). The results obtained by all the tests are shown in Table 11. All 4 antibody detection systems yielded consistent results in 28 (69%) of the patients, whereas with the other serum samples, discrepancies between single assays were observed. In 11 (31%)of the 35 serum samples where at least 2 different test systems indicated the presence of HCV specific antibodies (Table 111, viral DNA was not detectable. To investigate possible fluctuations in the d&ectabilFig, 2. Slot blot hybridization of amplified products obtained by a HCV “nested”PCR assay. P 1,2,3,4:children with chronic posttransfu- ity of viral RNA during the course of disease, serum sion hepatitis -: negative control samples. F VIII: factor VIII concen- samples drawn from 14 anti~o~y-positive patients at trate different times were assessed by PCR (Fig.3 A,B,C). The samples from 5 of the patients yielded consistently positive results, whereas those from 3 of the patients were consistently negative. Alternating positive and TABLE I. Results Obtained With 2 HCV-Antibody negative PCR results were obtained in patients. ELISAs and PCR From Serum of 68 Of the 68 patients, 15 were antibody negative using Patients Investigated both ELISAs. I n 8 (53%) viral RNA was detected by n = 68 ELISA 1 ELISA 2 PCR PCR (Table I). LIA and RIBA could be Derformed in n = 14 only 2 of these cases (Table 11). In one cas;! both confirn = 25 matory tests yielded positive results, thus confirming n=8 HCV infection indicated by PCR. In the second case n=6 (patient 16, Fig. 3,) the confirmatory tests were also n=8 n = 7 negative. As shown in Figure 3, HCV RNA was detected by PCR in 4 different serum samples drawn previously from this patient. In 3 patients not tested by LIA and RIBA, serum samples drawn at earlier times Investigation of Patients were investigated and in 2 of these patients, virus was PCR was applied to serum samples of 68 children already detectable in all of the earlier samples with chronic hepatitis for at least 2 years who had suf- (Fig. 3 D,E). fered from malignant disease and had received multiAt least one of the HCV tests was positive in 91% of ple blood transfusions. All the children were also inves- the patients (Table 111). Tests for hepatitis B virus intigated for the presence of HCV-specific antibodies fection revealed HCV/HBV double infections in 16% of using first-and second-generation ELISA test systems. all patients with chronic hepatitis. HCV and HBV inThe results obtained are shown in Table I. Thirty-nine fection was not detected in only 6% of the patients. patients yielded positive results with the first-generaDISCUSSION tion ELISA, whereas by the second-generation assay, Hepatitis C virus is a major cause of post-transfusion 14 additional patients were identified as antibody posihepatitis [Choo et al., 19891. Soon after its identificative.

+ +

+ + + +

+ + +

Diagnosis of Chronic HCV Infection

301

tectable by PCR, however, in 31%of the patients where the presence of HCV specific antibodies was confirmed A 3-+ by at least 2 different assays. It has been suggested 4 [Garson et al., 19901 that these discrepancies might be 6 +-+ due to a fluctuation of the amount of virus in the serum. 6 - --_ Evidence for such a fluctuation was indeed obtained in B 7 Ab-positive 6 patients where RNA was detected only in single sams-ples in the course of infection. Thus a negative PCR 8 + result does not necessarily exclude a chronic HCV in10 --+ fection. + c 1l 21 -- + In contrast, viral RNA was detected in about half of 13 *-the ELISA antibody-negative patients. This high prev14 +-alence of HCV infection in seronegative patients cannot be explained by recent acquisition of HCV infection 16 -+ D l S - + - + + - + - + since all of our patients suffered from chronic hepatitis 17 Ab-negative for a t least 2 years whereas seroconversion occurred on average 22 weeks [Alter et al., 19891or 13 weeks [Farci E 18 - + I I I I et al., 19911after infection. 1 4 12 ib a 6 i b x Different factors may account for the antibody-negamonths before last sampling tive results in our patients. First, it can be speculated Fig.3. PCR results of serum samples from 18 patients obtained at different time points in the course of disease. A,D: consistently posi- that seronegativity may be due to a decrease of antibodtive; B: consistently negative; and C,E: alternatively positive and ies as described recently in a single case [Farci et al., negative PCR results. +: PCR positive. -: PCR negative. X : day on 19911. However, there is evidence that patients develop which the last serum sample was drawn. individual patterns of antibodies against the different viral antigens (Brian Rodgers, personal communication). It seems possible, therefore, that some of the paTABLE 111. Prevalence of Hepatitis C and B Virus tients have developed antibodies primarily against viInfection in 68 Children With Post-Transfusion Hepatitis ral antigens not included in the antibody assays used. n = 68 HBV-infection HCV-infection In addition, all of the patients investigated had received immunosuppressive therapy. Thus seronegativn = 11 (16%) ity may also be due to the acquisition of HCV infection n = 2 (3%) during a period of decreased immunocompetence. n = 51 (75%) n = 4 (6%) When markers of HCV and HBV infection were investigated, only 6% of the hepatitis cases remained without a clear aetiology. The prevalence of HCV infection, assays for the detection of HCV-specific antibodies tion in our patient group was about 90%, which is in became available [Kuo et al., 19891. HCV infection was good agreement with the clinical diagnosis of non-A investigated in a group of 68 children surviving malig- non-B hepatitis [Dienstag et al., 19831 in post-transfunant disease and suffering from chronic hepatitis fol- sion hepatitis. This rate may, however, be increased lowing multiple blood transfusions. PCR [Saiki et al., further by improving the serological diagnosis of HCV 19881was used for the detection of HCV RNA in serum infection. in addition to antibody screening by a first-and a secACKNOWLEDGMENTS ond-generation antibody assay. In the course of estabThe authors thank Sophie Agoston, Monika Paslishing the PCR assay, it became apparent that an additional PCR step using a nested set of primers was sarini, and Andrea Konczar for excellent technical assistance, Dr. Eder (Immuno AG) for providing a noncrucial for the detection of HCV RNA sequences. heatinactivated factor VIII concentrate preparation, When the first-and second-generation HCV antibody ELISAs were compared, it was obvious that, in agree- which causes hepatitis C in experimental animals, and ment with recently published data [Craxi et al., 19911, Steve Allison for help in the preparation of the manuthe second-generation ELISA clearly had a higher de- script. REFERENCES tection rate. To control the reliability of the ELISA results, 2 confirmatory tests (LIA and RIBA) were car- Alter HJ, Purcell RH, Shih JW, Melpolder JC, Houghton M, Choo Q-L, ried out with a part of the serum samples. However, Kuo G.(1989): detection of antibody to hepatitis C virus in prospectively followed transfusion recipients with acute and chronic clear discrepancies between the 4 antibody assays were non-A, non-B hepatitis. New England Journal of Medicine 321: observed in 33% of the cases investigated. These results 1494-1500. show that even by the additional use of supplementary Choo Q-L, Kuo G , Weiner AJ, Overby LR, Bradley DW, Houghton M (1989): Isolation of a cDNA clone derived from a blood-borne tests, serological diagnosis of HCV infection is still asnon-A, non-B viral hepatitis genome. Science 244:359-362. sociated with considerable difficulties. Thus the direct Craxi A, Fiorento G , Di Marco V, Marino L, Magrin S, Fabriano C, detection of viral RNA in serum represents an imporPagliaro L (1991): Second generation tests in diagnosis of chronic tant additional diagnostic tool. HCV RNA was not dehepatitis C. Lancet I:1354.

patients

1

-

+

2

-+

+ + +

+

:]

+ +

+ +

302 Dienstag J L (1983):Non-A, non-B hepatitis.1. Recognition, epidemiology and clinical features. Gastroenterology 85:439-462. Farci P, Alter HJ, Wong D, Miller RH, Shih JW, J e t t B, Purcell RH (1991): A long term study of hepatitis C virus replication in non-A, non-B hepatitis. New England Journal of Medicine 325:98-104. Garson JA, Ring C, Tuke P, Tedder RS (1990): Enhanced detection by PCR of hepatitis C virus RNA. Lancet ii:878-879. Garson JA, Tuke PW, Makris M, Briggs M, Machin SJ, Preston FE, Tedder RS (1990): Demonstration of viraemia patterns in haemophiliacs treated with hepatitis-C-virus contaminated factor VIII concentrates. Lancet ii:1022-1025. Kato N, Yokosuka 0,Omata M, Hosoda K, Ohto M (1990):Detection of hepatitis C virus ribonucleic acid in the serum by amplification with polymerase chain reaction. Journal of Clinical Investigation 86:1764-1767. Kuo G, Choo Q-L, Alter HJ, Gitnick GL, Redeker AG, Purcell RH, Miyamura T, Dienstag JL, Alter MJ, Stevens CE, Tegtmeier GE, Bonino F, Colombo M, Lee WS, Kuo G , Berger K, Shuster JR, Overby LR, Bradley DW, Houghton M (1989): An assay for circulating antibodies to a maior etiologic virus of human non-A, non-B hepatitis. Science 244:362-364. Laure F, Rouzioux C, Veber F, Jacomet C, Courgnaud V, Blanche S, Burgard M, Griscelli C, Brechot C (1988): Detection of HIV 1DNA in infants and children by means of the polymerase chain reaction. Lancet ii:538-541. Okamoto H, Okada S, Sugiyama Y, Yotsumoto S, Tanaka T, Yoshizawa H, Tsuda F, Miyakawa Y Mayumi M (1990): The 5‘

Puchhammer-Stock1 et al. terminal sequence of the hepatitis C virus genome. Japanese Journal of Experimental Medicine 60:167-177. Puchhammer-Stock1 E, Popow-Kraupp Th, Heinz FX, Mandl CW, Kunz C (1990): Establishment of PCR for the early diagnosis of herpes simplex encephalitis. Journal of Medical Virology 32:7782. Saiki RK, Gelfand DH, Stoffel S, Scharf SJ, Higuchi R, Horn GT, Mullis KB, Ehrlich HA (1988): Primer directed enzymatic amplification of DNA with a thermostable DNA polymerase. Science 239487-491. Sambrook J, Fritsch EF, Maniatis T (1989): “Molecular Cloning, A Laboratory Manual,” 2nd ed. Cold Spring Harbor, NY: Cold Spring Harbour Laboratory Press. Stock1 E, Barrett N, Heinz FX, Banekovich M, Sting1 G, Guggenberger K, Dorner F, Kunz C (1989): Efficiency of the polymerase chain reaction for the detection of human immunodeficiency virus type 1 DNA in the lymphocytes of infected persons: Comparison to antigen-enzyme-linked immunosorbent assay and virus isolation. Journal of Medical Virology 29:249-255. Takamizawa A, Mori C, Fuke I, Manabe S, Murakami S, Fujita J , Onishi E, Andoh T, Yoshida I, Okayama H (1991): Structure and organization of the hepatitis C virus genome isolated from human carriers. Journal of Virology 65:1105-1113. Weiner AJ, Kuo G, Bradley DW, Bonino F, Saracco G, Lee C, Rosenblatt J , Choo Q-L, Houghton M (1990): Detection of hepatitisc viral sequences in non-A, non-B hepatitis. Lancet i:1-3.