JOURNAL OF CLINICAL MICROBIOLOGY, Dec. 1992, p. 3089-3094

Vol. 30, No. 12

0095-1137/92/123089-06$02.00/0 Copyright © 1992, American Society for Microbiology

Preliminary Evaluation of the Ligase Chain Reaction for Specific Detection of Neisseria gonorrhoeae LARRY BIRKENMEYER* AND ALAN S. ARMSTRONG Experimental Biology Research, D-90D, Building L3, Abbott Laboratories, North Chicago, Illinois 60064 Received 19 May 1992/Accepted 1 September 1992

Rapid identification of Neisseria gonorrhoeae in clinical specimens is essential for effective control. Traditional culture requires a minimum of 24 h, and for some specimens harboring gonococci, the gonococci fail to grow or are misidentified. The recently described ligase chain reaction (LCR) is a highly specific and sensitive DNA amplification technique which was evaluated as an alternative to routine culture. Three LCR probe sets were used. Two of the probe sets were directed against the multi-copy Opa genes (Omp-II), while the third set was targeted against the multicopy Pilin genes. Each LCR probe set was evaluated with 260 microorganisms including 136 global isolates of N. gonorrhoeae, 41 isolates of N. meningitidis, and 10 isolates of N. lactamica; 26 nonpathogenic Neisseria strains; and 47 isolates of non-Neisseria species that may reside in clinical specimens. Amplification products were detected by using the IMx LCR format (Abbott Laboratories, Abbott Park, Ill.). Strains of N. gonorrhoeae were assayed at 270 cells per LCR (approximately 6.7 x 1i0 CFU/ml) with the Opa and Puin probes, producing signals at least 21 and 15 times above background, respectively. In contrast, only background values were observed when testing the probe sets with 124 nongonococcal strains at 1.3 x 106 cells per LCR (approximately 3.2 x 108 CFU/ml). One hundred urogenital specimens were assayed by LCR, and compared with culture, the three probes were 100%v sensitive (8 of 8) and 97.8% specific (90 of 92), resulting in an agreement of 98% (98 of 100). On the basis of the results of these preliminary studies, LCR has the potential to be an accurate and rapid DNA probe assay for the detection of N. gonorrhoeae in clinical specimens.

MATERIALS AND METHODS

Neisseria gonorrhoeae is the etiologic agent of gonorrhea, an important sexually transmitted disease found throughout the world. In males, the infection usually is easily diagnosed and treated. However, less than 25% of females with gonorrhea have a readily discernible endocervical infection. As many as 10 to 15% of infected women develop gonococcal pelvic inflammatory disease which may involve damage to the fallopian tubes. Subsequently, gonococci may ascend to the ovaries and into the peritoneal cavity, which may lead to sterility and, in some cases, can be life-threatening (33).

Bacterial strains and growth. As shown in Table 1, a total of 260 strains including 213 strains of Neisseria species were used in the study. The gonococcal strains consisted of isolates from the United States and Europe, including 18 3-lactamase-producing strains. Also, at least 22 different gonococcal serovars and 21 auxotypes were represented among the strains. The N. meningitidis strains included eight different serogroups as well as untyped isolates. To further evaluate the reagents, a panel of non-Neisseria species was used. This panel of 47 organisms contained 27 different genera including Branhamella catarrhalis and other organisms commonly isolated from the urogenital area. All strains were stored lyophilized or at -70°C in Trypticase soy broth (BBL Microbiology Systems, Cockeysville, Md.) containing 20% glycerol. Most isolates were selected from the departmental culture collection acquired for previous studies. In addition, strains of Neisseria species were obtained from J. Morello (University of Chicago) and P. Coleman (Abbott Laboratories, Abbott Park, Ill.). Before testing, strains were subcultured on GC medium base (Difco Laboratories, Detroit, Mich.) containing 1% hemoglobin (Difco) and 1% IsoVitaleX supplement (BBL). This medium containing 1% vancomycin-colistin-nystatin inhibitor (BBL) was used for the isolation of N. gonorrhoeae from clinical specimens. Cultures were incubated for 24 to 48 h at 35°C in a humid atmosphere supplemented with 5% CO2. Anaerobes were incubated anaerobically at 35°C for 24 to 48 h. Growth was removed and suspended in 1 ml of buffer containing 10 mM Tris-HCl (pH 7.5), 1 mM EDTA, and 150 mM NaCl. The suspension (500 IlI) was extracted and assayed as described below or, for convenience, was stored at -20°C. Suspensions of Chlamydia trachomatis and Trichomonas vaginalis

Traditionally, definitive diagnosis of gonorrhea is done by culturing the organism from the clinical specimen suspected of harboring N. gonorrhoeae. Growth requires a minimum of 24 h, and some gonococci fail to grow or are misidentified (13). To eliminate some of these concerns associated with culture, alternative methods such as enzyme immunoassay and DNA hybridization have been developed (14, 23, 27, 30, 31). The specificities of these immunoassays may be less than desired, and compared with nucleic acid amplification procedures, they are less sensitive. Recently, a highly sensitive and specific DNA amplification procedure, the ligase chain reaction (LCR), and a modified form of LCR have been described (2, 3, 7). This report describes the identification of gonococcal-specific oligonucleotide sequences and their ability to amplify gonococcal DNA from cultured strains of N. gonorrhoeae or directly from urogenital samples by the modified LCR method.

*

Corresponding author. 3089

3090

J. CLIN. MICROBIOL.

BIRKENMEYER AND ARMSTRONG TABLE 1. LCR results with three probe sets and a panel of 260 microorganismsa

Organism

(no. tested)

Opa-2

N. gonorrhoeae (136) N. meningitidis (41) N. lactamica (10) Neisseria speciesd (26) Non-Neisseria speciese (47)

52.0-162.0" (110.13)c 0.8-1.5 (1.06) 0.9-1.1 (0.99) 0.9-1.2 (0.98)

LCR results with probe set: Opa-3

21.0-150.0 (63.28)

0.9-1.4 (1.04) 1.0-1.1 (1.05) 0.9-1.1 (1.03) 0.9-1.2 (1.02)

Pilin-2

25.0-97.0 (51.47)

0.9-1.4 (1.04) 0.9-1.1 (0.99) 0.9-1.2 (0.98)

0.8-1.4 (1.07) a N. gonorrhoeae strains were tested at 2.7 x 102 cell equivalents per LCR; all other strains were tested at 3 ng of DNA equivalent to about 1.3 x 106 gonococcal

0.9-1.2 (1.04)

cells per LCR. b Range of LCR S/N ratios based on two replicates (S/N ratios were calculated by dividing the LCR value of the sample by the LCR value of the negative control). c Values in parentheses are the mean of LCR S/N ratios based on two replicates. d Neisseria species included N. subflava (seven strains); N. sicca (six strains); N. cinerea (three strains); N. elongata (two strains); N. flavescens (two strains); N. polysaccharea (two strains); and N. flava, N. mucosa, N. perflava, and Neisseria strain ATCC 43831 (one strain each). e Including B. catarrhalis (seven strains).

were obtained from L. Howard (Abbott Laboratories) and were stored at -20°C. Specimen collection, processing, and culture. A total of 100 urethral and endocervical specimens were collected from walk-in patients attending the Sexually Transmitted Disease Clinic at the Lake County Department of Health in Waukegan, Ill. All participants were informed about the study and their rights prior to signing informed consent forms. After the swab was collected and used for necessary clinical diagnostic procedures (i.e., culture), it was used to inoculate Martin-Lewis medium (21), which was incubated at 35°C in a candle jar. The swab was placed into a 15-ml conical tube with 200 ,ul of specimen buffer containing 50 mM N-(2-hydroxyethyl)piperazine-N-(3-propanesulfonic acid) and 5 mM EDTA (pH 7.8), and the tube was held at room temperature. Within 24 to 48 h, the inoculated medium and tube were returned to our laboratory, where the culture was incubated further. Sufficient specimen buffer was added to the swab to produce a final volume of about 500 pul. After vigorous vortexing, the swab was discarded and the eluate was extracted as described below or was stored at -20°C for future evaluation. Cultures were incubated for at least 96 h and were inspected daily for the appearance of typical colonies of N. gonorrhoeae. Suspect colonies were identified as gonococci on the basis of colony morphology, Gram stain, and oxidase reaction. Presumptively positive colonies of N. gonorrhoeae were subcultured and confirmed by using the Phadebact Monoclonal GC Omni Test in accordance with the instructions of the manufacturer (Pharmacia, Uppsala, Sweden). Suspensions of confirmed isolates were prepared and stored at -70°C for future evaluation, if necessary. Cell lysis. DNA lysates were prepared from 0.5 ml of cultured cell suspension or 0.5 ml of clinical specimen by the addition of proteinase K to a final concentration of 200 ,ug/ml and incubation for 1 h at 60°C. Lysates were subsequently heated for 10 min in a boiling water bath to further lyse the cells, to denature the DNA, and to inactivate the proteinase K. Insoluble debris was pelleted by centrifugation for 10 min at 4°C in a desktop centrifuge (13,000 x g). The supernatants were stored at -20°C. DNA quantitation and sample dilution of microorganism lysates. The DNA in cell lysates was quantitated by the diaminobenzoic acid method with human placental DNA as the standard (19). Briefly, 5 ,ul of lysate was added to 15 ,ul of diaminobenzoic acid (400 mg/ml in water) and incubated for 45 min at 60°C. After cooling, 2.5 ml of perchloric acid

(475 mM) was added, and the samples were read immediately in a fluorometer. On the basis of the fact that there are 2.25 x 106 bp (2.3 fg) per genome (6, 11), N. gonorrhoeae strains were serially diluted with human placental DNA (80 ng/,ul in water) to a level of 270 cell equivalents per 4 ,ul (6.75 x 104 CFU/ml). Three gonococcal strains were further diluted for sensitivity studies. All other organisms were diluted to 3 ng of DNA per 4 ,l, corresponding to 1.3 x 106 cell equivalents per 4 ,ul (approximately 3.2 x 108 CFU/ml) for the other Neisseria species. LCR oligonucleotides. Comparison of N. gonorrhoeae and N. meningitidis DNA sequences revealed the conserved regions found in all gonococcal strains sequenced to date, but these conserved regions in N. gonorrhoeae nevertheless differed from the corresponding sequences in N. meningitidis. LCR probes specific for three such gonococcal regions were designed such that gap-filling and ligation occurred at the site of mismatch with N. meningitidis (Fig. 1). The Opa-2 and Opa-3 sets correspond to sequences immediately upstream of the opacity gene-coding regions, from bases 66 to 113 and bases 114 to 165, respectively (28). The Pilin-2 oligonucleotide set encompasses sequences just downstream of the pilin-coding regions, from bases 934 to 973 (20). Six bases that are not part of the pilin DNA sequence are present at one end of the Pilin-2 set and serve to increase annealing stability. All oligonucleotides were synthesized on an Applied Biosystems 381A DNA synthesizer by the phosphoramidite method. Oligonucleotides were subsequently haptenated with either biotin or fluorescein, as indicated in Fig. 1, and were purified by denaturing polyacrylamide gel electrophoresis (25). Each oligonucleotide set was designed so that hybridization of adjacent oligonucleotides to the same target molecule formed a short gap. The gap was filled by DNA polymerase in the presence of dGTP, and the resulting nick was sealed with DNA ligase. LCR amplification and detection. Each 50-,ul amplification reaction mixture contained 4 p'l of sample, 50 mM N-(2hydroxyethyl) piperazine-N-(3 propanesulfonic acid) (pH 7.8), 10 mM MgCl2, 10 mM NH4Cl, 80 mM K+ (as OH- and Cl-), 1 mM dithiothreitol, 10 ,ug of bovine serum albumin per ml, 100 ,uM 13 NAD, 1 ,uM dGTP, 830 fmol of each of the four oligonucleotides within a set, 1 U of Amplitaq DNA polymerase (Perkin-Elmer Cetus, Norwalk, Conn.), and 3,400 U of Thermus thermophilus DNA ligase (Abbott Laboratories). With the exception of the enzymes, the complete reaction was overlayed with mineral oil and heated for 3 min in a boiling water bath to ensure sample denatur-

VOL. 30, 1992

DETECTION OF N. GONORRHOEAE BY LCR

3091

3'1

5'1

F1-CGGGCGGGGTCGTCCGTTCC TGGAAATAATATATCGAT(TCTGCG)-Bio F1-GCCCGCCCCAGCAGGCAA CCACCTTTATTATATAGCTA(AGACGC)-Bio 5' 3'

Pilin-2

33

5'

F1-GCCATATTGTGTTGAAACACCGCCC AACCCGATATAATCCGCCCTT-Bio F1-CGGTATAACACAACTTTGTGGC CCTTGGGCTATATTAGGCGGGAA-Bio

Opa-2

5'1

3'1 5'

3'

F1-CAACATCAGTGAAAATCTTTTTTTAACC TCAAACCGAATAAGGAGCCGAA-Bio F1-GTTGTAGTCACTTTTAGAAAAAAATT CCAGTTTGGCTTATTCCTCGGCTT-Bio

Opa-3 5' 3' FIG. 1. Sequences of the LCR probe sets. Pilin-2-, Opa-2-, and Opa-3-specific oligonucleotides are shown along with their associated fluorescein (Fl) or biotin (Bio) haptens. The DNA sequence that was not part of the pilin gene is enclosed by parentheses and is described in the text. Oligonucleotides are oriented to show the short gap that is filled and ligated in the presence of DNA polymerase, dGTP, and the appropriate target DNA. The 5' and 3' ends facing each gap contain a phosphoryl group or a hydroxyl group, respectively.

ation. After cooling, both enzymes were added to the appropriate concentration. A positive control (270 cell equivalents of N. gonorrhoeae) and a negative control (320 ng of human placental DNA) were included in each experiment, and all reactions were performed in duplicate. LCR was performed in a TempCycler (Coy, Ann Arbor, Mich.) for 27 cycles (Opa-2), 33 cycles (Opa-3), or 31 cycles (Pilin-2). Each cycle contained a denaturation step of 850C for 30 s and a lower temperature step at 60°C (Opa-2 and Pilin-2) or 53°C (Opa-3) for 1 min, to allow annealing, gap-filling, and ligation of the oligonucleotides. After cycling, 40 ,ul of each LCR mixture was analyzed by using a Microparticle Capture Enzyme ImmunoAssay performed on the automated IMx detection system (Abbott Laboratories) (12). Biotin-labeled oligonucleotides ligated to fluoresceinlabeled oligonucleotides were captured on antifluoresceincoated microparticles. Capture was detected by an antibiotin alkaline phosphatase conjugate which, in the presence of methylumbelliferone phosphate, generates a fluorescent product at a rate proportional to the amount of ligated oligonucleotides (17). Starting with sample preparation, results can be obtained in approximately 4 h. RESULTS Sensitivities and specificities of probes. DNA extracts of N. gonorrhoeae were diluted in human placental DNA (80 ng/ml) to approximately 270 cell equivalents per LCR (6.7 x 104 CFU/ml). Nucleic acid extracts from all other organisms were diluted so that 4 pl contained 3 ng of DNA equivalent to about 1.3 x 106 gonococcal cells per LCR (approximately 3.2 x 108 CFU/ml). The sensitivity of the Opa-2 probe set was established by using twofold dilutions of gonococcal strains 17, 41, and A3. The results in Table 2 indicate that this set of probes amplified DNA from approximately 1.1 or fewer gonococcal cells per LCR. When the three strains were tested at 1.1 cells per LCR (275 CFU/ml), the assay S/N ratios (Table 2, footnote b) were at least twofold above the negative control mean value. Under the same conditions, the sensitivities of the Opa-3 and Pilin-2 probes were found to be less than twofold lower compared with the sensitivity of the Opa-2 probe set (data not shown). To further determine the sensitivities and specificities of the three probe sets, a panel consisting of 260 microorganisms was assayed. As shown in Table 1, when gonococcal

DNA extracts were tested, the S/N ratios ranged from 21 to 162, depending on the probe set used. The range mean varied in a similar manner. In contrast, the LCR values and S/N ratios obtained with 124 nongonococcal strains, including N. meningitidis and N. lactamica, were comparable to the negative control values of 1. These results indicate that all three probe sets are specific for N. gonorrhoeae and do not amplify DNA from any of the nongonococcal organisms when used at 3 ng of DNA. Detection of N. gonorrhoeae in clinical specimens. On the basis of the promising LCR results obtained with cultured microorganisms, a small clinical study was performed to determine the capability of the selected oligonucleotide sequences to detect N. gonorrhoeae in urogenital specimens. Of the 100 clinical specimens (41 specimens from males, 59 specimens from females) included in the study, there were 8 culture-positive samples (8%) which also were LCR positive. Two of the 92 culture-negative specimens produced low positive signals with all three probe sets (Table 3). For simplicity and privacy, our clinical specimens were identified only with a convenient numbering system (1 to 100) which did not correlate with the patient sample identification system used at the clinic. Thus, the two discrepant samples could not be resolved, although the presence of N.

TABLE 2. Sensitivity of Opa-2 LCR probes with three strains of

N. gonorrhoeae Approx. no. of gonococcal cell

Mean LCR S/N value for strain":

equivalents/LCRa

17

41

16.9 8.4 4.2 2.1 1.1 0.5 0.3 0.0 (negative control)

26.6 13.8 7.9 5.5 3.3 2.3 1.6 1.OC

17.2 9.8 5.3 3.0 2.2 1.0 1.0 1.0

A3

19.3 10.9 5.8 3.2 2.2 1.4 1.0 1.0 a Values are per 4 pi; multiplication by 250 provides the number of CFU per

milliliter. b Mean of LCR S/N value based on four replicates (S/N ratios were calculated by dividing the LCR value of the sample by the LCR value of the negative control). c The value is the mean of two replicates.

3092

BIRKENMEYER AND ARMSTRONG

J. CLIN. MICROBIOL.

TABLE 3. Comparison of positive LCR results and culture with clinical specimens Sample no.

4 15 34 36 43 50 65 100 40 99

Sex" M F

M F

M M M M F F

Cultureb

LCR results with probe set':

Opa-2

Opa-3

Pilin-2

+ + + + + + + +

255.1 239.9 250.5 178.9 257.9 248.5 261.8 260.5

260.4 198.4 223.8 114.0 215.5 242.0 263.0 235.1

-

21.1

235.0 228.6 253.5 122.8 246.5 243.9 277.0 270.5 7.1e 4.0

19.4d

14.3f 8.9

a M, male; F, female. b Positive or negative for N. gonorrhoeae. cValues are means of S/N ratios based on two replicates. d The mean of the S/N ratios of the 90 remaining LCR-negative, culturenegative specimens was 0.98 (range, 0.7 to 1.5). e The mean of the S/N ratios of the 90 remaining LCR-negative, culturenegative specimens was 1.0 (range, 0.9 to 1.4). fThe mean of the S/N ratios of the 90 remaining LCR-negative, culturenegative specimens was 0.98 (range, 0.7 to 1.4).

gonorrhoeae DNA was demonstrated by all three LCR probes. On repeat LCR testing, both discordant specimens (specimens 40F and 90F) remained reactive. The culture plate of specimen 40F contained about 250 micrococcal colonies which may have obscured identification of a few gonococcal colonies. The other cultured specimen (specimen 90F) contained three nongonococcal colonies. The remaining 90 culture-negative specimens gave LCR signals comparable to background values. Compared with culture, all three probes proved to be 100% sensitive (8 of 8) and 97.8% specific (90 of 92), resulting in an agreement of 98% (98 of 100). To ensure that the clinical specimen milieu did not inhibit the LCR, selected LCR-negative samples (bloody, heavy exudate) were spiked with approximately 17 cell equivalents of N. gonorrhoeae ATCC 27630 DNA. The clinical specimen spiked with DNA showed no loss of signal when compared with the signal in a specimen with an equal concentration of DNA in the absence of swab lysate (data not shown). DISCUSSION Traditional methods that do not require culture, such as enzyme immunoassays and nonamplified DNA probe hybridization, are available for the diagnosis of gonorrhea. Although effective, these methods do not approach the sensitivity possible with a probe amplification procedure such as polymerase chain reaction or LCR. The specificities of the traditional methods rely on a single recognition step, such as antibody-antigen binding or hybridization of a DNA probe to its target. The specificity of gap-fill LCR is fourfold. First, the correct or closely related target sequence must be present in order for the LCR oligonucleotides to hybridize; second, the DNA polymerase extends only properly paired 3' ends; third, the DNA polymerase completely fills the gap between adjacent oligonucleotides only if the correct nucleotide triphosphate(s) is provided; and fourth, the DNA ligase ligates only properly paired and juxtaposed 3' and 5' ends. The polymerase chain reaction assay also requires oligonucleotide hybridization and properly paired 3' ends. However, LCR has the addi-

tional levels of specificity required by proper gap-filling and ligation. Thus, LCR is well-suited for distinguishing between very closely related sequences such as those found in N. gonorrhoeae and N. meningitidis. The nucleotide sequences of the opa genes, which encode the cell surface opacity (Opa) proteins, are relatively conserved, with the exception of a single semivariable domain and two hypervariable domains within each gene (9, 28, 32). In two gonococcal strains, the opa genes have been mapped to at least 11 loci which are distributed over a large portion of the genome (6, 11). N. meningitidis contains approximately four opa loci encoding a more limited repertoire of Opa proteins (1, 18, 29). DNA sequences targeted by the Opa-2 LCR probes are upstream of the opa-coding region and encompass the -35 and -10 transcription promoter regions (5). The sequence homologous to the Opa-3 LCR probes contains the ribosome-binding site (5) and extends downstream from the Opa-2 region to just before the Opa start codon. The pilin proteins are also encoded by a multicopy gene family that comprises either partial or complete copies of the pil genes (20, 26). Like the opa genes, the pil genes contain a semivariable domain and two hypervariable domains embedded in a conserved framework (4, 15, 22). To date, seven gonococcalpil loci have been mapped, and in contrast to the opa genes, most of them are closely linked (6, 11). The sequence recognized by the Pilin-2 LCR probes is downstream of the pilin-coding region and contains part of the conserved SmaI-ClaI repeat which is hypothesized to be involved in recombination-dependent switching of pilin

expression (24). By using multicopy target sequences versus a single-copy target, probe sensitivity is enhanced, and the probability of losing all target copies because of deletion or interstrain variability is reduced. Such a loss in a clinical isolate seems particularly unlikely when the target sequences are involved in the expression of genes associated with pathogenicity. Probes to the multicopy gonococcal plasmid were not tested since the plasmid is not present in all strains (10). On the basis of the results of preliminary experiments (data not shown), three probe sets were selected for further evaluation with a panel of 260 different microorganisms. This panel covered a wide spectrum of genera and species including 136 gonococcal strains recovered from patients around the world. The three sets of probes evaluated were able to amplify DNA recovered from all of the gonococcal isolates, indicating that the probe sequences chosen were conserved among all gonococci tested. Although the Opa-2 oligonucleotides were slightly more sensitive, the remaining two probe sets (Opa-3, Pilin-2) also effectively amplified gonococcal DNA. The ability of the LCR to detect a single gonococcal cell was not unexpected. As indicated earlier, the primer sets hybridized with multicopy target sequences within a single genome. The probes did not amplify nucleic acids from 74 isolates of nongonococcal Neisseria species including 41 strains of N. meningitidis, 10 isolates of N. lactamica, and Neisseria sp. strain ATCC 43831, which serologically resembles N. gonorrhoeae but biochemically is characteristic of N. meningitidis. In addition, DNA extracts from 47 non-Neisseria strains that are able to inhabit the urogenital tract did not react with the probes. These results indicate that the three probe sets were specific for N. gonorrhoeae since amplification occurred only in the presence of gonococcal DNA. The ability to differentiate between N. gonorrhoeae and closely related strains of N. meningitidis is particularly

DETECTION OF N. GONORRHOEAE BY LCR

VOL. 30, 1992

important since N. meningitidis occasionally may be isolated from urogenital specimens (8, 16). To further evaluate the sensitivities and specificities of the DNA probes, 100 clinical specimens were assayed by LCR. All eight of the clinical samples harboring viable N. gonorrhoeae were positive. Two specimens, from which viable N. gonorrhoeae was not recovered by culture, were low positive by LCR. These positive results may be due to the superior sensitivity of LCR compared with that of culture. These probes did not cross-react with organisms usually found in urogenital specimens, making highly unlikely the amplification of nongonococcal DNA. In addition, all three probe sets were positive with these culture-negative specimens, further confirming the presence of gonococcal DNA. It is possible to envision a set of circumstances whereby a sample could contain only dead organisms, with the residual DNA serving as functional template to which the probes could hybridize. As indicated earlier, we were unable to resolve these discordant results because of the study plan design. The N. gonorrhoeae DNA probe sequences described in this report are gonococcal specific and, although based on a relatively few clinical samples, appear to offer an alternative to culture for the detection of N. gonorrhoeae in urogenital specimens. LCR is a DNA amplification technology which holds promise as a specific and sensitive method for the detection of infectious agents in clinical specimens. The DNA detection technology described in this report warrants further evaluation as a reliable method for the diagnosis of gonorrhea. ACKNOWLEDGMENTS We thank Isa Mushahwar for support and encouragement during the study. Also, we thank the patients for cooperation and acknowledge the support and enthusiasm of Irene Pierce and her congenial staff at the Lake County Health Department. We gratefully acknowledge William Bringer for technical assistance, Ron Marshall for the IMx reagents and Carolyn Ross for the oligonucleotides. We thank Nancy Miller for typing the manuscript. REFERENCES 1. Aho, E. L., J. A. Dempsey, M. M. Hobbs, D. G. Klapper, and J. G. Cannon. 1991. Characterization of the opa (class 5) gene family of Neisseria meningitidis. Mol. Microbiol. 5:1429-1437. 2. Backman, K. December 1987. European patent A-320,308. 3. Backman, K., J. J. Carrino, S. B. Bond, and T. G. Laffier. January 1990. European patent 439,182A. 4. Bergstrom, S., K. Robbins, J. M. Koomey, and J. Swanson. 1986. Piliation control mechanisms in Neisseria gonorrhoeae. Proc. Natl. Acad. Sci. USA 83:3890-3894. 5. Bhat, K. S., C. P. Gibbs, 0. Barrera, S. G. Morrison, F. Jfihnig, A. Stern, E.-M. Kupsch, T. F. Meyer, and J. Swanson. 1991. The opacity proteins of Neisseria gonorrhoeae strain MS11 are encoded by a family of 11 complete genes. Mol. Microbiol. 5:1889-1901. 6. Bihlmaier, A., U. Romling, T. F. Meyer, B. Tummler, and C. P. Gibbs. 1991. Physical and genetic map of the Neisseria gonorrhoeae strain MS11-N198 chromosome. Mol. Microbiol. 5:2529-2539. 7. Birkenmeyer, L. G., and I. K. Mushahwar. 1991. DNA probe amplification methods. J. Virol. Methods 35:117-126. 8. Conde-Glez, C. J., and E. Calderon. 1991. Urogenital infection due to meningococcus in men and women. Sex. Transm. Dis.

18:72-75. 9. Connell, T. D., W. J. Black, T. H. Kawula, D. S. Barritt, J. A. Dempsey, K. Kverneland, Jr., A. Stephenson, B. S. Schepart, G. L. Murphy, and J. G. Cannon. 1988. Recombination among protein II genes of Neisseria gonorrhoeae generates new coding sequences and increases structural variability in the protein II

3093

family. Mol. Microbiol. 2:227-236. Copely, C. G., and I. Egglestone. 1982. Gonococci without plasmids. Lancet i:1133. 11. Dempsey, J. A. F., W. Litaker, A. Madhure, T. L. Snodgrass, and J. G. Cannon. 1991. Physical map of the chromosome of Neisseria gonorrhoeae FA1090 with locations of genetic markers, including opa and pil genes. J. Bacteriol. 173:5476-5486. 12. Fiore, M., J. Mitchell, T. Doan, R. Nelson, G. Winter, C. Grandone, K. Zeng, R. Haraden, J. Smith, K. Harris, J. Leszczynski, D. Berry, S. Safford, G. Barnes, A. Scholnick, and K. Ludington. 1988. The Abbott IMx automated benchtop immunochemistry analyzer system. Clin. Chem. 34:1726-1732. 13. Goodhart, M. E., J. Ogden, A. A. Zaidi, and S. J. Kraus. 1982. Factors affecting the performance of smear and culture tests for the detection of Neisseria gonorrhoeae. Sex. Transm. Dis. 10.

9:63-69.

14. Grubin, L., and N. G. Osborne. 1987. Enzyme immunoassay for detection of Neisseria gonorrhoeae from urogenital samples. Obstet. Gynecol. 69:350-353. 15. Hagblom, P., E. Segal, E. Billyard, and M. So. 1985. Intragenic recombination leads to pilus antigenic variation in Neisseria gonorrhoeae. Nature (London) 315:156-158. 16. Hagman, M., L. Forslin, H. Moi, and D. Danielsson. 1991. Neisseria meningitidis in specimens from urogenital sites. Is increased awareness necessary? Sex. Transm. Dis. 18:228-232. 17. Hampl, H., R. A. Marshall, T. Perko, and N. Solomon. 1991. Alternative methods for DNA probing in diagnosis: ligase chain reaction (LCR), p. 15-22. In A. Rolfs, H. C. Schumacher, and P. Marx (ed.), PCR topics. Springer-Verlag, Berlin. 18. Kawula, T. H., E. L. Aho, D. S. Barritt, D. G. Klapper, and J. G. Cannon. 1988. Reversible phase variation of expression of Neisseria meningitidis class S outer membrane proteins and their relationship to gonococcal proteins II. Infect. Immun. 56:380-386. 19. Kissane, J. M., and E. Robins. 1958. The fluorometric measurement of deoxynucleic acid in animal tissues with special reference to the central nervous system. J. Biol. Chem. 233:184-188. 20. Meyer, T. F., E. Billyard, R. Haas, S. Storzbach, and M. So. 1984. Pilus genes of Neisseria gonorrhoeae: chromosomal organization and DNA sequence. Proc. Natl. Acad. Sci. USA

81:6110-6114.

21. Nash, P., and M. Krenz. 1991. Culture media, p. 1226-1288. In A. Balows, W. J. Hausler, Jr., K. L. Herrmann, H. D. Isenberg, and H. J. Shadomy (ed.), Manual of clinical microbiology, 5th ed. American Society for Microbiology, Washington, D.C. 22. Nicolson, I. J., A. C. F. Perry, M. Viiji, J. E. Heckels, and J. R. Saunders. 1987. Localization of antibody-binding sites by sequence analysis of cloned pilin genes from Neisseria gonorrhoeae. J. Gen. Microbiol. 133:825-833. 23. Panke, E. S., L. I. Yang, P. A. Leist, P. Magenney, R. J. Fry, and R. F. Lee. 1991. Comparison of Gen-Probe DNA probe test and culture for the detection of Neisseria gonorrhoeae in endocervical specimens. J. Clin. Microbiol. 29:883-888. 24. Perry, A. C. F., I. J. Nicolson, and J. R. Saunders. 1987. Structural analysis of the pil E region of Neisseria gonorrhoeae P9. Gene 60:85-92. 25. Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y. 26. Segal, E., P. Hagblom, H. S. Seifert, and M. So. 1986. Antigenic variation of gonococcal pilus involves assembly of separated silent gene segments. Proc. Natl. Acad. Sci. USA 83:2177-2181. 27. Stamm, W. E., B. Cole, C. Fennel, P. Bonin, A. S. Armstrong, J. E. Herrmann, and K. K. Holmes. 1984. Antigen detection for the diagnosis of gonorrhea. J. Clin. Microbiol. 19:399-403. 28. Stern, A., M. Brown, P. Nickel, and T. F. Meyer. 1986. Opacity genes in Neisseria gonorrhoeae: control of phase and antigenic variation. Cell 47:61-71. 29. Stern, A., and T. F. Meyer. 1987. Common mechanism controlling phase and antigenic variation in pathogenic neisseriae. Mol. Microbiol. 1:5-12. 30. Torres, M. J., R. Cano, and J. C. Palomares. 1991. Evaluation of a DNA probe of plasmid origin for the detection of Neisseria

3094

BIRKENMEYER AND ARMSTRONG

gonorrhoeae in cultures and clinical specimens. Mol. Cell. Probes 5:49-54. 31. Toten, P. A., K. K. Holmes, H. H. Handsfield, J. S. Knapp, P. L. Perine, and S. Falkow. 1983. DNA hybridization technique for the detection ofNeisseria gonorrhoeae in men with urethritis. J. Infect. Dis. 148:462-471. 32. van der Ley, P. 1988. Three copies of a single protein II-

J. CLIN. MICROBIOL.

encoding sequence in the genome of Neisseria gonorrhoeae JS3: evidence for gene conversion and gene duplication. Mol. Microbiol. 2:797-806. 33. Westrom, L., and P. A. Mardh. 1990. Acute pelvic inflammatory disease (PID), p. 593-613. In K. Holmes, P. A. Mardh, P. Sparling, and P. Wiesner (ed.), Sexually transmitted diseases. McGraw-Hill Book Co., New York.