227
Journal of Alzheimer’s Disease 46 (2015) 227–238 DOI 10.3233/JAD-131628 IOS Press
Pregnancy Zone Protein is Increased in the Alzheimer’s Disease Brain and Associates with Senile Plaques Diana A.T. Nijholta,1 , Linda Ijsselstijna,1 , Marcel M. van der Weidenb , Ping-Pin Zhengb , Peter A. E. Sillevis Smitta , Peter J. Koudstaala , Theo M. Luidera and Johan M. Krosb,∗ a Department b Department
of Neurology, Erasmus Medical Center, Rotterdam, The Netherlands of Pathology, Erasmus Medical Center, Rotterdam, The Netherlands
Accepted 11 February 2015
Abstract. Increased levels of pregnancy zone protein (PZP) were found in the serum of persons who later developed Alzheimer’s disease (AD) in comparison to controls who remained dementia free. We suggested that this increase is due to brain derived PZP entering the blood stream during the early phase of the disease. Here we investigate the possible involvement of PZP in human AD pathogenesis. We observed increased PZP immunoreactivity in AD postmortem brain cortex compared to non-demented controls. In the AD cortex, PZP immunoreactivity localized to microglial cells that interacted with senile plaques and was occasionally observed in neurons. Our data link the finding of elevated serum PZP levels with the characteristic AD pathology and identify PZP as a novel component in AD. Keywords: Alzheimer’s disease, microglia, pregnancy zone protein
INTRODUCTION Our recent proteomics based search for serum biomarkers identified pregnancy zone protein/PZPlike ␣2-macroglobulin domain-containing protein 6 (PZP/CPAMD6) as a potential biomarker for presymptomatic Alzheimer’s disease (AD). Absolute measurements in serum samples derived from the Rotterdam Scan Study, a population based prospective study cohort, demonstrated increased PZP levels in persons who later developed AD compared to persons who remained cognitively healthy [1]. PZP belongs to the ␣-macroglobulin (␣M) protein family and is highly homologous to ␣2-macroglobulin (␣2MG, 73% amino acid sequence identity [2]). Con1 These
authors contributed equally to this manuscript. to: Johan M. Kros, MD, PhD, Department of Pathology, Erasmus Medical Center, P.O. Box 2040, 3000 CA Rotterdam, The Netherlands. Tel.: +31 10 7043905; E-mail: [email protected]. ∗ Correspondence
trary to ␣2MG, levels of which are constitutively high in the serum (1-2 g/l [3]), PZP is normally a trace protein (10–100 mg/l [4]) that is strongly upregulated during pregnancy (1-2 g/l, [5]). ␣2MG and PZP are best known as pan-protease inhibitors as they are capable of binding, capturing, and inhibiting all classes of proteases [6]. Protease inhibition is important for several biological pathways, e.g., the regulation of coagulation and fibrinolysis and the regulation and containment of an immune response [7]. For ␣2MG, binding and regulation of growth factors, cytokines, and hormones was also reported [7]. All ␣M proteins contain a proteolysis sensitive ‘bait’ or ‘capture’ region and an internal -cysteinyl-␥-glutamyl thiolester. Binding to and cleavage of the bait region by proteases or nucleophilic attack of the thiolester by monoamines triggers a conformational change that allows the ␣M to effectively capture its ligand [8]. Upon capture the protease is sterically hindered from interaction with macromolecular substrates. Interestingly, the bait region of
ISSN 1387-2877/15/$35.00 © 2015 – IOS Press and the authors. All rights reserved
228
D.A.T. Nijholt et al. / Pregnancy Zone Protein in Alzheimer’s Disease
PZP is the region with the lowest similarity to ␣2MG, suggestive of a difference in ligand binding affinity and functionality [9]. The altered ␣M conformational state facilitates exposure of receptor binding sites and binding to the main ␣M receptor low density lipoprotein receptor-related protein (LRP)1 [7]. Upon binding the ligand-␣M-receptor complex is internalized via endocytosis. Dissociation of the ligand-␣M from LRP1 upon acidification of the endosomal compartment allows LRP1 to cycle back to the cell surface, whereas the ligand-␣M is degraded by lysosomal enzymes [10, 11]. In addition, LRP1 is involved in transcytosis of ligands across cells. For example it plays an important role in the transport of amyloid- (A) across the blood-brain barrier [12]. Expression of ␣M proteins is reported in the brain [13, 14] and here ␣2MG has received most attention as it was implicated in the pathogenesis of AD. In the brain ␣2MG is thought to be involved in the clearance of A from the extracellular environment via LRP1 [6, 15–17]. Interestingly, our prospective study did not identify ␣2MG, but the similar PZP, as a potential biomarker for presymptomatic AD [1]. PZP has not yet been extensively studied in the context of the brain or neurodegeneration. A positive association was reported between a SNP in the coding region of the PZP gene and late-onset AD [18, 19]. In vitro, activated PZP was shown to inhibit nerve growth factor mediated neurite outgrowth and TrkA mediated signal transduction in PC12 cells in a dose dependent manner [20]. Our immunohistochemical analysis of PZP expression on a limited set of AD cases (n = 2) compared to controls suggested increased PZP immunoreactivity in the AD brain [1]. These observations, combined with increased PZP serum levels in presymptomatic AD, led to the hypothesis that PZP plays a role in AD pathophysiology. The aim of the present study was to detail the expression of PZP in a larger cohort of AD brains (n = 20) and link PZP expression to AD pathology. MATERIALS AND METHODS Antibody characterization Antibody characterization was performed via immunoprecipitation (IP) and nano liquid chromatography (nLC) - Orbitrap mass spectrometry (MS/MS). For immunoprecipitation, 7.5 g antibody was coupled to 1.5 mg Protein G conjugated Dynabeads (Invitrogen Life Technologies, Paisley, UK) according to the manufacturer’s instructions. Antibody coupled Dynabeads were incubated with 10 l serum from
a pregnant woman (written informed consent available) for 16 h at 4◦ C. Following incubation beads were washed 3 × 5 min in 1x phosphate buffered saline (PBS) with 0.05% Tween20 and 3 × 5 min in 1 × PBS without Tween20. Target was eluted from the beads using 50 mM Glycine (pH 2.5) and 20 min shaking at room temperature. Following elution the pH of the eluate was adjusted to pH 7 using Tris-Base (pH 10). Samples were digested with trypsin and analyzed on an nLC coupled online to a hybrid linear ion trap/Orbitrap mass spectrometer as previously described [21]. Postmortem brain tissue Postmortem brain tissue was obtained from The Netherlands Brain Bank (Amsterdam, The Netherlands). All donors or their next of kin provided written informed consent for brain autopsy and use of tissue and medical records for research purposes. For this study freshly frozen superior frontal gyrus (SFG) from 20 AD and 7 non-demented controls was used. Clinical diagnosis, gender, age, postmortem delay (PMD), and Braak stage of all cases are listed in Table 1. Immunohistochemical analysis Cryosections (5-m thick) were mounted on StarFrost Microscope Slides (Waldemar Knittel, Braunschweig, Germany) and dried overnight at room temperature. Sections were fixed in ice-cold acetone (Sigma-Aldrich, Zwijndrecht, The Netherlands) for 10 min and allowed to air dry. For single immunohistochemistry, sections were washed in 1 × PBS and subsequently incubated with primary antibody (Table 2) for 60 min at room temperature. All primary antibodies were diluted in PBS containing 1% (w/v) bovine serum albumin (BSA, Sigma-Aldrich). Negative controls were generated by omission of primary antibodies. Sections were washed 3 × 10 min in PBS and subsequently incubated with BrightVision alkaline phosphatase conjugated goat ␣-rat/rabbit/mouse IgG (Immunologic, Duiven, The Netherlands) for 60 min at room temperature. Sections were washed and colour was developed with Fuchsine as chromogen. Nuclei were counterstained using hematoxylin and sections were mounted using Aqua/polymount (Polysciences, Warrington, PA, USA). Immunoreactive (IR) cells were counted in 4 × 0.25 mm2 areas (∼1 mm2 ) of SFG grey matter (cortex) and neighboring white matter. Sections were scored as
D.A.T. Nijholt et al. / Pregnancy Zone Protein in Alzheimer’s Disease
229
Table 1 Patient characteristics Case 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27
Clinical diagnosis
Gender
Age
PMD (h:m)
Braak score for NFT
Braak score for amyloid
Control Control Control Control Control Control Control AD AD AD AD AD AD AD AD AD AD AD AD AD AD AD AD AD AD AD AD
F M F F M F M F F F F F F F F F F F F F F M F F M F F
54 80 61 78 79 97 74 89 92 84 54 97 78 71 87 90 90 87 80 82 63 63 79 69 58 75 91
8:00 6:56 10:15 4:15 6:00 10:00 5:53 2:55 4:00 3:50 3:15 3:30 4:25 4:20 6:20 3:10 3:50 6:55 4:25 3:15 4:00 6:00 4:10 4:00 5:10 3:35 4:35
0 0 1 1 1 2 2 4 4 4 5 5 5 5 5 5 5 5 5 6 6 6 6 6 6 6 6
O O O O B B O B C C C C B C C C C B C B C C C C C C C
PMD, postmortem delay (hours: minutes); NFT, neurofibrillary tangles; AD, Alzheimer’s disease; F, female; M, male.
Table 2 Primary antibodies used in this study Antibody
Species
Mono/polyclonal
Concentration
Dilution IHC fIHC
Company/catalog number
Pregnancy zone protein (PZP)
Rabbit
Polyclonal
1 mg/ml
1:100
1:100
Monoclonal
1 mg/ml
1:150
–
Mouse
Polyclonal
1 mg/ml
–
1:100
Mouse
Monoclonal
2.5 mg/ml
–
1:100
Mouse
Monoclonal
1 mg/ml
–
1:100
Mouse
Monoclonal
0.5 mg/ml
–
1:100
GeneTex, Irvine, USA/GTX102547 Abcam, Cambridge, USA/Ab91104 Sigma Aldrich, St Louis, USA/WH0001524M1 Dako, Glostrup, Denmark/ z0334 Novus Biologicals, Littleton, USA/NBP1-92693V2 Dako, Glostrup, Denmark/Ab2539
Alpha-2-macroglobulin (␣2MG) chemokine (C-X3-C motif) receptor 1 (CX3CR1) glial fibrillary acidic protein (GFAP) Neuron-specific nuclear protein (NeuN) Amyloid- (A)
Mouse
IHC, immunohistochemistry; fIHC, fluorescent immunohistochemistry.
follows: level 1, 0–25 IR cells; level 2, 26–50 IR cells; level 3, 51–100 IR cells; level 4, >100 IR cells. When a structure was highly immunoreactive, but separate cells could not be discriminated, it was counted as one. Scoring was performed by two independent observers
blinded for patient data. Statistical analysis was performed using the SPSS statistical software package version 20.0 (SPSS Inc, Chicago, Illinois, USA). The Mann-Whitney test was used to test for differences between AD and controls.
230
D.A.T. Nijholt et al. / Pregnancy Zone Protein in Alzheimer’s Disease Table 3 Oligonucleotide probes for FISH
Name PZP Scramble
Nucleotide sequence (5 −→ 3 ) tttgtccgggttttcactgtgcatc gcgtctgttatcgccttatcttggt
RNA fluorescent in situ hybridization RNA fluorescent in situ hybridization (FISH) was performed to visualize PZP mRNA in brain tissue sections. Oligonucleotide probes (HPLC purified and 5’ biotin labelled) (Table 3) were purchased from Sigma-Aldrich. The PZP probe was targeted to the least ␣2MG homologous region of PZP (exons 11 and 12) and designed to cross the exon 11–exon 12 boundary for binding to mRNA only. The PZP mRNA oligonucleotide sequence was scrambled and used as a negative control probe. BLAST analysis (http://blast.ncbi.nlm.nih.gov) demonstrated that the PZP probe was specific for PZP mRNA and the scrambled probe did not interact with other sequences in the human genome. Prior to the experiment, all glassware was baked at 180◦ C and all reagents were treated with diethylpyrocarbonate (DEPC, Sigma-Aldrich) to abolish RNase activity and subsequently autoclaved. Cryosections (5-m thick) were cut and pasted on baked StarFrost Microscope Slides (Waldemar Knittel) and dried at room temperature for 15 min. Sections were fixed for 10 min in FAAS fixative containing 3.7% formaldehyde (Sigma-Aldrich), 5% acetic acid (Sigma-Aldrich), and 0.85% (w/v) NaCl in ddH2 O. Tissue slides were washed 2 × 5 min in 1x PBS at room temperature. Slides were subsequently transferred to 70% ethanol/ddH2 O solution and incubated overnight at 4◦ C. Slides were rehydrated in 2× saline-sodium citrate (SSC)/50% deionized formamide (Sigma-Aldrich) solution for 15 min and subsequently incubated overnight with 40 l/slide probe mix in a humid chamber at 37◦ C. Probe mix consisted of 1 ng/l oligonucleotide probe, 1 g/l yeast transfer ribonucleic acid, 33.3% deionized formamide, 1× hybridization buffer (2× concentrated contains: 4× SSC/20% dextran sulphate (Sigma-Aldrich)/0.4% (w/v) BSA) in ddH2 O. Following incubation slides were washed 2 × 15 min with 2× SSC/50% deionized formamide heated to 37◦ C followed by 2 × 5 min washing with 2× SSC at room temperature. For visualization of the biotin label, slides were washed in 1× PBS and incubated with streptavidin Cy3 (1:100 dilution in 1× PBS) for 2 h at room temperature. Slides
were subsequently washed 3 × 5 min in 1× PBS and nuclei were counterstained with DAPI (50 ng/ml). As an additional negative control sections were treated as above, but the oligonucleotide probes were omitted. Sections were mounted using Aqua/polymount and analyzed with a Zeiss LSM700 confocal laser scanning microscope. For non-fluorescent in situ hybridization the experiment was performed as described above up to the 2× SSC wash at room temperature. Slides were subsequently incubated with streptavidin/HRP (Dako, Glostrup, Denmark, 1:100 dilution in 1× PBS) for 2 h at room temperature. Color was developed using Liquid DAB+ Substrate Chromogen System (Dako). Nuclei were counterstained using hematoxylin and sections were mounted using Aqua/polymount. Fluorescent double immunohistochemistry Fluorescent double immunohistochemistry of PZP with chemokine (C-X3-C motif) receptor 1 (CX3CR1, marker for microglial cells), glial fibrillary acidic protein (GFAP, marker for astrocytes), A and neuronspecific nuclear protein (NeuN, marker for neurons) was performed on a selected set of tissue sections. Primary antibodies and dilutions used are described in Table 2. All primary and secondary antibodies were diluted in PBS containing 1% (w/v) BSA. Performance of all primary antibodies was assessed in single immunohistochemistry stainings parallel to the double immunohistochemistry stainings. Negative controls were generated by omission of primary antibodies. Cryosections were fixed in ice-cold acetone for 10 min and subsequently air-dried. Sections were washed in 1x PBS and incubated overnight at 4◦ C with a mixture of primary antibodies. Following incubation with primary antibodies sections were washed 3 × 10 min in PBS and subsequently incubated with biotinylated goat ␣-rabbit IgG (1:100 dilution, Dako) and Cy3 conjugated goat ␣-mouse IgG (1:100, Jackson ImmunoResearch Laboratories, Westgrove, PA, USA) for 60 min at room temperature. Sections were washed 3x 10 min in PBS and incubated with FITC conjugated streptavidin (1:100 dilution, Jackson ImmunoResearch) for 60 min at room temperature. Sections were subsequently washed 3x 10 min in PBS and nuclei were counterstained with DAPI (50 ng/ml). To also visualize amyloid plaques in the PZP/CX3CR1 double immunohistochemistry staining, slides were incubated with Amylo-Glo RTD Amyloid plaque stain reagent (Biosensis, Thebarton, Australia) after the final antibody detection step. The DAPI nuclear counterstain step was omitted
D.A.T. Nijholt et al. / Pregnancy Zone Protein in Alzheimer’s Disease
when Amylo-Glo was used. Autofluorescence was quenched using Sudan Black B (Sigma-Aldrich). Sections were mounted using Aqua/polymount and analyzed with a Zeiss LSM700 confocal laser scanning microscope. RESULTS PZP antibody characterization Due to the high sequence similarity between PZP and ␣2MG, we first determined the specificity of the commercially available GeneTex PZP antibody using IP followed by nLC Orbitrap MS/M) analysis. This method allows us to identify antibody bound proteins with high specificity and sensitivity. During pregnancy, serum levels of both ␣2MG and PZP are high, making this material suitable for antibody characterization. Serum from a pregnant woman was incubated with PZP antibody coupled magnetic beads. As a negative control, the serum sample was incubated with magnetic beads coupled to CX3CR1 antibody, a protein not expected to be present in serum. Following incubation and elution, the bead eluate was digested with trypsin and the obtained peptides were analyzed using nLC-MS/MS. A total of 43 unique PZP derived peptides (45% sequence coverage) were identified in the PZP IP sample, resulting in 100% protein identification probability. As expected, no CX3CR1 was immunoprecipitated from serum, nor was PZP detected in this sample. Furthermore, no ␣2MG derived peptides were detected in the PZP IP sample indicating the antibody is specific for PZP and can be used for immunohistochemical assessment. Expression of PZP is increased in the AD brain Cryosections of the SFG of 20 AD and 7 control cases were assessed for PZP expression. Immunohistochemical evaluation revealed PZP immunoreactive cells in the cortex and subcortical white matter of the SFG of both AD and control cases (Fig. 1). Based on their morphology these cells were characterized as glial cells. The PZP staining pattern differed from that observed for ␣2MG (compare Fig. 1A–D with Fig. 1G), further confirming the findings of our antibody characterization experiment. PZP immunoreactivity was most pronounced in the AD brain; an increased number of PZP immunoreactive cells were visible with increased staining intensity compared to controls (compare Fig. 1A,C with Fig. 1B,D). FISH was used to confirm expression of PZP in the brain at
231
the mRNA level in a subset of our cases: 2 controls (#2 and 4) and 4 AD (#13, 15, 20, and 24). Fig. 2A shows the presence of PZP mRNA in the AD cortex, visualized using a fluorescently labelled PZP specific oligonucleotide probe. No positive signal was detected when a scrambled oligonucleotide probe (Fig. 2B) was used or when the PZP oligonucleotide probe was omitted. A non-fluorescent in situ hybridization assay, inset in Fig. 2A, shows a cell with glial morphology expressing PZP mRNA. We observed a similar pattern for PZP mRNA expression in control brain tissue (data not shown). A semi-quantitative method was used to score PZP expression in the immunohistochemical approach shown in Fig. 1. PZP immunoreactive cells were counted in 4 × 0.25 mm2 (∼1 mm2 ) areas of cortex and neighboring white matter and assigned a scoring level (ranging from 1–4, described in the Materials and Methods section). All scoring levels per case are described in Table 4. We found a significant increase (Mann-Whitney test, p < 0.01) in PZP scoring level in AD cases compared to controls, reflective of the increased number of PZP immunoreactive cells. The increase was only significant in the SFG cortex (Fig. 3A), whereas a trend toward, but no significant difference, was observed in the neighboring white matter (Fig. 3B). In the cortex, PZP scoring level correlated positively with Braak stage for neurofibrillary tangles (r = 0.794; p < 0.0001, Fig. 3C) and amyloid deposition (r = 0.683; p < 0.0001, Fig. 3D). PZP immunoreactive microglia associate with amyloid plaques in the AD brain The increase in PZP immunoreactivity was most pronounced in the AD SFG cortex, which typically contains a high number of amyloid plaques. We used double immunohistochemistry on a subset of our cases—2 controls (#2 and 4) and 4 AD (#13, 15, 20, and 24)—to visualize both PZP and amyloid plaques (using an antibody directed against A). PZP immunoreactivity was observed in and surrounding A positive senile plaques in the AD cortex (Fig. 4A). No plaques were observed in control SFG (data not shown). Higher magnification analysis revealed PZP immunoreactive cells located between the plaque core and corona or closely associated with its outer edge. Strong PZP immunoreactive protrusions were observed running through the plaque (Fig. 4B–D). We further characterized these PZP immunoreactive cells in the AD SFG cortex (cases #13,
232
D.A.T. Nijholt et al. / Pregnancy Zone Protein in Alzheimer’s Disease
Fig. 1. Expression of PZP is increased in AD SFG. Immunohistochemical detection of PZP in the cortex and neighboring white matter of AD (A,C) and control (B,D) SFG. Shown are representative images of immunohistochemistry for all cases and controls. Arrows indicate the area shown in detail in the inset. Negative controls (primary antibody omission) are shown for cortex (E) and white matter (F). Immunohistochemical detection of ␣2MG in AD SFG cortex (G) demonstrates a distinct staining pattern that differs from PZP. Nuclei were counterstained using hematoxylin (blue). Scale bars: 200 m.
15, 20, and 24) using double immunohistochemistry combined with the fluorescent dye Amylo-Glo that visualizes amyloid plaques. PZP immunoreactive cells associating with senile plaques colocalized with the microglia marker chemokine (C-X3-C motif) receptor 1 (CX3CR1) indicating these cells are microglia (Fig. 5A,B). We observed no colocalization of PZP with the astrocyte marker GFAP (Fig. 5C).
PZP immunoreactivity is present in neurons in the AD brain Within the AD SFG cortex, we occasionally observed PZP immunoreactivity in cells that morphologically resembled neurons. In order to confirm these cells are neurons, we performed double immunohistochemistry on a subset of our cases [2 controls (#2 and 4) and 4 AD (#13, 15, 20, and 24)] using
D.A.T. Nijholt et al. / Pregnancy Zone Protein in Alzheimer’s Disease
233
Fig. 2. Expression of PZP mRNA in AD SFG. Detection of PZP mRNA by FISH in the AD cortex using a PZP specific oligonucleotide probe revealed a punctate pattern (red, A). No signal was detected when a scrambled probe (B) was used or when probes were omitted (data not shown). Nuclei were stained using DAPI (blue). Experiment consisted of 2 control and 4 AD cases. The inset in panel A shows an in situ hybridization experiment in which the PZP specific oligonucleotide was visualized using DAB and nuclei were counterstained using hematoxylin. Scale bar: 15 m. Table 4 PZP Immunohistochemistry scores
PZP immunoreactivity was observed in neurons of the control SFG (Fig. 6B).
Case Clinical diagnosis Scoring level cortex Scoring level WM 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27
Control Control Control Control Control Control Control AD AD AD AD AD AD AD AD AD AD AD AD AD AD AD AD AD AD AD AD
1 2 1 2 1 1 1 na 3 3 2 3 3 na 2 4 3 4 4 3 3 4 4 3 3 2 4
3 3 3 3 3 3 3 3 3 3 3 3 4 4 3 4 3 4 3 3 3 4 4 na 4 na 4
WM, white matter; AD, Alzheimer’s disease; na, not assessed.
antibodies directed against PZP and the neuronal marker NeuN. Neurons containing PZP immunoreactivity were observed in the AD SFG alongside neurons that did not show PZP immunoreactivity (Fig. 6A). No
DISCUSSION Our laboratory previously identified the protease inhibitor protein PZP as a potential serum biomarker for presymptomatic AD [1]. In this study we assessed the expression of PZP in the brain (SFG) in relation to AD pathophysiology and found increased PZP immunoreactivity in AD cases compared to controls. Using nLC-MS/MS, we first confirmed specificity of our antibody for PZP and excluded cross reactivity with the highly similar ␣2MG. We made use of immunohistochemistry (Fig. 1) and FISH (Fig. 2) to confirm expression of PZP in the brain. In general, strong PZP immunoreactivity was observed in the white matter of both AD and control cases. A significant increase in PZP immunoreactivity was observed in the AD SFG cortex and this correlated positively with Braak stages for neurofibrillary tangles and amyloid deposition (Fig. 3). Here, PZP immunoreactive microglia (Figs. 4 and 5) associated with senile plaques. In addition, PZP immunoreactive neurons were observed in AD but not in control SFG (Fig. 6). Our observations indicate that PZP plays a role early in AD pathophysiology, although its precise function remains unknown. Microglia, the resident macrophages of the brain, play an important role in the AD process [22]. They can be neuroprotective, as they are involved in the clearance of A from the brain interstitial space, but can also
234
D.A.T. Nijholt et al. / Pregnancy Zone Protein in Alzheimer’s Disease
A
B
C
D
Fig. 3. Increased PZP immunoreactivity positively correlates with Braak staging for neurofibrillary tangles and amyloid deposition. PZP immunoreactivity (IR) scores were depicted as a percentage of the total AD and control (Ctr) cases for the cortex (A) and neighboring white matter (B). Asterisk (*) signifies p < 0.01 using the Mann Whitney test. A positive correlation exists between PZP IR score and Braak staging for neurofibrillary tangles (NFT) (C) and amyloid (D) deposition (Spearman non-parametric analysis) in the SFG cortex.
mediate neurotoxic effects due to cytokine production [23]. Our finding that PZP is strongly expressed in microglia in the vicinity of senile plaques, in addition to its similarity to ␣2MG, suggests that PZP is involved in plaque dynamics. Complexes formed by PZP and its ligands can bind LRP1 and be subsequently internalized via endocytosis [24, 25]. LRP1 is strongly expressed in the brain, mainly in the entorhinal cortex, hippocampus, and cerebellum, and is also found on microglia [26], neurons [27, 28], activated astrocytes [29], brain endothelial cells, pericytes, and vascular smooth muscle cells [29]. This suggests that PZP aids in the receptor mediated endocytosis and lysosomal clearance of A or other plaque derived components and acts neuroprotective. Internalization of PZP-ligand complexes by LRP1 present on neurons explains the neuronal PZP immunoreactivity that we observed in the AD SFG. Defects in the endosomal-lysosomal route are apparent in early AD [30–32] and therefore
PZP-ligand complexes may accumulate as they can no longer be efficiently degraded. Alternatively, PZP may inhibit the action of proteases involved in the degradation of plaque components and in this manner facilitate plaque formation. Microglia that interact with plaques in the brain are in an activated state [33], suggesting that PZP is upregulated in a specific subgroup of microglia. However, relatively high PZP immunoreactivity was observed in white matter for both AD and control cases. It has been suggested that white matter microglia exist at a higher basal level of activation under physiological conditions when compared to areas with no or less myelination [34]. This may explain why levels of PZP are, in general, higher in white matter compared to the cortex and PZP is expressed in (activated) microglia that interact with senile plaques in the AD brain. In our previous study, we observed increased serum levels of PZP in presymptomatic AD cases [1]. It
D.A.T. Nijholt et al. / Pregnancy Zone Protein in Alzheimer’s Disease
235
Fig. 4. PZP immunoreactive cells associate with senile plaques in the AD SFG. Fluorescent double immunohistochemistry visualizing PZP and amyloid- (A). Low magnification image (A) shows PZP (green) and A (red) separately and in a merged panel. Several senile plaques are visible that associate with PZP immunoreactive cells (white arrows). Higher magnification images of individual plaques shows PZP immunoreactive cells localized between the plaque core and corona (B) or on the outer plaque perimeter (C,D). Colocalization (yellow) predominantly in the plaque core is visible (A,C) in addition to PZP immunoreactive protrusions (B–D). Nuclei were counterstained using DAPI. Experiment consisted of 2 control (not shown) and 4 AD cases. Scale bars A: 200 m. B–D: 50 m.
236
D.A.T. Nijholt et al. / Pregnancy Zone Protein in Alzheimer’s Disease
Fig. 5. PZP immunoreactivity localizes to microglia. Fluorescent double immunohistochemistry visualizing PZP in combination with the microglia marker CX3CR1 and the astrocyte marker GFAP in AD SFG cortex. Low magnification image (A) shows PZP (green), CX3CR1 (red), and plaques (visualized by the dye Amylo-Glo, blue). Cells immunoreactive for both PZP and CX3CR1 (colocalization indicated as yellow) associate with plaques. Higher magnification (B) of the area depicted by the arrow shows PZP and CX3CR1 immunoreactive cells associated with a senile plaque, both on the outer rim and in between the senile plaque core and corona. In (C) a high magnification image of immunolabeling of PZP with the astrocyte marker GFAP is shown and no colocalization was observed. Experiment consisted of 4 AD cases. Scale bars A: 100 m. B-C: 20 m.
Fig. 6. PZP immunoreactivity localizes to neurons in the AD SFG. Fluorescent double immunohistochemistry visualizing PZP (green) in combination with the neuronal marker NeuN (red) in AD (A) and control (B) tissue. Double immunoreactive cells were observed in the AD SFG. Low magnification image (A) shows several PZP immunoreactive neurons (depicted by an asterisk) in the SFG. Arrow indicates the area shown in high magnification next to panel A, two neurons are depicted one of which is immunoreactive for PZP. No PZP immunoreactive neurons were observed in control SFG (B). Nuclei were counterstained using DAPI. Experiment consisted of 2 control and 4 AD cases. Scale bars A, B: 100 m. Scale bar high magnification area: 20 m.
D.A.T. Nijholt et al. / Pregnancy Zone Protein in Alzheimer’s Disease
remains unknown whether increased PZP serum levels are directly derived from the pathogenic process of AD in the brain or by an associated phenomenon. As LRP1 is involved in the efflux of molecules from the brain into the bloodstream, clearance via this pathway might explain the increased PZP serum levels in presymptomatic cases. A further disruption or leakage of the blood-brain barrier as occurs in AD [35] is expected to further contribute to increased serum PZP levels. However, this does not exclude that serum PZP levels are increased due to a systemic event as also human peripheral blood leucocytes were reported to express PZP on their surface [36, 37]. It is unknown whether systemic events associated with increased serum PZP levels (e.g., pregnancy) also have an effect on PZP levels in the central nervous system and contribute to the microglial response in AD. In summary, we report increased PZP immunoreactivity in the AD brain. PZP immunoreactive cells were observed in close association with senile plaques, suggesting involvement in their formation and/or clearance. Combined with our previous findings the current data are indicative of early involvement of PZP in AD. Further investigations are needed to reveal the functional role of PZP in the AD disease process.
[6] [7]
[8]
[9]
[10]
[11]
[12]
[13]
[14]
[15]
ACKNOWLEDGMENTS This research was funded by Internationale Stichting Alzheimer Onderzoek (grant #11510 to PJK). Authors’ disclosures available online (http://jalz.com/manuscript-disclosures/13-1628r2).
[16]
[17]
REFERENCES [18] [1]
[2]
[3]
[4]
[5]
Ijsselstijn L, Dekker LJ, Stingl C, van der Weiden MM, Hofman A, Kros JM, Koudstaal PJ, Sillevis Smitt PA, Ikram MA, Breteler MM, Luider TM (2011) Serum levels of pregnancy zone protein are elevated in presymptomatic Alzheimer’s disease. J Proteome Res 10, 4902-4910. Sand O, Folkersen J, Westergaard JG, Sottrup-Jensen L (1985) Characterization of human pregnancy zone protein. Comparison with human alpha 2-macroglobulin. J Biol Chem 260, 15723-15735. Skornicka EL, Kiyatkina N, Weber MC, Tykocinski ML, Koo PH (2004) Pregnancy zone protein is a carrier and modulator of placental protein-14 in T-cell growth and cytokine production. Cell Immunol 232, 144-156. Folkersen J, Teisner B, Grunnet N, Grudzinskas JG, Westergaard JG, Hindersson P (1981) Circulating levels of pregnancy zone protein: Normal range and the influence of age and gender. Clin Chim Acta 110, 139-145. Teng H, Zhang WY, Zhu FQ (1994) A study on the serum pregnancy zone protein levels in pregnant women and patients with gynecological tumors. Chin Med J (Engl) 107, 910-914.
[19]
[20]
[21]
237
Kovacs DM (2000) alpha2-macroglobulin in late-onset Alzheimer’s disease. Exp Gerontol 35, 473-479. Rehman AA, Ahsan H, Khan FH (2013) alpha-2macroglobulin: A physiological guardian. J Cell Physiol 228, 1665-1675. Marrero A, Duquerroy S, Trapani S, Goulas T, Guevara T, Andersen GR, Navaza J, Sottrup-Jensen L, Gomis-Ruth FX (2012) The crystal structure of human alpha2-macroglobulin reveals a unique molecular cage. Angew Chem Int Ed Engl 51, 3340-3344. Jensen PE, Stigbrand T (1992) Differences in the proteinase inhibition mechanism of human alpha 2-macroglobulin and pregnancy zone protein. Eur J Biochem 210, 1071-1077. Gaultier A, Wu X, Le Moan N, Takimoto S, Mukandala G, Akassoglou K, Campana WM, Gonias SL (2009) Lowdensity lipoprotein receptor-related protein 1 is an essential receptor for myelin phagocytosis. J Cell Sci 122, 1155-1162. Hussain MM, Strickland DK, Bakillah A (1999) The mammalian low-density lipoprotein receptor family. Annu Rev Nutr 19, 141-172. Deane R, Bell RD, Sagare A, Zlokovic BV (2009) Clearance of amyloid-beta peptide across the blood-brain barrier: Implication for therapies in Alzheimer’s disease. CNS Neurol Disord Drug Targets 8, 16-30. Bauer J, Strauss S, Schreiter-Gasser U, Ganter U, Schlegel P, Witt I, Yolk B, Berger M (1991) Interleukin-6 and alpha2-macroglobulin indicate an acute-phase state in Alzheimer’s disease cortices. FEBS Lett 285, 111-114. Strauss S, Bauer J, Ganter U, Jonas U, Berger M, Volk B (1992) Detection of interleukin-6 and alpha 2-macroglobulin immunoreactivity in cortex and hippocampus of Alzheimer’s disease patients. Lab Invest 66, 223-230. Lauer D, Reichenbach A, Birkenmeier G (2001) Alpha 2macroglobulin-mediated degradation of amyloid beta 1-42: A mechanism to enhance amyloid beta catabolism. Exp Neurol 167, 385-392. Mettenburg JM, Webb DJ, Gonias SL (2002) Distinct binding sites in the structure of alpha 2-macroglobulin mediate the interaction with beta-amyloid peptide and growth factors. J Biol Chem 277, 13338-13345. Van Gool D, De Strooper B, Van Leuven F, Triau E, Dom R (1993) alpha 2-Macroglobulin expression in neuritic-type plaques in patients with Alzheimer’s disease. Neurobiol Aging 14, 233-237. Edwards TL, Pericak-Vance M, Gilbert JR, Haines JL, Martin ER, Ritchie MD (2009) An association analysis of Alzheimer disease candidate genes detects an ancestral risk haplotype clade in ACE and putative multilocus association between ACE, A2M, and LRRTM3. Am J Med Genet B Neuropsychiatr Genet 150B 721-735. Rogaeva E, Kawarai T, George-Hyslop PS (2006) Genetic complexity of Alzheimer’s disease: Successes and challenges. J Alzheimers Dis 9, 381-387. Chiabrando GA, Sanchez MC, Skornicka EL, Koo PH (2002) Low-density lipoprotein receptor-related protein mediates in PC12 cell cultures the inhibition of nerve growth factor-promoted neurite outgrowth by pregnancy zone protein and alpha2-macroglobulin. J Neurosci Res 70, 57-64. Stingl C, van Vilsteren FG, Guzel C, Ten Kate FJ, Visser M, Krishnadath KK, Bergman JJ, Luider TM (2011) Reproducibility of protein identification of selected cell types in Barrett’s esophagus analyzed by combining laser-capture microdissection and mass spectrometry. J Proteome Res 10, 288-298.
238 [22]
[23]
[24]
[25]
[26]
[27] [28]
[29]
D.A.T. Nijholt et al. / Pregnancy Zone Protein in Alzheimer’s Disease Combs CK (2009) Inflammation and microglia actions in Alzheimer’s disease. J Neuroimmune Pharmacol 4, 380-388. Maccioni RB, Rojo LE, Fernandez JA, Kuljis RO (2009) The role of neuroimmunomodulation in Alzheimer’s disease. Ann N Y Acad Sci 1153, 240-246. Moestrup SK, Christensen EI, Sottrup-Jensen L, Gliemann J (1987) Binding and receptor-mediated endocytosis of pregnancy zone protein-proteinase complex in rat macrophages. Biochim Biophys Acta 930, 297-303. Sanchez MC, Chiabrando GA, Vides MA (2001) Pregnancy zone protein-tissue-type plasminogen activator complexes bind to low-density lipoprotein receptor-related protein (LRP). Arch Biochem Biophys 389, 218-222. Marzolo MP, von Bernhardi R, Bu G, Inestrosa NC (2000) Expression of alpha(2)-macroglobulin receptor/low density lipoprotein receptor-related protein (LRP) in rat microglial cells. J Neurosci Res 60, 401-411. Andersen OM, Willnow TE (2006) Lipoprotein receptors in Alzheimer’s disease. Trends Neurosci 29, 687-694. Bu G, Maksymovitch EA, Nerbonne JM, Schwartz AL (1994) Expression and function of the low density lipoprotein receptor-related protein (LRP) in mammalian central neurons. J Biol Chem 269, 18521-18528. Spuch C, Ortolano S, Navarro C (2012) LRP-1 and LRP-2 receptors function in the membrane neuron. Trafficking mechanisms and proteolytic processing in Alzheimer’s disease. Front Physiol 3, 269.
[30]
[31]
[32]
[33]
[34]
[35]
[36]
[37]
Cataldo AM, Hamilton DJ, Nixon RA (1994) Lysosomal abnormalities in degenerating neurons link neuronal compromise to senile plaque development in Alzheimer disease. Brain Res 640, 68-80. Cataldo AM, Peterhoff CM, Schmidt SD, Terio NB, Duff K, Beard M, Mathews PM, Nixon RA (2004) Presenilin mutations in familial Alzheimer disease and transgenic mouse models accelerate neuronal lysosomal pathology. J Neuropathol Exp Neurol 63, 821-830. Nixon RA, Wegiel J, Kumar A, Yu WH, Peterhoff C, Cataldo A, Cuervo AM (2005) Extensive involvement of autophagy in Alzheimer disease: An immuno-electron microscopy study. J Neuropathol Exp Neurol 64, 113-122. Meda L, Baron P, Scarlato G (2001) Glial activation in Alzheimer’s disease: The role of Abeta and its associated proteins. Neurobiol Aging 22, 885-893. Carson MJ, Bilousova TV, Puntambekar SS, Melchior B, Doose JM, Ethell IM (2007) A rose by any other name? The potential consequences of microglial heterogeneity during CNS health and disease. Neurotherapeutics 4, 571-579. Popescu BO, Toescu EC, Popescu LM, Bajenaru O, Muresanu DF, Schultzberg M, Bogdanovic N (2009) Blood-brain barrier alterations in ageing and dementia. J Neurol Sci 283, 99-106. Stimson WH (1977) Identification of pregnancy-associated alpha-macroglobulin on the surface of peripheral blood leucocyte populations. Clin Exp Immunol 28, 445-452. Stimson WH, Anderson JM, Farquharson DM (1977) Pregnancy-associated alpha 2-glycoprotein. Lancet 1, 542543.
Journal of Alzheimer’s Disease 46 (2015) 227–238 DOI 10.3233/JAD-131628 IOS Press
Pregnancy Zone Protein is Increased in the Alzheimer’s Disease Brain and Associates with Senile Plaques Diana A.T. Nijholta,1 , Linda Ijsselstijna,1 , Marcel M. van der Weidenb , Ping-Pin Zhengb , Peter A. E. Sillevis Smitta , Peter J. Koudstaala , Theo M. Luidera and Johan M. Krosb,∗ a Department b Department
of Neurology, Erasmus Medical Center, Rotterdam, The Netherlands of Pathology, Erasmus Medical Center, Rotterdam, The Netherlands
Accepted 11 February 2015
Abstract. Increased levels of pregnancy zone protein (PZP) were found in the serum of persons who later developed Alzheimer’s disease (AD) in comparison to controls who remained dementia free. We suggested that this increase is due to brain derived PZP entering the blood stream during the early phase of the disease. Here we investigate the possible involvement of PZP in human AD pathogenesis. We observed increased PZP immunoreactivity in AD postmortem brain cortex compared to non-demented controls. In the AD cortex, PZP immunoreactivity localized to microglial cells that interacted with senile plaques and was occasionally observed in neurons. Our data link the finding of elevated serum PZP levels with the characteristic AD pathology and identify PZP as a novel component in AD. Keywords: Alzheimer’s disease, microglia, pregnancy zone protein
INTRODUCTION Our recent proteomics based search for serum biomarkers identified pregnancy zone protein/PZPlike ␣2-macroglobulin domain-containing protein 6 (PZP/CPAMD6) as a potential biomarker for presymptomatic Alzheimer’s disease (AD). Absolute measurements in serum samples derived from the Rotterdam Scan Study, a population based prospective study cohort, demonstrated increased PZP levels in persons who later developed AD compared to persons who remained cognitively healthy [1]. PZP belongs to the ␣-macroglobulin (␣M) protein family and is highly homologous to ␣2-macroglobulin (␣2MG, 73% amino acid sequence identity [2]). Con1 These
authors contributed equally to this manuscript. to: Johan M. Kros, MD, PhD, Department of Pathology, Erasmus Medical Center, P.O. Box 2040, 3000 CA Rotterdam, The Netherlands. Tel.: +31 10 7043905; E-mail: [email protected]. ∗ Correspondence
trary to ␣2MG, levels of which are constitutively high in the serum (1-2 g/l [3]), PZP is normally a trace protein (10–100 mg/l [4]) that is strongly upregulated during pregnancy (1-2 g/l, [5]). ␣2MG and PZP are best known as pan-protease inhibitors as they are capable of binding, capturing, and inhibiting all classes of proteases [6]. Protease inhibition is important for several biological pathways, e.g., the regulation of coagulation and fibrinolysis and the regulation and containment of an immune response [7]. For ␣2MG, binding and regulation of growth factors, cytokines, and hormones was also reported [7]. All ␣M proteins contain a proteolysis sensitive ‘bait’ or ‘capture’ region and an internal -cysteinyl-␥-glutamyl thiolester. Binding to and cleavage of the bait region by proteases or nucleophilic attack of the thiolester by monoamines triggers a conformational change that allows the ␣M to effectively capture its ligand [8]. Upon capture the protease is sterically hindered from interaction with macromolecular substrates. Interestingly, the bait region of
ISSN 1387-2877/15/$35.00 © 2015 – IOS Press and the authors. All rights reserved
228
D.A.T. Nijholt et al. / Pregnancy Zone Protein in Alzheimer’s Disease
PZP is the region with the lowest similarity to ␣2MG, suggestive of a difference in ligand binding affinity and functionality [9]. The altered ␣M conformational state facilitates exposure of receptor binding sites and binding to the main ␣M receptor low density lipoprotein receptor-related protein (LRP)1 [7]. Upon binding the ligand-␣M-receptor complex is internalized via endocytosis. Dissociation of the ligand-␣M from LRP1 upon acidification of the endosomal compartment allows LRP1 to cycle back to the cell surface, whereas the ligand-␣M is degraded by lysosomal enzymes [10, 11]. In addition, LRP1 is involved in transcytosis of ligands across cells. For example it plays an important role in the transport of amyloid- (A) across the blood-brain barrier [12]. Expression of ␣M proteins is reported in the brain [13, 14] and here ␣2MG has received most attention as it was implicated in the pathogenesis of AD. In the brain ␣2MG is thought to be involved in the clearance of A from the extracellular environment via LRP1 [6, 15–17]. Interestingly, our prospective study did not identify ␣2MG, but the similar PZP, as a potential biomarker for presymptomatic AD [1]. PZP has not yet been extensively studied in the context of the brain or neurodegeneration. A positive association was reported between a SNP in the coding region of the PZP gene and late-onset AD [18, 19]. In vitro, activated PZP was shown to inhibit nerve growth factor mediated neurite outgrowth and TrkA mediated signal transduction in PC12 cells in a dose dependent manner [20]. Our immunohistochemical analysis of PZP expression on a limited set of AD cases (n = 2) compared to controls suggested increased PZP immunoreactivity in the AD brain [1]. These observations, combined with increased PZP serum levels in presymptomatic AD, led to the hypothesis that PZP plays a role in AD pathophysiology. The aim of the present study was to detail the expression of PZP in a larger cohort of AD brains (n = 20) and link PZP expression to AD pathology. MATERIALS AND METHODS Antibody characterization Antibody characterization was performed via immunoprecipitation (IP) and nano liquid chromatography (nLC) - Orbitrap mass spectrometry (MS/MS). For immunoprecipitation, 7.5 g antibody was coupled to 1.5 mg Protein G conjugated Dynabeads (Invitrogen Life Technologies, Paisley, UK) according to the manufacturer’s instructions. Antibody coupled Dynabeads were incubated with 10 l serum from
a pregnant woman (written informed consent available) for 16 h at 4◦ C. Following incubation beads were washed 3 × 5 min in 1x phosphate buffered saline (PBS) with 0.05% Tween20 and 3 × 5 min in 1 × PBS without Tween20. Target was eluted from the beads using 50 mM Glycine (pH 2.5) and 20 min shaking at room temperature. Following elution the pH of the eluate was adjusted to pH 7 using Tris-Base (pH 10). Samples were digested with trypsin and analyzed on an nLC coupled online to a hybrid linear ion trap/Orbitrap mass spectrometer as previously described [21]. Postmortem brain tissue Postmortem brain tissue was obtained from The Netherlands Brain Bank (Amsterdam, The Netherlands). All donors or their next of kin provided written informed consent for brain autopsy and use of tissue and medical records for research purposes. For this study freshly frozen superior frontal gyrus (SFG) from 20 AD and 7 non-demented controls was used. Clinical diagnosis, gender, age, postmortem delay (PMD), and Braak stage of all cases are listed in Table 1. Immunohistochemical analysis Cryosections (5-m thick) were mounted on StarFrost Microscope Slides (Waldemar Knittel, Braunschweig, Germany) and dried overnight at room temperature. Sections were fixed in ice-cold acetone (Sigma-Aldrich, Zwijndrecht, The Netherlands) for 10 min and allowed to air dry. For single immunohistochemistry, sections were washed in 1 × PBS and subsequently incubated with primary antibody (Table 2) for 60 min at room temperature. All primary antibodies were diluted in PBS containing 1% (w/v) bovine serum albumin (BSA, Sigma-Aldrich). Negative controls were generated by omission of primary antibodies. Sections were washed 3 × 10 min in PBS and subsequently incubated with BrightVision alkaline phosphatase conjugated goat ␣-rat/rabbit/mouse IgG (Immunologic, Duiven, The Netherlands) for 60 min at room temperature. Sections were washed and colour was developed with Fuchsine as chromogen. Nuclei were counterstained using hematoxylin and sections were mounted using Aqua/polymount (Polysciences, Warrington, PA, USA). Immunoreactive (IR) cells were counted in 4 × 0.25 mm2 areas (∼1 mm2 ) of SFG grey matter (cortex) and neighboring white matter. Sections were scored as
D.A.T. Nijholt et al. / Pregnancy Zone Protein in Alzheimer’s Disease
229
Table 1 Patient characteristics Case 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27
Clinical diagnosis
Gender
Age
PMD (h:m)
Braak score for NFT
Braak score for amyloid
Control Control Control Control Control Control Control AD AD AD AD AD AD AD AD AD AD AD AD AD AD AD AD AD AD AD AD
F M F F M F M F F F F F F F F F F F F F F M F F M F F
54 80 61 78 79 97 74 89 92 84 54 97 78 71 87 90 90 87 80 82 63 63 79 69 58 75 91
8:00 6:56 10:15 4:15 6:00 10:00 5:53 2:55 4:00 3:50 3:15 3:30 4:25 4:20 6:20 3:10 3:50 6:55 4:25 3:15 4:00 6:00 4:10 4:00 5:10 3:35 4:35
0 0 1 1 1 2 2 4 4 4 5 5 5 5 5 5 5 5 5 6 6 6 6 6 6 6 6
O O O O B B O B C C C C B C C C C B C B C C C C C C C
PMD, postmortem delay (hours: minutes); NFT, neurofibrillary tangles; AD, Alzheimer’s disease; F, female; M, male.
Table 2 Primary antibodies used in this study Antibody
Species
Mono/polyclonal
Concentration
Dilution IHC fIHC
Company/catalog number
Pregnancy zone protein (PZP)
Rabbit
Polyclonal
1 mg/ml
1:100
1:100
Monoclonal
1 mg/ml
1:150
–
Mouse
Polyclonal
1 mg/ml
–
1:100
Mouse
Monoclonal
2.5 mg/ml
–
1:100
Mouse
Monoclonal
1 mg/ml
–
1:100
Mouse
Monoclonal
0.5 mg/ml
–
1:100
GeneTex, Irvine, USA/GTX102547 Abcam, Cambridge, USA/Ab91104 Sigma Aldrich, St Louis, USA/WH0001524M1 Dako, Glostrup, Denmark/ z0334 Novus Biologicals, Littleton, USA/NBP1-92693V2 Dako, Glostrup, Denmark/Ab2539
Alpha-2-macroglobulin (␣2MG) chemokine (C-X3-C motif) receptor 1 (CX3CR1) glial fibrillary acidic protein (GFAP) Neuron-specific nuclear protein (NeuN) Amyloid- (A)
Mouse
IHC, immunohistochemistry; fIHC, fluorescent immunohistochemistry.
follows: level 1, 0–25 IR cells; level 2, 26–50 IR cells; level 3, 51–100 IR cells; level 4, >100 IR cells. When a structure was highly immunoreactive, but separate cells could not be discriminated, it was counted as one. Scoring was performed by two independent observers
blinded for patient data. Statistical analysis was performed using the SPSS statistical software package version 20.0 (SPSS Inc, Chicago, Illinois, USA). The Mann-Whitney test was used to test for differences between AD and controls.
230
D.A.T. Nijholt et al. / Pregnancy Zone Protein in Alzheimer’s Disease Table 3 Oligonucleotide probes for FISH
Name PZP Scramble
Nucleotide sequence (5 −→ 3 ) tttgtccgggttttcactgtgcatc gcgtctgttatcgccttatcttggt
RNA fluorescent in situ hybridization RNA fluorescent in situ hybridization (FISH) was performed to visualize PZP mRNA in brain tissue sections. Oligonucleotide probes (HPLC purified and 5’ biotin labelled) (Table 3) were purchased from Sigma-Aldrich. The PZP probe was targeted to the least ␣2MG homologous region of PZP (exons 11 and 12) and designed to cross the exon 11–exon 12 boundary for binding to mRNA only. The PZP mRNA oligonucleotide sequence was scrambled and used as a negative control probe. BLAST analysis (http://blast.ncbi.nlm.nih.gov) demonstrated that the PZP probe was specific for PZP mRNA and the scrambled probe did not interact with other sequences in the human genome. Prior to the experiment, all glassware was baked at 180◦ C and all reagents were treated with diethylpyrocarbonate (DEPC, Sigma-Aldrich) to abolish RNase activity and subsequently autoclaved. Cryosections (5-m thick) were cut and pasted on baked StarFrost Microscope Slides (Waldemar Knittel) and dried at room temperature for 15 min. Sections were fixed for 10 min in FAAS fixative containing 3.7% formaldehyde (Sigma-Aldrich), 5% acetic acid (Sigma-Aldrich), and 0.85% (w/v) NaCl in ddH2 O. Tissue slides were washed 2 × 5 min in 1x PBS at room temperature. Slides were subsequently transferred to 70% ethanol/ddH2 O solution and incubated overnight at 4◦ C. Slides were rehydrated in 2× saline-sodium citrate (SSC)/50% deionized formamide (Sigma-Aldrich) solution for 15 min and subsequently incubated overnight with 40 l/slide probe mix in a humid chamber at 37◦ C. Probe mix consisted of 1 ng/l oligonucleotide probe, 1 g/l yeast transfer ribonucleic acid, 33.3% deionized formamide, 1× hybridization buffer (2× concentrated contains: 4× SSC/20% dextran sulphate (Sigma-Aldrich)/0.4% (w/v) BSA) in ddH2 O. Following incubation slides were washed 2 × 15 min with 2× SSC/50% deionized formamide heated to 37◦ C followed by 2 × 5 min washing with 2× SSC at room temperature. For visualization of the biotin label, slides were washed in 1× PBS and incubated with streptavidin Cy3 (1:100 dilution in 1× PBS) for 2 h at room temperature. Slides
were subsequently washed 3 × 5 min in 1× PBS and nuclei were counterstained with DAPI (50 ng/ml). As an additional negative control sections were treated as above, but the oligonucleotide probes were omitted. Sections were mounted using Aqua/polymount and analyzed with a Zeiss LSM700 confocal laser scanning microscope. For non-fluorescent in situ hybridization the experiment was performed as described above up to the 2× SSC wash at room temperature. Slides were subsequently incubated with streptavidin/HRP (Dako, Glostrup, Denmark, 1:100 dilution in 1× PBS) for 2 h at room temperature. Color was developed using Liquid DAB+ Substrate Chromogen System (Dako). Nuclei were counterstained using hematoxylin and sections were mounted using Aqua/polymount. Fluorescent double immunohistochemistry Fluorescent double immunohistochemistry of PZP with chemokine (C-X3-C motif) receptor 1 (CX3CR1, marker for microglial cells), glial fibrillary acidic protein (GFAP, marker for astrocytes), A and neuronspecific nuclear protein (NeuN, marker for neurons) was performed on a selected set of tissue sections. Primary antibodies and dilutions used are described in Table 2. All primary and secondary antibodies were diluted in PBS containing 1% (w/v) BSA. Performance of all primary antibodies was assessed in single immunohistochemistry stainings parallel to the double immunohistochemistry stainings. Negative controls were generated by omission of primary antibodies. Cryosections were fixed in ice-cold acetone for 10 min and subsequently air-dried. Sections were washed in 1x PBS and incubated overnight at 4◦ C with a mixture of primary antibodies. Following incubation with primary antibodies sections were washed 3 × 10 min in PBS and subsequently incubated with biotinylated goat ␣-rabbit IgG (1:100 dilution, Dako) and Cy3 conjugated goat ␣-mouse IgG (1:100, Jackson ImmunoResearch Laboratories, Westgrove, PA, USA) for 60 min at room temperature. Sections were washed 3x 10 min in PBS and incubated with FITC conjugated streptavidin (1:100 dilution, Jackson ImmunoResearch) for 60 min at room temperature. Sections were subsequently washed 3x 10 min in PBS and nuclei were counterstained with DAPI (50 ng/ml). To also visualize amyloid plaques in the PZP/CX3CR1 double immunohistochemistry staining, slides were incubated with Amylo-Glo RTD Amyloid plaque stain reagent (Biosensis, Thebarton, Australia) after the final antibody detection step. The DAPI nuclear counterstain step was omitted
D.A.T. Nijholt et al. / Pregnancy Zone Protein in Alzheimer’s Disease
when Amylo-Glo was used. Autofluorescence was quenched using Sudan Black B (Sigma-Aldrich). Sections were mounted using Aqua/polymount and analyzed with a Zeiss LSM700 confocal laser scanning microscope. RESULTS PZP antibody characterization Due to the high sequence similarity between PZP and ␣2MG, we first determined the specificity of the commercially available GeneTex PZP antibody using IP followed by nLC Orbitrap MS/M) analysis. This method allows us to identify antibody bound proteins with high specificity and sensitivity. During pregnancy, serum levels of both ␣2MG and PZP are high, making this material suitable for antibody characterization. Serum from a pregnant woman was incubated with PZP antibody coupled magnetic beads. As a negative control, the serum sample was incubated with magnetic beads coupled to CX3CR1 antibody, a protein not expected to be present in serum. Following incubation and elution, the bead eluate was digested with trypsin and the obtained peptides were analyzed using nLC-MS/MS. A total of 43 unique PZP derived peptides (45% sequence coverage) were identified in the PZP IP sample, resulting in 100% protein identification probability. As expected, no CX3CR1 was immunoprecipitated from serum, nor was PZP detected in this sample. Furthermore, no ␣2MG derived peptides were detected in the PZP IP sample indicating the antibody is specific for PZP and can be used for immunohistochemical assessment. Expression of PZP is increased in the AD brain Cryosections of the SFG of 20 AD and 7 control cases were assessed for PZP expression. Immunohistochemical evaluation revealed PZP immunoreactive cells in the cortex and subcortical white matter of the SFG of both AD and control cases (Fig. 1). Based on their morphology these cells were characterized as glial cells. The PZP staining pattern differed from that observed for ␣2MG (compare Fig. 1A–D with Fig. 1G), further confirming the findings of our antibody characterization experiment. PZP immunoreactivity was most pronounced in the AD brain; an increased number of PZP immunoreactive cells were visible with increased staining intensity compared to controls (compare Fig. 1A,C with Fig. 1B,D). FISH was used to confirm expression of PZP in the brain at
231
the mRNA level in a subset of our cases: 2 controls (#2 and 4) and 4 AD (#13, 15, 20, and 24). Fig. 2A shows the presence of PZP mRNA in the AD cortex, visualized using a fluorescently labelled PZP specific oligonucleotide probe. No positive signal was detected when a scrambled oligonucleotide probe (Fig. 2B) was used or when the PZP oligonucleotide probe was omitted. A non-fluorescent in situ hybridization assay, inset in Fig. 2A, shows a cell with glial morphology expressing PZP mRNA. We observed a similar pattern for PZP mRNA expression in control brain tissue (data not shown). A semi-quantitative method was used to score PZP expression in the immunohistochemical approach shown in Fig. 1. PZP immunoreactive cells were counted in 4 × 0.25 mm2 (∼1 mm2 ) areas of cortex and neighboring white matter and assigned a scoring level (ranging from 1–4, described in the Materials and Methods section). All scoring levels per case are described in Table 4. We found a significant increase (Mann-Whitney test, p < 0.01) in PZP scoring level in AD cases compared to controls, reflective of the increased number of PZP immunoreactive cells. The increase was only significant in the SFG cortex (Fig. 3A), whereas a trend toward, but no significant difference, was observed in the neighboring white matter (Fig. 3B). In the cortex, PZP scoring level correlated positively with Braak stage for neurofibrillary tangles (r = 0.794; p < 0.0001, Fig. 3C) and amyloid deposition (r = 0.683; p < 0.0001, Fig. 3D). PZP immunoreactive microglia associate with amyloid plaques in the AD brain The increase in PZP immunoreactivity was most pronounced in the AD SFG cortex, which typically contains a high number of amyloid plaques. We used double immunohistochemistry on a subset of our cases—2 controls (#2 and 4) and 4 AD (#13, 15, 20, and 24)—to visualize both PZP and amyloid plaques (using an antibody directed against A). PZP immunoreactivity was observed in and surrounding A positive senile plaques in the AD cortex (Fig. 4A). No plaques were observed in control SFG (data not shown). Higher magnification analysis revealed PZP immunoreactive cells located between the plaque core and corona or closely associated with its outer edge. Strong PZP immunoreactive protrusions were observed running through the plaque (Fig. 4B–D). We further characterized these PZP immunoreactive cells in the AD SFG cortex (cases #13,
232
D.A.T. Nijholt et al. / Pregnancy Zone Protein in Alzheimer’s Disease
Fig. 1. Expression of PZP is increased in AD SFG. Immunohistochemical detection of PZP in the cortex and neighboring white matter of AD (A,C) and control (B,D) SFG. Shown are representative images of immunohistochemistry for all cases and controls. Arrows indicate the area shown in detail in the inset. Negative controls (primary antibody omission) are shown for cortex (E) and white matter (F). Immunohistochemical detection of ␣2MG in AD SFG cortex (G) demonstrates a distinct staining pattern that differs from PZP. Nuclei were counterstained using hematoxylin (blue). Scale bars: 200 m.
15, 20, and 24) using double immunohistochemistry combined with the fluorescent dye Amylo-Glo that visualizes amyloid plaques. PZP immunoreactive cells associating with senile plaques colocalized with the microglia marker chemokine (C-X3-C motif) receptor 1 (CX3CR1) indicating these cells are microglia (Fig. 5A,B). We observed no colocalization of PZP with the astrocyte marker GFAP (Fig. 5C).
PZP immunoreactivity is present in neurons in the AD brain Within the AD SFG cortex, we occasionally observed PZP immunoreactivity in cells that morphologically resembled neurons. In order to confirm these cells are neurons, we performed double immunohistochemistry on a subset of our cases [2 controls (#2 and 4) and 4 AD (#13, 15, 20, and 24)] using
D.A.T. Nijholt et al. / Pregnancy Zone Protein in Alzheimer’s Disease
233
Fig. 2. Expression of PZP mRNA in AD SFG. Detection of PZP mRNA by FISH in the AD cortex using a PZP specific oligonucleotide probe revealed a punctate pattern (red, A). No signal was detected when a scrambled probe (B) was used or when probes were omitted (data not shown). Nuclei were stained using DAPI (blue). Experiment consisted of 2 control and 4 AD cases. The inset in panel A shows an in situ hybridization experiment in which the PZP specific oligonucleotide was visualized using DAB and nuclei were counterstained using hematoxylin. Scale bar: 15 m. Table 4 PZP Immunohistochemistry scores
PZP immunoreactivity was observed in neurons of the control SFG (Fig. 6B).
Case Clinical diagnosis Scoring level cortex Scoring level WM 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27
Control Control Control Control Control Control Control AD AD AD AD AD AD AD AD AD AD AD AD AD AD AD AD AD AD AD AD
1 2 1 2 1 1 1 na 3 3 2 3 3 na 2 4 3 4 4 3 3 4 4 3 3 2 4
3 3 3 3 3 3 3 3 3 3 3 3 4 4 3 4 3 4 3 3 3 4 4 na 4 na 4
WM, white matter; AD, Alzheimer’s disease; na, not assessed.
antibodies directed against PZP and the neuronal marker NeuN. Neurons containing PZP immunoreactivity were observed in the AD SFG alongside neurons that did not show PZP immunoreactivity (Fig. 6A). No
DISCUSSION Our laboratory previously identified the protease inhibitor protein PZP as a potential serum biomarker for presymptomatic AD [1]. In this study we assessed the expression of PZP in the brain (SFG) in relation to AD pathophysiology and found increased PZP immunoreactivity in AD cases compared to controls. Using nLC-MS/MS, we first confirmed specificity of our antibody for PZP and excluded cross reactivity with the highly similar ␣2MG. We made use of immunohistochemistry (Fig. 1) and FISH (Fig. 2) to confirm expression of PZP in the brain. In general, strong PZP immunoreactivity was observed in the white matter of both AD and control cases. A significant increase in PZP immunoreactivity was observed in the AD SFG cortex and this correlated positively with Braak stages for neurofibrillary tangles and amyloid deposition (Fig. 3). Here, PZP immunoreactive microglia (Figs. 4 and 5) associated with senile plaques. In addition, PZP immunoreactive neurons were observed in AD but not in control SFG (Fig. 6). Our observations indicate that PZP plays a role early in AD pathophysiology, although its precise function remains unknown. Microglia, the resident macrophages of the brain, play an important role in the AD process [22]. They can be neuroprotective, as they are involved in the clearance of A from the brain interstitial space, but can also
234
D.A.T. Nijholt et al. / Pregnancy Zone Protein in Alzheimer’s Disease
A
B
C
D
Fig. 3. Increased PZP immunoreactivity positively correlates with Braak staging for neurofibrillary tangles and amyloid deposition. PZP immunoreactivity (IR) scores were depicted as a percentage of the total AD and control (Ctr) cases for the cortex (A) and neighboring white matter (B). Asterisk (*) signifies p < 0.01 using the Mann Whitney test. A positive correlation exists between PZP IR score and Braak staging for neurofibrillary tangles (NFT) (C) and amyloid (D) deposition (Spearman non-parametric analysis) in the SFG cortex.
mediate neurotoxic effects due to cytokine production [23]. Our finding that PZP is strongly expressed in microglia in the vicinity of senile plaques, in addition to its similarity to ␣2MG, suggests that PZP is involved in plaque dynamics. Complexes formed by PZP and its ligands can bind LRP1 and be subsequently internalized via endocytosis [24, 25]. LRP1 is strongly expressed in the brain, mainly in the entorhinal cortex, hippocampus, and cerebellum, and is also found on microglia [26], neurons [27, 28], activated astrocytes [29], brain endothelial cells, pericytes, and vascular smooth muscle cells [29]. This suggests that PZP aids in the receptor mediated endocytosis and lysosomal clearance of A or other plaque derived components and acts neuroprotective. Internalization of PZP-ligand complexes by LRP1 present on neurons explains the neuronal PZP immunoreactivity that we observed in the AD SFG. Defects in the endosomal-lysosomal route are apparent in early AD [30–32] and therefore
PZP-ligand complexes may accumulate as they can no longer be efficiently degraded. Alternatively, PZP may inhibit the action of proteases involved in the degradation of plaque components and in this manner facilitate plaque formation. Microglia that interact with plaques in the brain are in an activated state [33], suggesting that PZP is upregulated in a specific subgroup of microglia. However, relatively high PZP immunoreactivity was observed in white matter for both AD and control cases. It has been suggested that white matter microglia exist at a higher basal level of activation under physiological conditions when compared to areas with no or less myelination [34]. This may explain why levels of PZP are, in general, higher in white matter compared to the cortex and PZP is expressed in (activated) microglia that interact with senile plaques in the AD brain. In our previous study, we observed increased serum levels of PZP in presymptomatic AD cases [1]. It
D.A.T. Nijholt et al. / Pregnancy Zone Protein in Alzheimer’s Disease
235
Fig. 4. PZP immunoreactive cells associate with senile plaques in the AD SFG. Fluorescent double immunohistochemistry visualizing PZP and amyloid- (A). Low magnification image (A) shows PZP (green) and A (red) separately and in a merged panel. Several senile plaques are visible that associate with PZP immunoreactive cells (white arrows). Higher magnification images of individual plaques shows PZP immunoreactive cells localized between the plaque core and corona (B) or on the outer plaque perimeter (C,D). Colocalization (yellow) predominantly in the plaque core is visible (A,C) in addition to PZP immunoreactive protrusions (B–D). Nuclei were counterstained using DAPI. Experiment consisted of 2 control (not shown) and 4 AD cases. Scale bars A: 200 m. B–D: 50 m.
236
D.A.T. Nijholt et al. / Pregnancy Zone Protein in Alzheimer’s Disease
Fig. 5. PZP immunoreactivity localizes to microglia. Fluorescent double immunohistochemistry visualizing PZP in combination with the microglia marker CX3CR1 and the astrocyte marker GFAP in AD SFG cortex. Low magnification image (A) shows PZP (green), CX3CR1 (red), and plaques (visualized by the dye Amylo-Glo, blue). Cells immunoreactive for both PZP and CX3CR1 (colocalization indicated as yellow) associate with plaques. Higher magnification (B) of the area depicted by the arrow shows PZP and CX3CR1 immunoreactive cells associated with a senile plaque, both on the outer rim and in between the senile plaque core and corona. In (C) a high magnification image of immunolabeling of PZP with the astrocyte marker GFAP is shown and no colocalization was observed. Experiment consisted of 4 AD cases. Scale bars A: 100 m. B-C: 20 m.
Fig. 6. PZP immunoreactivity localizes to neurons in the AD SFG. Fluorescent double immunohistochemistry visualizing PZP (green) in combination with the neuronal marker NeuN (red) in AD (A) and control (B) tissue. Double immunoreactive cells were observed in the AD SFG. Low magnification image (A) shows several PZP immunoreactive neurons (depicted by an asterisk) in the SFG. Arrow indicates the area shown in high magnification next to panel A, two neurons are depicted one of which is immunoreactive for PZP. No PZP immunoreactive neurons were observed in control SFG (B). Nuclei were counterstained using DAPI. Experiment consisted of 2 control and 4 AD cases. Scale bars A, B: 100 m. Scale bar high magnification area: 20 m.
D.A.T. Nijholt et al. / Pregnancy Zone Protein in Alzheimer’s Disease
remains unknown whether increased PZP serum levels are directly derived from the pathogenic process of AD in the brain or by an associated phenomenon. As LRP1 is involved in the efflux of molecules from the brain into the bloodstream, clearance via this pathway might explain the increased PZP serum levels in presymptomatic cases. A further disruption or leakage of the blood-brain barrier as occurs in AD [35] is expected to further contribute to increased serum PZP levels. However, this does not exclude that serum PZP levels are increased due to a systemic event as also human peripheral blood leucocytes were reported to express PZP on their surface [36, 37]. It is unknown whether systemic events associated with increased serum PZP levels (e.g., pregnancy) also have an effect on PZP levels in the central nervous system and contribute to the microglial response in AD. In summary, we report increased PZP immunoreactivity in the AD brain. PZP immunoreactive cells were observed in close association with senile plaques, suggesting involvement in their formation and/or clearance. Combined with our previous findings the current data are indicative of early involvement of PZP in AD. Further investigations are needed to reveal the functional role of PZP in the AD disease process.
[6] [7]
[8]
[9]
[10]
[11]
[12]
[13]
[14]
[15]
ACKNOWLEDGMENTS This research was funded by Internationale Stichting Alzheimer Onderzoek (grant #11510 to PJK). Authors’ disclosures available online (http://jalz.com/manuscript-disclosures/13-1628r2).
[16]
[17]
REFERENCES [18] [1]
[2]
[3]
[4]
[5]
Ijsselstijn L, Dekker LJ, Stingl C, van der Weiden MM, Hofman A, Kros JM, Koudstaal PJ, Sillevis Smitt PA, Ikram MA, Breteler MM, Luider TM (2011) Serum levels of pregnancy zone protein are elevated in presymptomatic Alzheimer’s disease. J Proteome Res 10, 4902-4910. Sand O, Folkersen J, Westergaard JG, Sottrup-Jensen L (1985) Characterization of human pregnancy zone protein. Comparison with human alpha 2-macroglobulin. J Biol Chem 260, 15723-15735. Skornicka EL, Kiyatkina N, Weber MC, Tykocinski ML, Koo PH (2004) Pregnancy zone protein is a carrier and modulator of placental protein-14 in T-cell growth and cytokine production. Cell Immunol 232, 144-156. Folkersen J, Teisner B, Grunnet N, Grudzinskas JG, Westergaard JG, Hindersson P (1981) Circulating levels of pregnancy zone protein: Normal range and the influence of age and gender. Clin Chim Acta 110, 139-145. Teng H, Zhang WY, Zhu FQ (1994) A study on the serum pregnancy zone protein levels in pregnant women and patients with gynecological tumors. Chin Med J (Engl) 107, 910-914.
[19]
[20]
[21]
237
Kovacs DM (2000) alpha2-macroglobulin in late-onset Alzheimer’s disease. Exp Gerontol 35, 473-479. Rehman AA, Ahsan H, Khan FH (2013) alpha-2macroglobulin: A physiological guardian. J Cell Physiol 228, 1665-1675. Marrero A, Duquerroy S, Trapani S, Goulas T, Guevara T, Andersen GR, Navaza J, Sottrup-Jensen L, Gomis-Ruth FX (2012) The crystal structure of human alpha2-macroglobulin reveals a unique molecular cage. Angew Chem Int Ed Engl 51, 3340-3344. Jensen PE, Stigbrand T (1992) Differences in the proteinase inhibition mechanism of human alpha 2-macroglobulin and pregnancy zone protein. Eur J Biochem 210, 1071-1077. Gaultier A, Wu X, Le Moan N, Takimoto S, Mukandala G, Akassoglou K, Campana WM, Gonias SL (2009) Lowdensity lipoprotein receptor-related protein 1 is an essential receptor for myelin phagocytosis. J Cell Sci 122, 1155-1162. Hussain MM, Strickland DK, Bakillah A (1999) The mammalian low-density lipoprotein receptor family. Annu Rev Nutr 19, 141-172. Deane R, Bell RD, Sagare A, Zlokovic BV (2009) Clearance of amyloid-beta peptide across the blood-brain barrier: Implication for therapies in Alzheimer’s disease. CNS Neurol Disord Drug Targets 8, 16-30. Bauer J, Strauss S, Schreiter-Gasser U, Ganter U, Schlegel P, Witt I, Yolk B, Berger M (1991) Interleukin-6 and alpha2-macroglobulin indicate an acute-phase state in Alzheimer’s disease cortices. FEBS Lett 285, 111-114. Strauss S, Bauer J, Ganter U, Jonas U, Berger M, Volk B (1992) Detection of interleukin-6 and alpha 2-macroglobulin immunoreactivity in cortex and hippocampus of Alzheimer’s disease patients. Lab Invest 66, 223-230. Lauer D, Reichenbach A, Birkenmeier G (2001) Alpha 2macroglobulin-mediated degradation of amyloid beta 1-42: A mechanism to enhance amyloid beta catabolism. Exp Neurol 167, 385-392. Mettenburg JM, Webb DJ, Gonias SL (2002) Distinct binding sites in the structure of alpha 2-macroglobulin mediate the interaction with beta-amyloid peptide and growth factors. J Biol Chem 277, 13338-13345. Van Gool D, De Strooper B, Van Leuven F, Triau E, Dom R (1993) alpha 2-Macroglobulin expression in neuritic-type plaques in patients with Alzheimer’s disease. Neurobiol Aging 14, 233-237. Edwards TL, Pericak-Vance M, Gilbert JR, Haines JL, Martin ER, Ritchie MD (2009) An association analysis of Alzheimer disease candidate genes detects an ancestral risk haplotype clade in ACE and putative multilocus association between ACE, A2M, and LRRTM3. Am J Med Genet B Neuropsychiatr Genet 150B 721-735. Rogaeva E, Kawarai T, George-Hyslop PS (2006) Genetic complexity of Alzheimer’s disease: Successes and challenges. J Alzheimers Dis 9, 381-387. Chiabrando GA, Sanchez MC, Skornicka EL, Koo PH (2002) Low-density lipoprotein receptor-related protein mediates in PC12 cell cultures the inhibition of nerve growth factor-promoted neurite outgrowth by pregnancy zone protein and alpha2-macroglobulin. J Neurosci Res 70, 57-64. Stingl C, van Vilsteren FG, Guzel C, Ten Kate FJ, Visser M, Krishnadath KK, Bergman JJ, Luider TM (2011) Reproducibility of protein identification of selected cell types in Barrett’s esophagus analyzed by combining laser-capture microdissection and mass spectrometry. J Proteome Res 10, 288-298.
238 [22]
[23]
[24]
[25]
[26]
[27] [28]
[29]
D.A.T. Nijholt et al. / Pregnancy Zone Protein in Alzheimer’s Disease Combs CK (2009) Inflammation and microglia actions in Alzheimer’s disease. J Neuroimmune Pharmacol 4, 380-388. Maccioni RB, Rojo LE, Fernandez JA, Kuljis RO (2009) The role of neuroimmunomodulation in Alzheimer’s disease. Ann N Y Acad Sci 1153, 240-246. Moestrup SK, Christensen EI, Sottrup-Jensen L, Gliemann J (1987) Binding and receptor-mediated endocytosis of pregnancy zone protein-proteinase complex in rat macrophages. Biochim Biophys Acta 930, 297-303. Sanchez MC, Chiabrando GA, Vides MA (2001) Pregnancy zone protein-tissue-type plasminogen activator complexes bind to low-density lipoprotein receptor-related protein (LRP). Arch Biochem Biophys 389, 218-222. Marzolo MP, von Bernhardi R, Bu G, Inestrosa NC (2000) Expression of alpha(2)-macroglobulin receptor/low density lipoprotein receptor-related protein (LRP) in rat microglial cells. J Neurosci Res 60, 401-411. Andersen OM, Willnow TE (2006) Lipoprotein receptors in Alzheimer’s disease. Trends Neurosci 29, 687-694. Bu G, Maksymovitch EA, Nerbonne JM, Schwartz AL (1994) Expression and function of the low density lipoprotein receptor-related protein (LRP) in mammalian central neurons. J Biol Chem 269, 18521-18528. Spuch C, Ortolano S, Navarro C (2012) LRP-1 and LRP-2 receptors function in the membrane neuron. Trafficking mechanisms and proteolytic processing in Alzheimer’s disease. Front Physiol 3, 269.
[30]
[31]
[32]
[33]
[34]
[35]
[36]
[37]
Cataldo AM, Hamilton DJ, Nixon RA (1994) Lysosomal abnormalities in degenerating neurons link neuronal compromise to senile plaque development in Alzheimer disease. Brain Res 640, 68-80. Cataldo AM, Peterhoff CM, Schmidt SD, Terio NB, Duff K, Beard M, Mathews PM, Nixon RA (2004) Presenilin mutations in familial Alzheimer disease and transgenic mouse models accelerate neuronal lysosomal pathology. J Neuropathol Exp Neurol 63, 821-830. Nixon RA, Wegiel J, Kumar A, Yu WH, Peterhoff C, Cataldo A, Cuervo AM (2005) Extensive involvement of autophagy in Alzheimer disease: An immuno-electron microscopy study. J Neuropathol Exp Neurol 64, 113-122. Meda L, Baron P, Scarlato G (2001) Glial activation in Alzheimer’s disease: The role of Abeta and its associated proteins. Neurobiol Aging 22, 885-893. Carson MJ, Bilousova TV, Puntambekar SS, Melchior B, Doose JM, Ethell IM (2007) A rose by any other name? The potential consequences of microglial heterogeneity during CNS health and disease. Neurotherapeutics 4, 571-579. Popescu BO, Toescu EC, Popescu LM, Bajenaru O, Muresanu DF, Schultzberg M, Bogdanovic N (2009) Blood-brain barrier alterations in ageing and dementia. J Neurol Sci 283, 99-106. Stimson WH (1977) Identification of pregnancy-associated alpha-macroglobulin on the surface of peripheral blood leucocyte populations. Clin Exp Immunol 28, 445-452. Stimson WH, Anderson JM, Farquharson DM (1977) Pregnancy-associated alpha 2-glycoprotein. Lancet 1, 542543.
