e n v i r o n m e n t a l t o x i c o l o g y a n d p h a r m a c o l o g y 3 7 ( 2 0 1 4 ) 1040–1047
Available online at www.sciencedirect.com
ScienceDirect journal homepage: www.elsevier.com/locate/etap
Potential toxic effect of trifloxystrobin on cellular microstructure, mRNA expression and antioxidant enzymes in Chlorella vulgaris Yu-Feng Shen a,1 , Lei Liu a,1 , Yu-Xin Gong b , Bin Zhu a , Guang-Lu Liu c , Gao-Xue Wang a,∗ a
College of Animal Science and Technology, Northwest A&F University, Xinong Road 22nd, Yangling, Shaanxi 712100, China b College of Veterinary Medicine, Northwest A&F University, Xinong Road 22nd, Yangling, Shaanxi 712100, China c College of Science, Northwest A&F University, Xinong Road 22nd, Yangling, Shaanxi 712100, China
a r t i c l e
i n f o
a b s t r a c t
Article history:
This study investigated the effects of trifloxystrobin that one strobilurin used widely in the
Received 30 October 2013
world as an effective fungicidal agent to control Asian soybean rust on aquatic unicellu-
Received in revised form
lar algae Chlorella vulgaris. We determined the potential toxic effect of trifloxystrobin on
3 April 2014
C. vulgaris, and found median inhibition concentration (IC50 ) value 255.58 (95% confidence
Accepted 3 April 2014
interval, 207.81–330.29) g L−1 . In addition, the algal cells were obviously depressed or shrunk
Available online 13 April 2014
at different concentrations by electron microscopy. In the study, a real-time polymerase
Keywords:
thetic genes, psaB, psbC, and rbcL, and one energy gene, ATPs. The results showed that
Chlorella vulgaris
trifloxystrobin reduced the transcript abundances of the three genes and enhanced expres-
chain reaction (PCR) assay showed changes in transcript abundances of three photosyn-
Trifloxystrobin
sion of ATPs after 48 and 96 h. The lowest abundances of psaB, psbC and rbcL transcripts in
Microstructure
response to trifloxystrobin exposure were 58%, 79% and 60% of those of the control, respec-
Oxidative damage
tively. For the potential toxic influences, trifloxystrobin could decrease the soluble protein and total antioxidant contents (T-AOC), and increase superoxide dismutase (SOD) and peroxidase (POD) activity with a gradual concentration–response relationship. Overall, the present study demonstrated that trifloxystrobin could affect the activities of antioxidant enzymes, disrupts photosynthesis in C. vulgaris, and damage cellular structure. © 2014 Elsevier B.V. All rights reserved.
1.
Introduction
With the rapid development of modern agriculture, application of new pesticides has risen sharply. Hence, increasing
∗
1
concern has been voiced about the pollution of soil and aquatic environments with pesticides during recent years (Deb et al., 2010). One major group is strobilurins that were developed from strobilurin A in Strobilurus tenecellus, deemed the only effective means to combating soybean rust
Corresponding author. Tel.: +86 029 87092102; fax: +86 029 87092164. E-mail address: [email protected] (G.-X. Wang). These authors are joint first author and contributed equally to this work.
http://dx.doi.org/10.1016/j.etap.2014.04.006 1382-6689/© 2014 Elsevier B.V. All rights reserved.
e n v i r o n m e n t a l t o x i c o l o g y a n d p h a r m a c o l o g y 3 7 ( 2 0 1 4 ) 1040–1047
(http://www.extension.purdue.edu/extmedia/ID/ID-324.pdf), which has lead to an increase of fungicide mass per hectare of 286%, 424% and 355% for corn, soybean and winter wheat in the last decade, respectively (Morrison et al., 2013). The molecular target of strobilurins in fungi is to block the mitochondrial respiratory electron transfer chain between cytochrome b and cytochrome c1 at the ubiquinol oxidizing site (Qo) of the complex III, and thus can cause losses of ATP synthesis and inhibition of cellular respiration (Bartlett et al., 2002; Hnatova et al., 2003). Due to special physical and chemical properties, strobilurins have been used widely in the United States and Great Britain as an effective fungicidal agent applied on crops (Hooser et al., 2012). Flint® is the first fungicide of the strobilurin groups in the Bayer Crop Science product portfolio (Junges et al., 2012). This formulation contains trifloxystrobin (CAS Registry Number 141517-21-7) as the active ingredient. According to United States Environmental Protection Agency (EPA) Pesticide fact sheet, trifloxystrobin is expected to degrade rapidly (hours to days) in most soil and aquatic environments and the free form of the acid metabolite, CGA-321113, appears to be a mobile and persistent metabolite that can be further degraded but at a slower rate than the parent compound (http://www.epa.gov/opp00001/chem search/reg actions/registration/fs PC-129112 20-Sep-99.pdf). However, its primary metabolite [(E,E)-trifloxystrobin acid] is soluble in water; hence, aquatic organisms may be at risk of exposure to these products (Junges et al., 2012). Nowadays some investigators have considered that trifloxystrobin may have a very high mobility/dissipation rates from soil/air to water, and eventually lead to significant transport, reaching downstream aquatic ecosystems (Junges et al., 2012; Belden et al., 2010). This phenomenon may indicate that aquatic organisms may be at risk of exposure to trifloxystrobin at a higher concentration (compared with the relevant environmental concentration) during air spraying, or indirectly, leaching in soil, drain flow in some local waters. Even though Cámara de Sanidad Agropecuaria y Fertilizantes (CASAFE) has demonstrated that trifloxystrobin is low acute and chronic toxicity to humans, birds, mammals, bees, and other beneficial insects and earthworms (http://redbiblio.unne.edu.ar/pdf/0603-001005 I.pdf); though it has been classified as highly toxic to non-target aquatic species. For example, Australian Pesticides and Veterinary Medicines Authority (APVMA) noted that the median lethal concentration (96-h LC50 ) of trifloxystrobin for Oncorhynchus mykiss trout ranged from 15 to 78 g L−1 , and for Mysidopsis bahia the median effective concentration EC50 ranged from 9 to 34 g L−1 (http://www.apvma.gov.au/registration/assessment/ docs/prs trifloxystrobin.pdf). In addition, Belden et al. (2010) found that toxic effects of trifloxystrobin on Bufo cognatus tadpoles were obtained at 40 g L−1 , and trifloxystrobin would alter the outcome of eel-tadpole interaction by reducing prey movements (Junges et al., 2012). Even though a series of studies assessed toxic and lethal doses of trifloxystrobin in aquatic organisms, potential effects and mechanisms of action are still lacking. Aquatic food chains, algae not only are important food components for aquatic species, especially fish and shellfish, but also considered to be very sensitive indicators of various
1041
toxicants (Hörnström, 1990; Blaise, 1993). In addition, algae can absorb inorganic salts and carbon dioxide to synthesize organics in the light to produce oxygen, control water quality and sediment stabilization, and provide habitat and shelter for aquatic life and wildlife (Lewis, 1995). Both material circulation and energy flow in the aquatic ecosystems are based on algae that are the main primary sources in aquatic ecosystem and (Krauss, 1953; Moss, 1973). Nowadays more efforts are continuously made to explore effects of environmental toxicants on algae, which are meaningful and quantifiable indicators of ecological change on short timescales (Ramakrishnan et al., 2010). Thereby, algae play an important role in water environmental risk assessment. The purpose of our study was to experimentally determine the potential toxic effect of trifloxystrobin on the freshwater green alga Chlorella vulgaris, and to examine different critical endpoints, such as median (IC50 ) and tenth percentile (IC10 ) inhibition concentrations, expression of certain mRNA (photosystem I reaction center protein subunit B (psaB), photosystem II reaction center protein subunit C (psbC), large subunit of ribulose-1,5-bisphosphate carboxylase oxygenase (rbcL) and ATP synthase subunit alpha (ATPs)) was investigated, as well as physiological changes (total protein, total antioxidant capacity (T-AOC), peroxidase (POD) and superoxide dismutase (SOD)) measured. We also investigated whether cellular microstructure was changed by exposure to trifloxystrobin.
2.
Materials and methods
2.1.
Fungicide formulations
The strobilurin trifloxystrobin (purity 99%, (E,E) methoxyimino-{2-[1-(3-trifluoromethyl-phenyl)-ethylideneamin-ooxymethyl]-phenyl}-acetic acid methyl ester) was purchased from Jintan Huashang Chemical Auxiliaries Corp., LTD. (Jiangsu, China). High performance liquid chromatography (HPLC) (L-2000, Hitachi, Japan) was used to confirm trifloxystrobin purity. Based on previous studies, no solvent was used as stock and exposure concentrations were well below the solubility of trifloxystrobin in water.
2.2.
Test organisms
C. vulgaris was obtained from Institute of Hydrobiology, Chinese Academy of Sciences (Hubei, China), stationary culture in sterilized blue-green alga medium BG-11 (Rippka, 1972). C. vulgaris were kept at 25 ± 0.5 ◦ C illuminated with approximately 2000 lux, with a 16:8 h light:dark photoperiod. The health C. vulgaris cells were assessed prior to testing by monitoring their growth over a ten-day period (Mitchell et al., 2011). In a healthy culture, growth should plateau between days eight and ten, with the exponential growth phase occurring between days three and seven, which verified that the stock cultures were normal and healthy (Mitchell et al., 2011). Inoculum from a four to seven days old stock culture (the exponential growth phase occurring) was transferred to 250 mL flasks containing 100 mL fresh liquid growth medium. The initial cell density for each experiment was 3.55 × 105 cells mL−1 (log phase).
1042
e n v i r o n m e n t a l t o x i c o l o g y a n d p h a r m a c o l o g y 3 7 ( 2 0 1 4 ) 1040–1047
Table 1 – Sequences of primer pairs used for the analysis of gene expression by real-time PCR. Primer sequences (from 5 to 3 )
Position
GenBank accession no.
Forward Reverse Forward
TTGACGGAAGGGCACCA CACCACCCATAGAATCAAGAAAGAG GCTGGTCAATCTTTGGCTTC
1146–1272
X13688
1462–1551
GeneID:809130
Reverse Forward
AAAGTCTCCGGTCCGATGGT GAACATCACCACCACCAGGA
834–913
GeneID:809108
Reverse Forward
CGGTGCTTGGCTTTTAGTTTG CTTGGACGACTGTATGGACTG
194–464
AF499684
Reverse Forward Reverse
ATACCGTGAGGAGGACCTTG AAACAGTCTTCGTCGCCCACGC GAGACACGGCCCAGACGCTT
181–280
JK815952
Genes 18S rRNA Photosystem I reaction center protein subunit B (psaB) Photosystem II reaction center protein subunit C (psbC) Large subunit of ribulose-1,5-bisphosphate carboxylase oxygenase (rbcL) ATP synthase subunit alpha (ATPs)
2.3.
Growth inhibition tests on C. vulgaris
A range of initial concentrations (10, 16, 25, 40, 63, 80, 160, 250 and 400 g L−1 ) of the trifloxystrobin solutions used in this study were selected on the basis of their observed effects of acute toxicity in preliminary studies. Triplicate cultures were prepared for each treatment. Examining the effects of trifloxystrobin on algae followed the microplate method (Blaise and Vasseur, 2005). Tests were conducted in sterile, disposable, flat-bottomed 96-well plates, with each well added to 200 L of test solution, followed by inoculated with 20 L of test solution, added to each well, followed by inoculation. Algal cell concentrations were measured at 680 nm in a microplate reader (ELX800, Gene, Hong Kong, China).
2.4.
Electron microscopy analysis
To explore the damage of trifloxystrobin on algal cells, exposure concentration was set to 300 and 600 g L−1 (IC50,96 h and twice of the IC50,96 h value), respectively. Triplicate cultures were prepared for each treatment. Experimental groups (control and treatment) were collected at day 4, and then fixed with 2.5% glutaldehyde at 4 ◦ C overnight. After that, samples were washed with pH 7.2 PBS, dehydrated in a graded series of ethanol, passaged through acetone, replaced with isoamyl acetate, and fully dried with a critical point dryer. The treated alga cells were mounted on copper stubs and sputter-coated with gold–palladium, and then observed using a field emission scanning electron microscopy (FE-SEM, S-4800, Hitachi, Japan) at 10 kV.
2.5.
Gene transcription analysis
Determining mRNA expression by trifloxystrobin treatment, C. vulgaris were exposed to a range of initial concentrations (25, 50 and 100 g L−1 , exposure concentrations chosen according to the above inhibition tests) for 48 and 96 h periods. Triplicate cultures were prepared for each treatment. For RNA extractions, 20 mL of algal cultures were transferred to centrifuge tubes and pellets collected, followed by centrifugation at 1.2 × 104 × g for 15 min, and immediately frozen in liquid nitrogen, and added TRIZOL reagent (Invitrogen, Carlsbad,
CA, USA) to extract the RNA, according to the manufacturer’s instruction. Reverse transcription (RT) was carried out using PrimeScript RT reagent Kit (Perfect Real Time) and oligo d (T) primer (TaKaRa, Dalian, China). The reaction mixture was first maintained at 37 ◦ C for 15 min and then heated at 85 ◦ C for 5 s to stop the RT reaction. Three photosynthesis-related genes (psaB, psbC and rbcL) and one energy-related-gene (ATPs) in the freshwater algae C. vulgaris were selected for study. The 18S rRNA gene was used to standardize the results by eliminating variation in the quantity and quality of mRNA and cDNA. Quantitative real-time PCR primers for 18S rRNA, psaB, psbC, rbcL and ATPs genes were designed by previous studies (Qian et al., 2008a, b; Tate et al., 2012) and are listed in Table 1. The relative quantification of gene transcription was performed as described in Qian et al. (2008a, b).
2.6.
Enzyme extraction and assays
The algal cells exposed to trifloxystrobin were harvested to extract enzymes each time after exposure for 48 and 96 h, respectively. Three replicates were set for the tests. After the incubation period, the selected algal cell cultures (50 mL) were centrifuged at 8.0 × 103 × g for 15 min at 4 ◦ C, and cell pellets were added to PBS and homogenized by an ultrasonic cell pulverizer (JY92-2D, Xinzhi Co., Ningbo, China) at 200 W with total time of 10 min (ultrasonic:rest = 2:8 s) under ice-bath cooling. The homogenate was centrifuged at 1.0 × 104 × g for 15 min at 4 ◦ C to obtain the supernatant for assays of the enzyme activity. The cell-free enzyme supernatant was maintained at −20 ◦ C and not more than 12 h before enzymatic assays. All operations were under ice-bath cooling to keep enzyme activities. In the experiment, total protein content was determined by Bradford, 1976 using bovine serum albumin as the standard. In addition, T-AOC, POD and SOD were measured using commercial assay kits (Jiancheng Institute, Nanjing, China) according to the manufacturer’s instructions. All measurements were made on a microplate reader (ELX800, Gene, Hong Kong, China).
2.7.
Statistical analyses
Statistical analyses were performed using SPSS (version 16.0) statistical software (SPSS Inc., Chicago, IL, USA). The growth
e n v i r o n m e n t a l t o x i c o l o g y a n d p h a r m a c o l o g y 3 7 ( 2 0 1 4 ) 1040–1047
1043
100
Trifloxystrobin Inhibition (%)
80 60 40 20 0 0
80
160
240
320
400
480
-1
Concentration (μg L )
Fig. 1 – Growth inhibition (%) of C. vulgaris after 96 h exposed to trifloxystrobin.
inhibitory rate (IR) over control was estimated by the following formula: IR (%) = [1 − Nt /N0 ] × 100, where Nt and N0 are the cell numbers in the treated and control cultures, respectively. The IC10,50 values with 95% confidence intervals were estimated by probit analysis. The mean and standard error of the mean (SEM) were calculated for each treatment. Statistical differences between experimental group and control were analyzed through one-way analysis of variance (ANOVA) after normalization. When the probability (p) was less than 0.05, the values were considered significantly different.
3.
Results
3.1.
Effects of trifloxystrobin on algal growth
In toxicity tests, percent growth inhibition curves of C. vulgaris in relation to exposure concentration of trifloxystrobin for short-term (96 h) are shown in Fig. 1. As shown in Fig. 1, the growth rates of C. vulgaris generally declined with increasing exposure, following a concentration–response relationship in 96 h exposure period, where 63.45% reduction was found in the highest concentration treatment compared with the control. The IC10,50 values of trifloxystrobin tested were 26.61 (95% confidence interval, 19.96–33.40) and 255.58 (95% confidence interval, 207.81–330.29) g L−1 , respectively.
3.2.
Effects on cellular microstructure
The microstructure changes in C. vulgaris cell were reflected in Fig. 2. Fig. 2A showed normal cells were intact, round, and plump and had spherical shapes. After 4 days of exposure to trifloxystrobin, some cells were obviously pronounced depressed or shrunk compared with the control.
3.3.
Gene expression
The results showing the transcript expression of four genes (psaB, psbC, rbcL and ATPs) was screened by qRT-PCR in C. vulgaris exposed to trifloxystrobin during 48 and 96 h periods are demonstrated in Fig. 3. The result in Fig. 3A showed that the transcript levels of ATPs was also significantly increased in response to all trifloxystrobin treatments (10.13, 2.10- and 2.82-fold for 25–100 g L−1 after 48 h exposure,
respectively; 5.81-, 4.62- and 3.15-fold for 25–100 g L−1 after 96 h exposure, respectively) compared with controls at different durations, although the rising levels were decreased with increasing concentration. In the trifloxystrobin-treated group, three photosynthesis-related gene levels were downregulated throughout the observation period (Fig. 3B–D). As shown in Fig. 3B, the gene of psaB was significantly decreased to 0.43- and 0.54-folds of the control following 48 and 96 h exposure to 100 g L−1 trifloxystrobin, respectively; simultaneously, the significant decrease of psbC was found in the concentrations of 100 g L−1 of trifloxystrobin (0.22-fold, 48 h; 0.27-fold, 96 h) (Fig. 3C). For the rbcL gene, the expression levels were also decreased significantly in the highest concentration groups at different durations (0.67-fold after 48 h and 0.41-fold after 96 h) (Fig. 2D).
3.4. Effects of trifloxystrobin on total protein, T-AOC, POD and SOD in C. vulgaris As shown in Fig. 4, protein content decreased significantly with exposure concentration and time. The relative protein concentration of C. vulgaris after 48 h exposure to 37.5, 75.0 and 150.0 g L−1 trifloxystrobin was 85.60%, 78.71% and 72.82% versus control group, respectively. Compared with the control, the protein content of C. vulgaris after 96 h exposed to different concentrations of trifloxystrobin decreased significantly, with 17.19%, 22.60% and 23.09% reduction. In contrast, the SOD and POD content increased with exposure concentration and time extending (Fig. 4B and C). The SOD content at 75.0 and 150 g L−1 trifloxystrobin exposures after 48 h were 2.04- and 2.21-fold higher relative to the control, respectively (Fig. 4B); simultaneously, after 96 h, a 2.47-fold increase was found in the highest concentration compared with the control. The result in Fig. 4C showed that POD activity was also significantly influenced in response to different concentrations of trifloxystrobin after 48 and 96 h exposure. POD activity increased significantly by 95.97% and 133.88% compared with controls in response to the highest concentrations, respectively (Fig. 4C). The effects of trifloxystrobin on T-AOC content were shown in Fig. 4D. The T-AOC of C. vulgaris initially decreased significantly after exposure to 75.0 and 150 g L−1 trifloxystrobin during two exposure periods (0.24- and 0.24-folds for 48 h; 0.60 and 0.49-folds for 96 h).
1044
e n v i r o n m e n t a l t o x i c o l o g y a n d p h a r m a c o l o g y 3 7 ( 2 0 1 4 ) 1040–1047
Fig. 2 – FE-SEM images of C. vulgaris treated by trifloxystrobin. (A): control; (B) 300 g L−1 group and (C): 600 g L−1 group.
4.
Discussion
The increased use of trifloxystrobin for the chemical control of pathogenic fungi might damage the biology of aquatic
systems. Furthermore, we observed a highlighted that process of algal growth and cell morphology under high exposure concentrations of trifloxystrobin. Our results demonstrated that micro-algal growth was significantly affected by trifloxystrobin in a concentration-dependent manner. Furthermore, cellular microstructure showed the potential negative effect of trifloxystrobin on C. vulgaris cells which may alter the membrane permeability and cause irreversible damage on the cellular membrane. This result may be debilitating and possibly fatal, albeit t high exposure concentrations. The membrane permeability change in the C. vulgaris cells may reflect substantial release of some cell contents. Thereby, exposure to trifloxystrobin at the initial high experimental concentrations would bring about abnormal physiological metabolism of algae cells, and finally may lead to cell apoptosis. The main reason responsible for oxidative imbalance in plants is the reduction of oxygen by surplus electrons that enter the photosynthetic electron transport chain (Asada et al., 1998). Considering these issues, three photosynthesisrelated genes and one energy-related gene were chosen for better understanding of the potential effects and mechanism of action in this study. In C. vulgaris, psaB encodes for the photosystem I (PSI) reaction center protein; psbC encodes for chlorophyll-protein complexes (CP43), acting as an integral membrane protein component of photo-system II (PSII); and rbcL encodes for the large subunit of one key enzyme in the Calvin Benson Basham cycle, catalyzing the first step in which CO2 is reductively assimilated into organic carbon (Qian et al., 2008a, b). The RT-qPCR results demonstrated that the psaB, psbC and rbcL genes were all decreased with exposure to trifloxystrobin during 48 and 96 h exposure periods. The abundance of the Rubisco (both carboxylase and oxygenase activities that control the rate-limiting step of carbon assimilation and photorespiration, respectively) gene transcripts was reduced in response to trifloxystrobin. The decrease resulted in a corresponding decrease in the amount of enzyme and its activity (Qian et al., 2008a, b). By decreasing the abundance of rbcL, blocking carbon assimilation and photorespiration, trifloxystrobin likely caused the accumulation of a mass of reducing equivalents. Hence, excess electrons can lead to decreased transcription of PSI and PSII genes. Additionally, the products of these genes mainly participate in electron transport and their inhibition may hinder electron transport and lead to decreased transcription of PSI and PSII genes and induce oxidative stress (Qian et al., 2012). This result was in accordance with the phenomenon of decrement of T-AOC level discussed below. Simultaneously, up-regulation of ATPs may suggest an abnormal balance between ATP and NADPH production, which is important to photosynthetic productivity (Kramer and Evans, 2011). However, we found that mRNA expression decreased with exposure concentration. This may possibly be due to algal cells in the lower exposure concentrations attempting to produce more NADPH. This finding was in agreement with the conclusion of Maltby et al. (2009) that the sensitivity of non-target organisms (fish, invertebrates, and primary producers) to fungicides can affect energy production. We also investigated that trifloxystrobin not only can change gene transcription at the molecular level but also
e n v i r o n m e n t a l t o x i c o l o g y a n d p h a r m a c o l o g y 3 7 ( 2 0 1 4 ) 1040–1047
1045
Fig. 3 – Expression of ATPs (A), psaB (B), psbC (C) and rbcL (D) genes in C. vulgaris exposed to 25, 50 and 100 g L−1 of trifloxystrobin for 48 and 96 h. Values were normalized against 18S rRNA as housekeeping gene and represent the relative mRNA expression (mean ± SEM) of three replicate. The mRNA level of the control group is expressed as 1. Values that were significantly different from the control are indicated by asterisks (one-way ANOVA, *p < 0.05; **p < 0.01).
bring about various physiological and biochemical changes in C. vulgaris. In the present study, we observed that total protein content decreased as exposure time and concentration. The decrease of protein content herein may be in response to an increase in membrane permeability, or explain the inhibition of protein synthesis by trifloxystrobin, to some extent. Protein as an important part of the organism, not only participates in the various kinds of physiological processes, but also acts as enzymes to facilitate the biochemical reactions in cell metabolism (Zhang et al., 2013). Hence, the content of soluble protein could reflect the activity of cell metabolism and extent of damage. The decrease of protein content herein might explain, to some extent, the inhibition of protein synthesis by azoxystrobin and kresoxim-methyl, with the potential to lead to a disorder of normal physiological metabolism functions in C. vulgaris cells. T-AOC, an integrated index, can reflect a comprehensive status of the defense system (Sun et al., 2009). Nowadays the T-AOC response was rarely investigated, though some studies report responses of antioxidants in algae exposed to environmental stresses (Li et al., 2006; Hong et al., 2009). Our result showed that T-AOC exposure decreased
in concentration-dependent manner during 48 and 96 h exposure periods. T-AOC reflects the health of plants (Li et al., 2011), and the decrease in T-AOC level suggested that the antioxidant protective system of C. vulgaris might be affected by trifloxystrobin. Furthermore, the activities of two antioxidant enzymes (SOD and POD) in time-dependent and concentration-dependent manner were revealed in our study. POD, present in almost all living organisms, uses various peroxides as electron acceptors to catalyze a number of oxidative reactions (Koua et al., 2009). SOD is responsible for counteracting the effects of ROS, particularly the superoxide ion (Van Rensburg et al., 1995), can indicate the protective system status in organisms. The up-regulation of POD and SOD levels can indicate potential protection against oxidative damage, initially increasing in C. vulgaris, which is commonly reported for a variety of environmental stresses (Geret and Bebianno, 2004). Prolonged exposure depletes antioxidant enzymes and oxidative stress may eventually result in cellular damage. Taken together, trifloxystrobin could weaken the antioxidant defense system and enhance oxidative stress to damage the C. vulgaris physiology, and this is a function of exposure concentration.
1046
e n v i r o n m e n t a l t o x i c o l o g y a n d p h a r m a c o l o g y 3 7 ( 2 0 1 4 ) 1040–1047
trifloxystrobin may affect the activity of antioxidant enzymes as well as increase oxidative stress, rendering C. vulgaris more vulnerable to oxidative damage. Thereby, there could be potential negative influences to unicellular green algae at the experimental concentrations tested.
Conflict of interest The authors declare that there are no conflicts of interest.
Acknowledgments This work was supported by the National Training Programs of Innovation and Entrepreneur ship for under graduates under Grant.
Appendix A. Supplementary data Supplementary material related to this article can be found, in the online version, at doi:10.1016/j.etap.2014.04.006.
references
Fig. 4 – Levels of total protein (A), SOD (B), POD (C) and T-AOC (D) in C. vulgaris exposed to different concentrations of trifloxystrobin. ANOVA is used to analyze the differences to control at 48 and 96 h. Asterisks represent statistically significant differences compared with the control (*p < 0.05; **p < 0.01; n = 3; bar = SEM).
5.
Conclusion
In conclusion, the present results showed potential toxic effect of trifloxystrobin on C. vulgaris by inhibition of algal growth, possibly altered cell membrane permeability, affected mRNA expression, and induced oxidative damage in a series of experimental concentrations. In this study trifloxystrobin damaged cellular structure at higher concentrations and reduced normal C. vulgaris photosynthesis-related gene expression. Among different physiological indicators measured,
Asada, K., Endo, T., Mano, J., Miyake, C., 1998. Molecular mechanism for relaxation of and protection from light stress. In: Sato, K., Murata, N. (Eds.), Stress Responses of Photosynthetic Organisms. Elsevier Science Publishing, Amsterdam, pp. 37–52. Bartlett, D.W., Clough, J.M., Godwin, J.R., Hall, A.A., Hamer, M., Parr-Dobrzanski, B., 2002. The strobilurin fungicides. Pest Manag. Sci. 58, 649–662. Belden, J., McMurry, S., Smith, L., Reilley, P., 2010. Acute toxicity of fungicide formulations to amphibians at environmentally relevant concentrations. Environ. Toxicol. Chem. 29, 2477–2480. Blaise, C., 1993. Practical laboratory applications with micro-algae for hazard assessment of aquatic contaminants. In: Ecotoxicology Monitoring. VCH Publishers, Weinheim, Germany, pp. 83–107. Blaise, C., Vasseur, P., 2005. Algal Microplate Toxicity Test. Small-Scale Freshwater Toxicity Investigations. Springer, pp. 137–179. Bradford, M.M., 1976. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. biochem. 72, 248–254. Deb, D., Engel, B.A., Harbor, J., Hahn, L., Lim, K.J., Zhai, T., 2010. Investigating potential water quality impacts of fungicides used to combat soybean rust in Indiana. Water, Air, Soil Pollut. 207, 273–288. Geret, F., Bebianno, M.J., 2004. Does zinc produce reactive oxygen species in Ruditapes decussatus? Ecotoxicol. Environ. Saf. 57, 399–409. ˇ ˇ Hnatova, M., Gbelska, Y., Obernauerova, M., Subíková, V., Subík, J., 2003. Cross-resistance to strobilurin fungicides in mitochondrial and nuclear mutants of Saccharomyces cerevisiae. Folia Microbiol. 48, 496–500. Hong, Y., Hu, H.Y., Xie, X., Sakoda, A., Sagehashi, M., Li, F.M., 2009. Gramine-induced growth inhibition, oxidative damage and antioxidant responses in freshwater cyanobacterium Microcystis aeruginosa. Aquat. Toxicol. 91, 262–269.
e n v i r o n m e n t a l t o x i c o l o g y a n d p h a r m a c o l o g y 3 7 ( 2 0 1 4 ) 1040–1047
Hooser, E.A., Belden, J.B., Smith, L.M., McMurry, S.T., 2012. Acute toxicity of three strobilurin fungicide formulations and their active ingredients to tadpoles. Ecotoxicology 21, 1458–1464. Hörnström, E., 1990. Toxicity test with algae – a discussion on the batch method. Ecotoxicol. Environ. Saf. 20, 343–353. Junges, C., Peltzer, P., Lajmanovich, R., Attademo, A., Cabagna Zenklusen, M., Basso, A., 2012. Toxicity of the fungicide trifloxystrobin on tadpoles and its effect on fish–tadpole interaction. Chemosphere 87, 1348–1354. Koua, D., Cerutti, L., Falquet, L., Sigrist, C.J., Theiler, G., Hulo, N., Dunand, C., 2009. PeroxiBase: a database with new tools for peroxidase family classification. Nucleic Acids Res. 37, 261–266. Kramer, D.M., Evans, J.R., 2011. The importance of energy balance in improving photosynthetic productivity. Plant Physiol. 155, 70–78. Krauss, R.W., 1953. Inorganic nutrition of algae Algal culture from laboratory to pilot plant. Carnegie Inst. Wash. Publ. 600, 85–102. Lewis, M.A., 1995. Use of freshwater plants for phytotoxicity testing: a review. Environ. Pollut. 87, 319–336. Li, D.D., Zhou, D.M., Wang, P., Weng, N.Y., Zhu, X.D., 2011. Subcellular Cd distribution and its correlation with antioxidant enzymatic activities in wheat (Triticum aestivum) roots. Ecotox. Environ. Safe. 74, 874–881. Li, M., Hu, C.W., Zhu, Q., Chen, L., Kong, Z.M., Liu, Z.L., 2006. Copper and zinc induction of lipid peroxidation and effects on antioxidant enzyme activities in the microalga Pavlova viridis (Prymnesiophyceae). Chemosphere 62, 565–572. Maltby, L., Brock, T.C., van den Brink, P.J., 2009. Fungicide risk assessment for aquatic ecosystems: importance of interspecific variation, toxic mode of action, and exposure regime. Environ. Sci. Technol. 43, 7556–7563. Mitchell, R.J., Myers, A.L., Mabury, S.A., Solomon, K.R., Sibley, P.K., 2011. Toxicity of fluorotelomer carboxylic acids to the algae Pseudokirchneriella subcapitata and Chlorella vulgaris, and the amphipod Hyalella azteca. Ecotoxicol. Environ. Saf. 74, 2260–2267. Morrison, S.A., Mcmurry, S.T., Smith, L.M., Belden, J.B., 2013. Acute toxicity of pyraclostrobin and trifloxystrobin to Hyalella azteca. Environ. Toxicol. Chem. 32, 1516–1525.
1047
Moss, B., 1973. The influence of environmental factors on the distribution of freshwater algae: an experimental study: II. The role of pH and the carbon dioxide-bicarbonate system. J. Ecol., 157–177. Qian, H., Chen, W., Sheng, G.D., Xu, X., Liu, W., Fu, Z., 2008a. Effects of glufosinate on antioxidant enzymes, subcellular structure, and gene expression in the unicellular green alga Chlorella vulgaris. Aquat. Toxicol. 88, 301–307. Qian, H.F., Li, J., Pan, X.J., Chen, J., Zhou, D.M., Chen, Z.G., Zhang, L., Fu, Z.W., 2012. Analyses of gene expression and physiological changes in Microcystis aeruginosa reveal the phytotoxicities of three environmental pollutants. Ecotoxicology 3, 847–859. Qian, H.F., Sheng, G.D., Liu, W., Lu, Y., Liu, Z., Fu, Z., 2008b. Inhibitory effects of atrazine on Chlorella vulgaris as assessed by real-time polymerase chain reaction. Environ. Toxicol. Chem. 27, 182–187. Ramakrishnan, B., Megharaj, M., Venkateswarlu, K., Naidu, R., Sethunathan, N., 2010. The impacts of environmental pollutants on microalgae and cyanobacteria. Crit. Rev. Environ. Sci. Tecnol. 40, 699–821. Rippka, R., 1972. Photoheterotrophy and chemoheterotrophy among unicellular blue-green algae. Arch. Mikrobiol. 87, 93–98. Sun, D.Q., Li, A.W., Li, J., Li, D.G., Li, Y.X., Feng, H., Gong, M.G., 2009. Changes of lipid peroxidation in carbon disulfide-treated rat nerve tissues and serum. Chem. Biol. Interact. 179, 110–117. Tate, J.J., Gutierrez-Wing, M.T., Rusch, K.A., Benton, M.G., 2012. Gene expression analysis of a Louisiana native Chlorella vulgaris (Chlorophyta)/Leptolyngbya sp (Cyanobacteria) co-culture using suppression subtractive hybridization. Eng. Life Sci. 13, 185–193. Van Rensburg, S., Carstens, M., Potocnik, F., Van Der Spuy, G., Van Der Walt, B., Taljaard, J., 1995. Transferrin C2 and Alzheimer’s disease: another piece of the puzzle found? Med. Hypotheses 44, 268–272. Zhang, C., Yi, Y.L., Hao, K., Liu, G.L., Wang, G.X., 2013. Algicidal activity of Salvia miltiorrhiza Bung on Microcystis aeruginosa – towards identification of algicidal substance and determination of inhibition mechanism. Chemosphere 93, 997–1004.
Available online at www.sciencedirect.com
ScienceDirect journal homepage: www.elsevier.com/locate/etap
Potential toxic effect of trifloxystrobin on cellular microstructure, mRNA expression and antioxidant enzymes in Chlorella vulgaris Yu-Feng Shen a,1 , Lei Liu a,1 , Yu-Xin Gong b , Bin Zhu a , Guang-Lu Liu c , Gao-Xue Wang a,∗ a
College of Animal Science and Technology, Northwest A&F University, Xinong Road 22nd, Yangling, Shaanxi 712100, China b College of Veterinary Medicine, Northwest A&F University, Xinong Road 22nd, Yangling, Shaanxi 712100, China c College of Science, Northwest A&F University, Xinong Road 22nd, Yangling, Shaanxi 712100, China
a r t i c l e
i n f o
a b s t r a c t
Article history:
This study investigated the effects of trifloxystrobin that one strobilurin used widely in the
Received 30 October 2013
world as an effective fungicidal agent to control Asian soybean rust on aquatic unicellu-
Received in revised form
lar algae Chlorella vulgaris. We determined the potential toxic effect of trifloxystrobin on
3 April 2014
C. vulgaris, and found median inhibition concentration (IC50 ) value 255.58 (95% confidence
Accepted 3 April 2014
interval, 207.81–330.29) g L−1 . In addition, the algal cells were obviously depressed or shrunk
Available online 13 April 2014
at different concentrations by electron microscopy. In the study, a real-time polymerase
Keywords:
thetic genes, psaB, psbC, and rbcL, and one energy gene, ATPs. The results showed that
Chlorella vulgaris
trifloxystrobin reduced the transcript abundances of the three genes and enhanced expres-
chain reaction (PCR) assay showed changes in transcript abundances of three photosyn-
Trifloxystrobin
sion of ATPs after 48 and 96 h. The lowest abundances of psaB, psbC and rbcL transcripts in
Microstructure
response to trifloxystrobin exposure were 58%, 79% and 60% of those of the control, respec-
Oxidative damage
tively. For the potential toxic influences, trifloxystrobin could decrease the soluble protein and total antioxidant contents (T-AOC), and increase superoxide dismutase (SOD) and peroxidase (POD) activity with a gradual concentration–response relationship. Overall, the present study demonstrated that trifloxystrobin could affect the activities of antioxidant enzymes, disrupts photosynthesis in C. vulgaris, and damage cellular structure. © 2014 Elsevier B.V. All rights reserved.
1.
Introduction
With the rapid development of modern agriculture, application of new pesticides has risen sharply. Hence, increasing
∗
1
concern has been voiced about the pollution of soil and aquatic environments with pesticides during recent years (Deb et al., 2010). One major group is strobilurins that were developed from strobilurin A in Strobilurus tenecellus, deemed the only effective means to combating soybean rust
Corresponding author. Tel.: +86 029 87092102; fax: +86 029 87092164. E-mail address: [email protected] (G.-X. Wang). These authors are joint first author and contributed equally to this work.
http://dx.doi.org/10.1016/j.etap.2014.04.006 1382-6689/© 2014 Elsevier B.V. All rights reserved.
e n v i r o n m e n t a l t o x i c o l o g y a n d p h a r m a c o l o g y 3 7 ( 2 0 1 4 ) 1040–1047
(http://www.extension.purdue.edu/extmedia/ID/ID-324.pdf), which has lead to an increase of fungicide mass per hectare of 286%, 424% and 355% for corn, soybean and winter wheat in the last decade, respectively (Morrison et al., 2013). The molecular target of strobilurins in fungi is to block the mitochondrial respiratory electron transfer chain between cytochrome b and cytochrome c1 at the ubiquinol oxidizing site (Qo) of the complex III, and thus can cause losses of ATP synthesis and inhibition of cellular respiration (Bartlett et al., 2002; Hnatova et al., 2003). Due to special physical and chemical properties, strobilurins have been used widely in the United States and Great Britain as an effective fungicidal agent applied on crops (Hooser et al., 2012). Flint® is the first fungicide of the strobilurin groups in the Bayer Crop Science product portfolio (Junges et al., 2012). This formulation contains trifloxystrobin (CAS Registry Number 141517-21-7) as the active ingredient. According to United States Environmental Protection Agency (EPA) Pesticide fact sheet, trifloxystrobin is expected to degrade rapidly (hours to days) in most soil and aquatic environments and the free form of the acid metabolite, CGA-321113, appears to be a mobile and persistent metabolite that can be further degraded but at a slower rate than the parent compound (http://www.epa.gov/opp00001/chem search/reg actions/registration/fs PC-129112 20-Sep-99.pdf). However, its primary metabolite [(E,E)-trifloxystrobin acid] is soluble in water; hence, aquatic organisms may be at risk of exposure to these products (Junges et al., 2012). Nowadays some investigators have considered that trifloxystrobin may have a very high mobility/dissipation rates from soil/air to water, and eventually lead to significant transport, reaching downstream aquatic ecosystems (Junges et al., 2012; Belden et al., 2010). This phenomenon may indicate that aquatic organisms may be at risk of exposure to trifloxystrobin at a higher concentration (compared with the relevant environmental concentration) during air spraying, or indirectly, leaching in soil, drain flow in some local waters. Even though Cámara de Sanidad Agropecuaria y Fertilizantes (CASAFE) has demonstrated that trifloxystrobin is low acute and chronic toxicity to humans, birds, mammals, bees, and other beneficial insects and earthworms (http://redbiblio.unne.edu.ar/pdf/0603-001005 I.pdf); though it has been classified as highly toxic to non-target aquatic species. For example, Australian Pesticides and Veterinary Medicines Authority (APVMA) noted that the median lethal concentration (96-h LC50 ) of trifloxystrobin for Oncorhynchus mykiss trout ranged from 15 to 78 g L−1 , and for Mysidopsis bahia the median effective concentration EC50 ranged from 9 to 34 g L−1 (http://www.apvma.gov.au/registration/assessment/ docs/prs trifloxystrobin.pdf). In addition, Belden et al. (2010) found that toxic effects of trifloxystrobin on Bufo cognatus tadpoles were obtained at 40 g L−1 , and trifloxystrobin would alter the outcome of eel-tadpole interaction by reducing prey movements (Junges et al., 2012). Even though a series of studies assessed toxic and lethal doses of trifloxystrobin in aquatic organisms, potential effects and mechanisms of action are still lacking. Aquatic food chains, algae not only are important food components for aquatic species, especially fish and shellfish, but also considered to be very sensitive indicators of various
1041
toxicants (Hörnström, 1990; Blaise, 1993). In addition, algae can absorb inorganic salts and carbon dioxide to synthesize organics in the light to produce oxygen, control water quality and sediment stabilization, and provide habitat and shelter for aquatic life and wildlife (Lewis, 1995). Both material circulation and energy flow in the aquatic ecosystems are based on algae that are the main primary sources in aquatic ecosystem and (Krauss, 1953; Moss, 1973). Nowadays more efforts are continuously made to explore effects of environmental toxicants on algae, which are meaningful and quantifiable indicators of ecological change on short timescales (Ramakrishnan et al., 2010). Thereby, algae play an important role in water environmental risk assessment. The purpose of our study was to experimentally determine the potential toxic effect of trifloxystrobin on the freshwater green alga Chlorella vulgaris, and to examine different critical endpoints, such as median (IC50 ) and tenth percentile (IC10 ) inhibition concentrations, expression of certain mRNA (photosystem I reaction center protein subunit B (psaB), photosystem II reaction center protein subunit C (psbC), large subunit of ribulose-1,5-bisphosphate carboxylase oxygenase (rbcL) and ATP synthase subunit alpha (ATPs)) was investigated, as well as physiological changes (total protein, total antioxidant capacity (T-AOC), peroxidase (POD) and superoxide dismutase (SOD)) measured. We also investigated whether cellular microstructure was changed by exposure to trifloxystrobin.
2.
Materials and methods
2.1.
Fungicide formulations
The strobilurin trifloxystrobin (purity 99%, (E,E) methoxyimino-{2-[1-(3-trifluoromethyl-phenyl)-ethylideneamin-ooxymethyl]-phenyl}-acetic acid methyl ester) was purchased from Jintan Huashang Chemical Auxiliaries Corp., LTD. (Jiangsu, China). High performance liquid chromatography (HPLC) (L-2000, Hitachi, Japan) was used to confirm trifloxystrobin purity. Based on previous studies, no solvent was used as stock and exposure concentrations were well below the solubility of trifloxystrobin in water.
2.2.
Test organisms
C. vulgaris was obtained from Institute of Hydrobiology, Chinese Academy of Sciences (Hubei, China), stationary culture in sterilized blue-green alga medium BG-11 (Rippka, 1972). C. vulgaris were kept at 25 ± 0.5 ◦ C illuminated with approximately 2000 lux, with a 16:8 h light:dark photoperiod. The health C. vulgaris cells were assessed prior to testing by monitoring their growth over a ten-day period (Mitchell et al., 2011). In a healthy culture, growth should plateau between days eight and ten, with the exponential growth phase occurring between days three and seven, which verified that the stock cultures were normal and healthy (Mitchell et al., 2011). Inoculum from a four to seven days old stock culture (the exponential growth phase occurring) was transferred to 250 mL flasks containing 100 mL fresh liquid growth medium. The initial cell density for each experiment was 3.55 × 105 cells mL−1 (log phase).
1042
e n v i r o n m e n t a l t o x i c o l o g y a n d p h a r m a c o l o g y 3 7 ( 2 0 1 4 ) 1040–1047
Table 1 – Sequences of primer pairs used for the analysis of gene expression by real-time PCR. Primer sequences (from 5 to 3 )
Position
GenBank accession no.
Forward Reverse Forward
TTGACGGAAGGGCACCA CACCACCCATAGAATCAAGAAAGAG GCTGGTCAATCTTTGGCTTC
1146–1272
X13688
1462–1551
GeneID:809130
Reverse Forward
AAAGTCTCCGGTCCGATGGT GAACATCACCACCACCAGGA
834–913
GeneID:809108
Reverse Forward
CGGTGCTTGGCTTTTAGTTTG CTTGGACGACTGTATGGACTG
194–464
AF499684
Reverse Forward Reverse
ATACCGTGAGGAGGACCTTG AAACAGTCTTCGTCGCCCACGC GAGACACGGCCCAGACGCTT
181–280
JK815952
Genes 18S rRNA Photosystem I reaction center protein subunit B (psaB) Photosystem II reaction center protein subunit C (psbC) Large subunit of ribulose-1,5-bisphosphate carboxylase oxygenase (rbcL) ATP synthase subunit alpha (ATPs)
2.3.
Growth inhibition tests on C. vulgaris
A range of initial concentrations (10, 16, 25, 40, 63, 80, 160, 250 and 400 g L−1 ) of the trifloxystrobin solutions used in this study were selected on the basis of their observed effects of acute toxicity in preliminary studies. Triplicate cultures were prepared for each treatment. Examining the effects of trifloxystrobin on algae followed the microplate method (Blaise and Vasseur, 2005). Tests were conducted in sterile, disposable, flat-bottomed 96-well plates, with each well added to 200 L of test solution, followed by inoculated with 20 L of test solution, added to each well, followed by inoculation. Algal cell concentrations were measured at 680 nm in a microplate reader (ELX800, Gene, Hong Kong, China).
2.4.
Electron microscopy analysis
To explore the damage of trifloxystrobin on algal cells, exposure concentration was set to 300 and 600 g L−1 (IC50,96 h and twice of the IC50,96 h value), respectively. Triplicate cultures were prepared for each treatment. Experimental groups (control and treatment) were collected at day 4, and then fixed with 2.5% glutaldehyde at 4 ◦ C overnight. After that, samples were washed with pH 7.2 PBS, dehydrated in a graded series of ethanol, passaged through acetone, replaced with isoamyl acetate, and fully dried with a critical point dryer. The treated alga cells were mounted on copper stubs and sputter-coated with gold–palladium, and then observed using a field emission scanning electron microscopy (FE-SEM, S-4800, Hitachi, Japan) at 10 kV.
2.5.
Gene transcription analysis
Determining mRNA expression by trifloxystrobin treatment, C. vulgaris were exposed to a range of initial concentrations (25, 50 and 100 g L−1 , exposure concentrations chosen according to the above inhibition tests) for 48 and 96 h periods. Triplicate cultures were prepared for each treatment. For RNA extractions, 20 mL of algal cultures were transferred to centrifuge tubes and pellets collected, followed by centrifugation at 1.2 × 104 × g for 15 min, and immediately frozen in liquid nitrogen, and added TRIZOL reagent (Invitrogen, Carlsbad,
CA, USA) to extract the RNA, according to the manufacturer’s instruction. Reverse transcription (RT) was carried out using PrimeScript RT reagent Kit (Perfect Real Time) and oligo d (T) primer (TaKaRa, Dalian, China). The reaction mixture was first maintained at 37 ◦ C for 15 min and then heated at 85 ◦ C for 5 s to stop the RT reaction. Three photosynthesis-related genes (psaB, psbC and rbcL) and one energy-related-gene (ATPs) in the freshwater algae C. vulgaris were selected for study. The 18S rRNA gene was used to standardize the results by eliminating variation in the quantity and quality of mRNA and cDNA. Quantitative real-time PCR primers for 18S rRNA, psaB, psbC, rbcL and ATPs genes were designed by previous studies (Qian et al., 2008a, b; Tate et al., 2012) and are listed in Table 1. The relative quantification of gene transcription was performed as described in Qian et al. (2008a, b).
2.6.
Enzyme extraction and assays
The algal cells exposed to trifloxystrobin were harvested to extract enzymes each time after exposure for 48 and 96 h, respectively. Three replicates were set for the tests. After the incubation period, the selected algal cell cultures (50 mL) were centrifuged at 8.0 × 103 × g for 15 min at 4 ◦ C, and cell pellets were added to PBS and homogenized by an ultrasonic cell pulverizer (JY92-2D, Xinzhi Co., Ningbo, China) at 200 W with total time of 10 min (ultrasonic:rest = 2:8 s) under ice-bath cooling. The homogenate was centrifuged at 1.0 × 104 × g for 15 min at 4 ◦ C to obtain the supernatant for assays of the enzyme activity. The cell-free enzyme supernatant was maintained at −20 ◦ C and not more than 12 h before enzymatic assays. All operations were under ice-bath cooling to keep enzyme activities. In the experiment, total protein content was determined by Bradford, 1976 using bovine serum albumin as the standard. In addition, T-AOC, POD and SOD were measured using commercial assay kits (Jiancheng Institute, Nanjing, China) according to the manufacturer’s instructions. All measurements were made on a microplate reader (ELX800, Gene, Hong Kong, China).
2.7.
Statistical analyses
Statistical analyses were performed using SPSS (version 16.0) statistical software (SPSS Inc., Chicago, IL, USA). The growth
e n v i r o n m e n t a l t o x i c o l o g y a n d p h a r m a c o l o g y 3 7 ( 2 0 1 4 ) 1040–1047
1043
100
Trifloxystrobin Inhibition (%)
80 60 40 20 0 0
80
160
240
320
400
480
-1
Concentration (μg L )
Fig. 1 – Growth inhibition (%) of C. vulgaris after 96 h exposed to trifloxystrobin.
inhibitory rate (IR) over control was estimated by the following formula: IR (%) = [1 − Nt /N0 ] × 100, where Nt and N0 are the cell numbers in the treated and control cultures, respectively. The IC10,50 values with 95% confidence intervals were estimated by probit analysis. The mean and standard error of the mean (SEM) were calculated for each treatment. Statistical differences between experimental group and control were analyzed through one-way analysis of variance (ANOVA) after normalization. When the probability (p) was less than 0.05, the values were considered significantly different.
3.
Results
3.1.
Effects of trifloxystrobin on algal growth
In toxicity tests, percent growth inhibition curves of C. vulgaris in relation to exposure concentration of trifloxystrobin for short-term (96 h) are shown in Fig. 1. As shown in Fig. 1, the growth rates of C. vulgaris generally declined with increasing exposure, following a concentration–response relationship in 96 h exposure period, where 63.45% reduction was found in the highest concentration treatment compared with the control. The IC10,50 values of trifloxystrobin tested were 26.61 (95% confidence interval, 19.96–33.40) and 255.58 (95% confidence interval, 207.81–330.29) g L−1 , respectively.
3.2.
Effects on cellular microstructure
The microstructure changes in C. vulgaris cell were reflected in Fig. 2. Fig. 2A showed normal cells were intact, round, and plump and had spherical shapes. After 4 days of exposure to trifloxystrobin, some cells were obviously pronounced depressed or shrunk compared with the control.
3.3.
Gene expression
The results showing the transcript expression of four genes (psaB, psbC, rbcL and ATPs) was screened by qRT-PCR in C. vulgaris exposed to trifloxystrobin during 48 and 96 h periods are demonstrated in Fig. 3. The result in Fig. 3A showed that the transcript levels of ATPs was also significantly increased in response to all trifloxystrobin treatments (10.13, 2.10- and 2.82-fold for 25–100 g L−1 after 48 h exposure,
respectively; 5.81-, 4.62- and 3.15-fold for 25–100 g L−1 after 96 h exposure, respectively) compared with controls at different durations, although the rising levels were decreased with increasing concentration. In the trifloxystrobin-treated group, three photosynthesis-related gene levels were downregulated throughout the observation period (Fig. 3B–D). As shown in Fig. 3B, the gene of psaB was significantly decreased to 0.43- and 0.54-folds of the control following 48 and 96 h exposure to 100 g L−1 trifloxystrobin, respectively; simultaneously, the significant decrease of psbC was found in the concentrations of 100 g L−1 of trifloxystrobin (0.22-fold, 48 h; 0.27-fold, 96 h) (Fig. 3C). For the rbcL gene, the expression levels were also decreased significantly in the highest concentration groups at different durations (0.67-fold after 48 h and 0.41-fold after 96 h) (Fig. 2D).
3.4. Effects of trifloxystrobin on total protein, T-AOC, POD and SOD in C. vulgaris As shown in Fig. 4, protein content decreased significantly with exposure concentration and time. The relative protein concentration of C. vulgaris after 48 h exposure to 37.5, 75.0 and 150.0 g L−1 trifloxystrobin was 85.60%, 78.71% and 72.82% versus control group, respectively. Compared with the control, the protein content of C. vulgaris after 96 h exposed to different concentrations of trifloxystrobin decreased significantly, with 17.19%, 22.60% and 23.09% reduction. In contrast, the SOD and POD content increased with exposure concentration and time extending (Fig. 4B and C). The SOD content at 75.0 and 150 g L−1 trifloxystrobin exposures after 48 h were 2.04- and 2.21-fold higher relative to the control, respectively (Fig. 4B); simultaneously, after 96 h, a 2.47-fold increase was found in the highest concentration compared with the control. The result in Fig. 4C showed that POD activity was also significantly influenced in response to different concentrations of trifloxystrobin after 48 and 96 h exposure. POD activity increased significantly by 95.97% and 133.88% compared with controls in response to the highest concentrations, respectively (Fig. 4C). The effects of trifloxystrobin on T-AOC content were shown in Fig. 4D. The T-AOC of C. vulgaris initially decreased significantly after exposure to 75.0 and 150 g L−1 trifloxystrobin during two exposure periods (0.24- and 0.24-folds for 48 h; 0.60 and 0.49-folds for 96 h).
1044
e n v i r o n m e n t a l t o x i c o l o g y a n d p h a r m a c o l o g y 3 7 ( 2 0 1 4 ) 1040–1047
Fig. 2 – FE-SEM images of C. vulgaris treated by trifloxystrobin. (A): control; (B) 300 g L−1 group and (C): 600 g L−1 group.
4.
Discussion
The increased use of trifloxystrobin for the chemical control of pathogenic fungi might damage the biology of aquatic
systems. Furthermore, we observed a highlighted that process of algal growth and cell morphology under high exposure concentrations of trifloxystrobin. Our results demonstrated that micro-algal growth was significantly affected by trifloxystrobin in a concentration-dependent manner. Furthermore, cellular microstructure showed the potential negative effect of trifloxystrobin on C. vulgaris cells which may alter the membrane permeability and cause irreversible damage on the cellular membrane. This result may be debilitating and possibly fatal, albeit t high exposure concentrations. The membrane permeability change in the C. vulgaris cells may reflect substantial release of some cell contents. Thereby, exposure to trifloxystrobin at the initial high experimental concentrations would bring about abnormal physiological metabolism of algae cells, and finally may lead to cell apoptosis. The main reason responsible for oxidative imbalance in plants is the reduction of oxygen by surplus electrons that enter the photosynthetic electron transport chain (Asada et al., 1998). Considering these issues, three photosynthesisrelated genes and one energy-related gene were chosen for better understanding of the potential effects and mechanism of action in this study. In C. vulgaris, psaB encodes for the photosystem I (PSI) reaction center protein; psbC encodes for chlorophyll-protein complexes (CP43), acting as an integral membrane protein component of photo-system II (PSII); and rbcL encodes for the large subunit of one key enzyme in the Calvin Benson Basham cycle, catalyzing the first step in which CO2 is reductively assimilated into organic carbon (Qian et al., 2008a, b). The RT-qPCR results demonstrated that the psaB, psbC and rbcL genes were all decreased with exposure to trifloxystrobin during 48 and 96 h exposure periods. The abundance of the Rubisco (both carboxylase and oxygenase activities that control the rate-limiting step of carbon assimilation and photorespiration, respectively) gene transcripts was reduced in response to trifloxystrobin. The decrease resulted in a corresponding decrease in the amount of enzyme and its activity (Qian et al., 2008a, b). By decreasing the abundance of rbcL, blocking carbon assimilation and photorespiration, trifloxystrobin likely caused the accumulation of a mass of reducing equivalents. Hence, excess electrons can lead to decreased transcription of PSI and PSII genes. Additionally, the products of these genes mainly participate in electron transport and their inhibition may hinder electron transport and lead to decreased transcription of PSI and PSII genes and induce oxidative stress (Qian et al., 2012). This result was in accordance with the phenomenon of decrement of T-AOC level discussed below. Simultaneously, up-regulation of ATPs may suggest an abnormal balance between ATP and NADPH production, which is important to photosynthetic productivity (Kramer and Evans, 2011). However, we found that mRNA expression decreased with exposure concentration. This may possibly be due to algal cells in the lower exposure concentrations attempting to produce more NADPH. This finding was in agreement with the conclusion of Maltby et al. (2009) that the sensitivity of non-target organisms (fish, invertebrates, and primary producers) to fungicides can affect energy production. We also investigated that trifloxystrobin not only can change gene transcription at the molecular level but also
e n v i r o n m e n t a l t o x i c o l o g y a n d p h a r m a c o l o g y 3 7 ( 2 0 1 4 ) 1040–1047
1045
Fig. 3 – Expression of ATPs (A), psaB (B), psbC (C) and rbcL (D) genes in C. vulgaris exposed to 25, 50 and 100 g L−1 of trifloxystrobin for 48 and 96 h. Values were normalized against 18S rRNA as housekeeping gene and represent the relative mRNA expression (mean ± SEM) of three replicate. The mRNA level of the control group is expressed as 1. Values that were significantly different from the control are indicated by asterisks (one-way ANOVA, *p < 0.05; **p < 0.01).
bring about various physiological and biochemical changes in C. vulgaris. In the present study, we observed that total protein content decreased as exposure time and concentration. The decrease of protein content herein may be in response to an increase in membrane permeability, or explain the inhibition of protein synthesis by trifloxystrobin, to some extent. Protein as an important part of the organism, not only participates in the various kinds of physiological processes, but also acts as enzymes to facilitate the biochemical reactions in cell metabolism (Zhang et al., 2013). Hence, the content of soluble protein could reflect the activity of cell metabolism and extent of damage. The decrease of protein content herein might explain, to some extent, the inhibition of protein synthesis by azoxystrobin and kresoxim-methyl, with the potential to lead to a disorder of normal physiological metabolism functions in C. vulgaris cells. T-AOC, an integrated index, can reflect a comprehensive status of the defense system (Sun et al., 2009). Nowadays the T-AOC response was rarely investigated, though some studies report responses of antioxidants in algae exposed to environmental stresses (Li et al., 2006; Hong et al., 2009). Our result showed that T-AOC exposure decreased
in concentration-dependent manner during 48 and 96 h exposure periods. T-AOC reflects the health of plants (Li et al., 2011), and the decrease in T-AOC level suggested that the antioxidant protective system of C. vulgaris might be affected by trifloxystrobin. Furthermore, the activities of two antioxidant enzymes (SOD and POD) in time-dependent and concentration-dependent manner were revealed in our study. POD, present in almost all living organisms, uses various peroxides as electron acceptors to catalyze a number of oxidative reactions (Koua et al., 2009). SOD is responsible for counteracting the effects of ROS, particularly the superoxide ion (Van Rensburg et al., 1995), can indicate the protective system status in organisms. The up-regulation of POD and SOD levels can indicate potential protection against oxidative damage, initially increasing in C. vulgaris, which is commonly reported for a variety of environmental stresses (Geret and Bebianno, 2004). Prolonged exposure depletes antioxidant enzymes and oxidative stress may eventually result in cellular damage. Taken together, trifloxystrobin could weaken the antioxidant defense system and enhance oxidative stress to damage the C. vulgaris physiology, and this is a function of exposure concentration.
1046
e n v i r o n m e n t a l t o x i c o l o g y a n d p h a r m a c o l o g y 3 7 ( 2 0 1 4 ) 1040–1047
trifloxystrobin may affect the activity of antioxidant enzymes as well as increase oxidative stress, rendering C. vulgaris more vulnerable to oxidative damage. Thereby, there could be potential negative influences to unicellular green algae at the experimental concentrations tested.
Conflict of interest The authors declare that there are no conflicts of interest.
Acknowledgments This work was supported by the National Training Programs of Innovation and Entrepreneur ship for under graduates under Grant.
Appendix A. Supplementary data Supplementary material related to this article can be found, in the online version, at doi:10.1016/j.etap.2014.04.006.
references
Fig. 4 – Levels of total protein (A), SOD (B), POD (C) and T-AOC (D) in C. vulgaris exposed to different concentrations of trifloxystrobin. ANOVA is used to analyze the differences to control at 48 and 96 h. Asterisks represent statistically significant differences compared with the control (*p < 0.05; **p < 0.01; n = 3; bar = SEM).
5.
Conclusion
In conclusion, the present results showed potential toxic effect of trifloxystrobin on C. vulgaris by inhibition of algal growth, possibly altered cell membrane permeability, affected mRNA expression, and induced oxidative damage in a series of experimental concentrations. In this study trifloxystrobin damaged cellular structure at higher concentrations and reduced normal C. vulgaris photosynthesis-related gene expression. Among different physiological indicators measured,
Asada, K., Endo, T., Mano, J., Miyake, C., 1998. Molecular mechanism for relaxation of and protection from light stress. In: Sato, K., Murata, N. (Eds.), Stress Responses of Photosynthetic Organisms. Elsevier Science Publishing, Amsterdam, pp. 37–52. Bartlett, D.W., Clough, J.M., Godwin, J.R., Hall, A.A., Hamer, M., Parr-Dobrzanski, B., 2002. The strobilurin fungicides. Pest Manag. Sci. 58, 649–662. Belden, J., McMurry, S., Smith, L., Reilley, P., 2010. Acute toxicity of fungicide formulations to amphibians at environmentally relevant concentrations. Environ. Toxicol. Chem. 29, 2477–2480. Blaise, C., 1993. Practical laboratory applications with micro-algae for hazard assessment of aquatic contaminants. In: Ecotoxicology Monitoring. VCH Publishers, Weinheim, Germany, pp. 83–107. Blaise, C., Vasseur, P., 2005. Algal Microplate Toxicity Test. Small-Scale Freshwater Toxicity Investigations. Springer, pp. 137–179. Bradford, M.M., 1976. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. biochem. 72, 248–254. Deb, D., Engel, B.A., Harbor, J., Hahn, L., Lim, K.J., Zhai, T., 2010. Investigating potential water quality impacts of fungicides used to combat soybean rust in Indiana. Water, Air, Soil Pollut. 207, 273–288. Geret, F., Bebianno, M.J., 2004. Does zinc produce reactive oxygen species in Ruditapes decussatus? Ecotoxicol. Environ. Saf. 57, 399–409. ˇ ˇ Hnatova, M., Gbelska, Y., Obernauerova, M., Subíková, V., Subík, J., 2003. Cross-resistance to strobilurin fungicides in mitochondrial and nuclear mutants of Saccharomyces cerevisiae. Folia Microbiol. 48, 496–500. Hong, Y., Hu, H.Y., Xie, X., Sakoda, A., Sagehashi, M., Li, F.M., 2009. Gramine-induced growth inhibition, oxidative damage and antioxidant responses in freshwater cyanobacterium Microcystis aeruginosa. Aquat. Toxicol. 91, 262–269.
e n v i r o n m e n t a l t o x i c o l o g y a n d p h a r m a c o l o g y 3 7 ( 2 0 1 4 ) 1040–1047
Hooser, E.A., Belden, J.B., Smith, L.M., McMurry, S.T., 2012. Acute toxicity of three strobilurin fungicide formulations and their active ingredients to tadpoles. Ecotoxicology 21, 1458–1464. Hörnström, E., 1990. Toxicity test with algae – a discussion on the batch method. Ecotoxicol. Environ. Saf. 20, 343–353. Junges, C., Peltzer, P., Lajmanovich, R., Attademo, A., Cabagna Zenklusen, M., Basso, A., 2012. Toxicity of the fungicide trifloxystrobin on tadpoles and its effect on fish–tadpole interaction. Chemosphere 87, 1348–1354. Koua, D., Cerutti, L., Falquet, L., Sigrist, C.J., Theiler, G., Hulo, N., Dunand, C., 2009. PeroxiBase: a database with new tools for peroxidase family classification. Nucleic Acids Res. 37, 261–266. Kramer, D.M., Evans, J.R., 2011. The importance of energy balance in improving photosynthetic productivity. Plant Physiol. 155, 70–78. Krauss, R.W., 1953. Inorganic nutrition of algae Algal culture from laboratory to pilot plant. Carnegie Inst. Wash. Publ. 600, 85–102. Lewis, M.A., 1995. Use of freshwater plants for phytotoxicity testing: a review. Environ. Pollut. 87, 319–336. Li, D.D., Zhou, D.M., Wang, P., Weng, N.Y., Zhu, X.D., 2011. Subcellular Cd distribution and its correlation with antioxidant enzymatic activities in wheat (Triticum aestivum) roots. Ecotox. Environ. Safe. 74, 874–881. Li, M., Hu, C.W., Zhu, Q., Chen, L., Kong, Z.M., Liu, Z.L., 2006. Copper and zinc induction of lipid peroxidation and effects on antioxidant enzyme activities in the microalga Pavlova viridis (Prymnesiophyceae). Chemosphere 62, 565–572. Maltby, L., Brock, T.C., van den Brink, P.J., 2009. Fungicide risk assessment for aquatic ecosystems: importance of interspecific variation, toxic mode of action, and exposure regime. Environ. Sci. Technol. 43, 7556–7563. Mitchell, R.J., Myers, A.L., Mabury, S.A., Solomon, K.R., Sibley, P.K., 2011. Toxicity of fluorotelomer carboxylic acids to the algae Pseudokirchneriella subcapitata and Chlorella vulgaris, and the amphipod Hyalella azteca. Ecotoxicol. Environ. Saf. 74, 2260–2267. Morrison, S.A., Mcmurry, S.T., Smith, L.M., Belden, J.B., 2013. Acute toxicity of pyraclostrobin and trifloxystrobin to Hyalella azteca. Environ. Toxicol. Chem. 32, 1516–1525.
1047
Moss, B., 1973. The influence of environmental factors on the distribution of freshwater algae: an experimental study: II. The role of pH and the carbon dioxide-bicarbonate system. J. Ecol., 157–177. Qian, H., Chen, W., Sheng, G.D., Xu, X., Liu, W., Fu, Z., 2008a. Effects of glufosinate on antioxidant enzymes, subcellular structure, and gene expression in the unicellular green alga Chlorella vulgaris. Aquat. Toxicol. 88, 301–307. Qian, H.F., Li, J., Pan, X.J., Chen, J., Zhou, D.M., Chen, Z.G., Zhang, L., Fu, Z.W., 2012. Analyses of gene expression and physiological changes in Microcystis aeruginosa reveal the phytotoxicities of three environmental pollutants. Ecotoxicology 3, 847–859. Qian, H.F., Sheng, G.D., Liu, W., Lu, Y., Liu, Z., Fu, Z., 2008b. Inhibitory effects of atrazine on Chlorella vulgaris as assessed by real-time polymerase chain reaction. Environ. Toxicol. Chem. 27, 182–187. Ramakrishnan, B., Megharaj, M., Venkateswarlu, K., Naidu, R., Sethunathan, N., 2010. The impacts of environmental pollutants on microalgae and cyanobacteria. Crit. Rev. Environ. Sci. Tecnol. 40, 699–821. Rippka, R., 1972. Photoheterotrophy and chemoheterotrophy among unicellular blue-green algae. Arch. Mikrobiol. 87, 93–98. Sun, D.Q., Li, A.W., Li, J., Li, D.G., Li, Y.X., Feng, H., Gong, M.G., 2009. Changes of lipid peroxidation in carbon disulfide-treated rat nerve tissues and serum. Chem. Biol. Interact. 179, 110–117. Tate, J.J., Gutierrez-Wing, M.T., Rusch, K.A., Benton, M.G., 2012. Gene expression analysis of a Louisiana native Chlorella vulgaris (Chlorophyta)/Leptolyngbya sp (Cyanobacteria) co-culture using suppression subtractive hybridization. Eng. Life Sci. 13, 185–193. Van Rensburg, S., Carstens, M., Potocnik, F., Van Der Spuy, G., Van Der Walt, B., Taljaard, J., 1995. Transferrin C2 and Alzheimer’s disease: another piece of the puzzle found? Med. Hypotheses 44, 268–272. Zhang, C., Yi, Y.L., Hao, K., Liu, G.L., Wang, G.X., 2013. Algicidal activity of Salvia miltiorrhiza Bung on Microcystis aeruginosa – towards identification of algicidal substance and determination of inhibition mechanism. Chemosphere 93, 997–1004.
