Journal of Medical Virology
Potential Roles of Placental Human Beta-Defensin-3 and Apolipoprotein B mRNA-editing Enzyme Catalytic Polypeptide 3G in Prevention of Intrauterine Transmission of Hepatitis B Virus Xiaoxia Bai, Ting Tian, Peng Wang, Xiaofu Yang, Zhengping Wang, and Minyue Dong* Women’s Hospital, School of Medicine, Zhejiang University, Hangzhou, Zhejiang Province, China
Approximately 5% of newborns were infected by hepatitis B virus (HBV) via intrauterine transmission and this is the main reason for high prevalence of HBV in endemic regions. However, the mechanisms by which intrauterine transmission is avoided in most cases remain elusive and placental natural anti-microbial factors may play a role in the prevention of HBV intrauterine transmission. The expression levels of human b-defensin-3 (HBD3), apolipoprotein B mRNA-editing enzyme catalytic polypeptide 3G (A3G) and mannose binding lectin (MBL) were determined in the placenta of 30 HBV-seronegative pregnant women (controls), 7 HBV-seropositive pregnant women with infants infected via intrauterine transmission (infected group) and 30 HBVseropositive pregnant women with non-infected infants (non-infected group). The expression of HBD-3, A3G, and MBL of placental trophoblast cell line Swan71 was determined after exposed to HBV. There were significant differences in placental HBD-3 and A3G levels among three groups, but the expression of MBL did not significantly differ. The expressions of HBD-3 and A3G were higher in noninfected group than controls and infected group, but not significantly different between infected group and controls. The exposure to HBV increased significantly the expression of HBD-3, A3G, and MBL by Swan 71. It may be concluded HBV up-regulates HBD-3 and A3G expression in vivo and in vitro in placental trophoblast and lack of this up-regulation is possibly associated with intrauterine transmission of HBV. J. Med. Virol. # 2014 Wiley Periodicals, Inc.
KEY WORDS:
apolipoprotein B mRNA-editing enzyme catalytic polypeptide 3G (A3G); hepatitis B virus;
C 2014 WILEY PERIODICALS, INC.
human b-defensin-3 (HBD-3); intrauterine transmission; pregnancy
INTRODUCTION Hepatitis B virus (HBV) infection is a serious public health problem worldwide. It is estimated that over 350 million people worldwide are infected chronically with HBV, of whom almost one million die annually from HBV-related diseases, such as liver cirrhosis and hepatocellular carcinoma [Lavanchy, 2004]. Motherto-child transmission plays an important role in the endemicity of HBV, and it is the major reason for the high prevalence of HBV infection in endemic regions. Intrauterine infection is one of the important routes for the Mother-to-child transmission of HBV, and the rate of intrauterine infection of HBV is estimated to be 5–10% [Guo et al., 2013]. Although the mechanisms by which HBV translocates across placental barrier and infects the fetus remain unknown, in vivo and in vitro observations provided sound evidence that HBV infects trophoblast [Bai et al., 2007; Bhat Abbreviations: HBV, hepatitis B virus; HBD-3, human bdefensin-3; APOBEC, apolipoprotein B mRNA-editing enzyme catalytic polypeptide; A3G, apolipoprotein B mRNA-editing enzyme catalytic polypeptide 3G; APOBEC, apolipoprotein B mRNA-editing enzyme catalytic polypeptide 3G; MBL, mannose binding lectin Grant sponsor: Natural Science Foundation of Zhejiang Province; Grant number: Y2100416.; Grant sponsor: Natural Science Foundation of China; Grant number: 81300501. Correspondence to: Minyue Dong, MD/PhD, Women’s Hospital, School of Medicine, Zhejiang University, 1 Xueshi Road, Hangzhou, Zhejiang Province, 310006, China. E-mail: [email protected] Accepted 13 August 2014 DOI 10.1002/jmv.24072 Published online in Wiley Online Library (wileyonlinelibrary.com).
2
Bai et al.
and Anderson, 2007]. The infection of HBV to trophoblsast is the first and most important step of intrauterine infection of HBV. On the other hand, the placenta is the specific component of innate immune system and comprises mechanical and immunological barrier restricting microbes to access the fetus [Guleria and Pollard, 2000]. Recently, it has been shown that primary placental trophoblasts are more resistant to virus infection than non-trophoblastic cells [Delorme-Axford et al., 2013]. The mechanisms by which placental trophoblast combats virus need elucidating. However, antiviral innate immune system is crucial at the maternal–fetal interface where vertical transmission of virus from maternal blood to the fetus occurs. Natural anti-microbials are key mediators of innate immune system, and human defensins and Apolipoprotein B mRNA-editing enzyme catalytic polypeptide (APOBEC) are important members of natural anti-microbial peptides. Human b-defensin-3 (HBD-3), a member of defensin family, is abundantly expressed in placenta [Maisetta et al., 2003; Chen et al., 2006] and inhibits HIV infection and replication [Quinones-Mateu et al., 2003; Weinberg et al., 2006], while apolipoprotein B mRNAediting enzyme catalytic polypeptide (APOBEC3G or A3G), a member of APOBEC superfamily expressed by placental trophoblast [Abrahams et al., 2006], possesses antiviral activity against a broad range of viruses including HBV [Harris and Liddament, 2004; Lei et al., 2006; Noguchi et al., 2007]. However, the roles of HBD-3 and A3G in preventing intrauterine HBV transmission have never been elucidated. On the basis of their expression in placenta and their antiviral property, we hypothesized that placental HBD-3 and A3G play a role in preventing intrauterine transmission of HBV. To verify this hypothesis, mRNA expression of HBD-3 and A3G was determined in the placenta of pregnant women whose fetuses were infected via intrauterine transmission, placenta of pregnant women whose fetuses were not infected, and placenta of normal pregnant women. And then, the response of trophoblast cells to HBV regarding mRNA expression of HBD-3 and A3G was observed. The possible role of placental mannose binding lectin (MBL), a pattern
recognition molecule, in intrauterine transmission of HBV was also explored. MATERIALS AND METHODS Subjects Seven HBV carrier women whose infants were found to be infected by the intrauterine route composed infected group (infected) and 30 women of chronic HBV carrier whose neonates were not infected comprised non-infected group (non-infected). In addition, 30 HBV seronegative pregnant women served as controls. There were no significant differences in maternal age (P ¼ 0.675), gestational age at delivery (P ¼ 0.251), maternal body weight (P ¼ 0.933), neonatal birth weight (P ¼ 0.138), and neonatal gender (P ¼ 0.303) among three groups (Table I). Maternal HBV–DNA load (P ¼ 0.306) and the prevalence of HBeAg (P ¼ 0.606) were not significantly different between infected and non-infected groups. HBV DNA was negative in non-infected neonates but positive (ranging from 2,400 to 25,700 copies/ml) in infected neonates. Chronic maternal HBV infection was diagnosed on the basis of the seropositive hepatitis B surface antigen (HBsAg), the presence of HBV DNA in maternal serum, normal liver tests and absence of symptoms of acute hepatitis during pregnancy. Intrauterine infection of HBV was defined as the seropositive HBsAg and the presence of HBV DNA in serum of neonates taken on the third days of delivery. To exclude the possible effects of labor on the intrauterine transmission of HBV, only mothers with selective Cesarean section were included. The indication for selective cesarean section was history of caesarean delivery, macrosomia, breech presentation, cephalopelvic disproportion or maternal request. All subjects were negative for serum markers of hepatitis A, C, and E. Exclusion criteria included acute HBV infection, presence of pregnancy complications (such as preterm labor, preterm rupture of membrane, and pre-eclampsia), fetal distress, auto-immune diseases, abnormal liver and kidney tests, human immunodeficiency virus (HIV), syphilis, infectious diseases, and other diseases.
TABLE I. Clinical Data
N Maternal age (year) Gestational age (year) Maternal body weight (kg) Primiparity Neonatal birth weight (g) Neonatal gender (F/M) Maternal HBsAg (þ) Maternal HBeAg (þ) Maternal DNA level (106 copies) J. Med. Virol. DOI 10.1002/jmv
Control
Non-infected
Infected
P
30 29.13 3.08 39.03 1.13 70.07 6.39 29 3510 397 15/15 0 0 —
30 28.40 2.88 38.70 0.79 70.62 8.65 27 3397 438 19/11 30 18 62.5 (22.6, 170.3)
7 28.86 4.85 38.43 1.27 69.57 8.56 5 3164 430 3/4 7 4 67.8 (27.4, 159.0)
0.675 0.251 0.933 0.105 0.138 0.303 — 0.606 0.306
Placental A3G and HBD-3 May Play a Role in HBV Transmission
Standard passive and active immunoprophylaxis strategy was provided for all infants born to HBVpositive mothers. Vaccination strategy included the administration of 100 IU HBI g (human hepatitis B immunoglobulin) and HBV vaccine (5 mg) within 12 hr of birth. Vaccination series were later completed with two additional doses of HBV vaccine (one at 4 weeks of age and one at 6 month of age). The protocol of the current investigation was approved by the Ethics Committee of Women’s Hospital, School of Medicine, Zhejiang University and the informed consents were obtained from all the participants. Sample Collection For the assay of HBV markers, maternal blood samples were taken at the admission to hospital, and neonatal blood samples on the third day after delivery. Blood samples were centrifuged at 1500g for 15 min after standing for at least 30 min in room temperature and serum was separated. For trophoblast response test, blood samples were taken from high-level HBV carriers (HBV DNA > 1.0 108 copies/ml) with normal liver function test and healthy volunteers with a negative serum HBV marker and serum were separated aseptically. A 0.22 mm filtration device (Corning, Glendale, CA) was used for further sterilization. The complement was inactivated at 56C for 30 min and serum was stored at 80˚C until assay. Placental samples were collected immediately after the placentas were delivered. Placental cotyledons were dissected at middle zone, washed thoroughly with ice-cold normal saline after amniotic membranes, deciduas, and connective tissues were removed. They were snap-frozen with liquid-nitrogen, and then stored at 80˚C until assay.
3
(corresponding to approximately 100 viral genomes equivalent/cell). After 48 hr of incubation, cells were then washed three times with PBS, trypsinized, and collected after extensively washed. Assays Serum markers of hepatitis A, B, C, and E including HAV IgM, HBsAg, HBeAg, anti-HBc, anti-HBe, HCV IgG, and HEV IgM were routinely detected with ELISA (Sino-American Biotechnology, Beijing, China) and HBV DNA with real-time PCR (Zhongshan University DaAn Gene Company, Zhongshan, China). Total RNA was isolated from placental tissue and trophoblastic cells by using the Trizol RNA reagent (Invitrogen Life Technologies, Carlsbad, CA). Reverse transcription was performed with random primers using PrimeScript RT reagent kit (Takara Bio, Tokyo, Japan). The RNA and cDNA samples were stored at 80˚C. The primers were designed by using an online program BatchPrimer3 (USDA, Albany, NY) and the sequences of primers of HBD3, A3G, MBL, and the internal control genes are listed in Table II. All primers were synthesized by Shanghai Sangon Biological Engineering Technology (Shanghai, China). Real-time PCR was performed on the ABI7900 HT Fast Real-Time PCR System (Applied Biosystems, Carlsbad, CA) using the SYBR Premix EXTaq (Takara Bio, Tokyo, Japan) according to the manufacturer’s instructions. Thermal cycling conditions included pre-incubation at 95˚C for 10 min followed by 40 cycles of 95˚C for 15 sec, 60˚C for 30 sec, 72˚C for 10 sec. LightCycler collected data automatically and analyzed the value of threshold cycle (Ct). All PCR reactions were performed in triplicate. The changes of A3G, MBL, and HBD3 mRNA expression were presented and compared in 2DDCt method.
Cell Culture Placental trophoblast cell lineage Swan 71 was cultured in DMEM/F12 medium supplemented with 10% fetal bovine serum and antibiotics (penicillin 100 U/ml and streptomycin 100 mg/ml) at 37˚C/5% CO2. Cells were seeded at a concentration of 2 105 cells/ml in tissue culture dishes and cultured overnight and then the medium was changed. When the cells reached a confluence of 50%–60%, serum containing high quantity of HBV was added
Statistical Analysis Data distribution was tested with Kolmogorov– Smirnov test and data were presented in mean and SD or median and quartiles according to their distribution. Significance was tested with one-way ANOVA, Mann–Whitney test, Student t test or Chisquare test. SPSS statistic package (SPSS Company, Chicago, IL) was used for data analysis.
TABLE II. Sequences of Primers Gene
Sequence of primers
Length of product (bp)
A3G
Forward: GCTGTGCTTCCTGGACGTGA Reverse: GGTGGTCCACAAAGGTGTCCC Forward: AGCTCTGCCTTACCATTGGGTTC Reverse: TCCAGCCACAGCTGCAATTC Forward: CCACTTGAGACAGCACTATGTAGGA Reverse: GACAGCCCAGAAACAGACACAC Forward: AGAAAATCTGGCACCACACC Reverse: TAGCACAGCCTGGATAGCAA
284
HBD3 MBL b-Actin
140 111 173
J. Med. Virol. DOI 10.1002/jmv
4
Bai et al.
Fig. 1. Comparison of placental expression of HBD-3, A3G, and MBL. There were significant differences in placental mRNA expression of A3G (F ¼ 4.716, P ¼ 0.014) and HBD-3 (F ¼ 4.958, P ¼ 0.003) among the three groups. The expression of MBL did not significantly differ (F ¼ 2.064, P ¼ 0.135). The expression levels of A3G mRNA were significantly higher in non-infected group than those of control group and infected group (P ¼ 0.007 and P ¼ 0.043, respectively), however, were not significantly different between infected group and control group (P ¼ 0.975). The expression levels of HBD-3 mRNA were significantly higher in non-infected group than those of control group (P ¼ 0.003), however, were not significantly different between infected group and infected group or control group (P ¼ 0.119 and P ¼ 0.240).
RESULTS As shown in Figure 1, there were significant differences in placental mRNA expression of A3G (F ¼ 4.716, P ¼ 0.014) and HBD-3 (F ¼ 4.958, P ¼ 0.003) among the three groups, but the expression of MBL did not significantly differ (F ¼ 2.064, P ¼ 0.135). The expression levels A3G mRNA were significantly higher in non-infected group than controls and infected group (P ¼ 0.007 and P ¼ 0.043, respectively), however, were not significantly different between controls and infected groups (P ¼ 0.975). The expression levels of HBD-3 mRNA were significantly higher in non-infected group than controls (P ¼ 0.003), however, were not significantly different between infected group and noninfected group (P ¼ 0.119) and between infected group and controls (P ¼ 0.240). To determine if HBV induced the expression of HBD-3, A3G, and MBL, Swan71 cells were cultured in the presence (HBV-exposure) or absence (control) of HBV and the expression of HBD-3, A3G, and MBL mRNA was detected. There was an significant increase in the expression of A3G (P < 0.001), HBD-3 (P ¼ 0.0419), and MBL (P ¼ 0.0236) when trophoblast cells were exposed to HBV compare to control (Fig. 2), suggesting trophoblast cells recognize and respond to HBV and up-regulate the expression of anti-microbial peptides. DISCUSSION In the current investigation, it was found that placental expression of HBD-3 and A3G was markedly increased in HBV carrier women and the exposure to HBV enhanced HBD-3 and A3G expression by trophoblastic cell Swan 71, indicating that HBV upregulates HBD-3 and A3G expression of placental trophoblast in vivo and in vitro. It was also shown J. Med. Virol. DOI 10.1002/jmv
Fig. 2. Change of expression of A3G, HBD-3 and MBL by trophoblast after exposed to HBV. The mRNA levels of A3G, HBD-3, and MBL were significantly higher (P < 0.001, P ¼ 0.0419, and P ¼ 0.0236, respectively) in HBV-exposed cells than control.
that the increase in the expression of A3G was absent in the placenta of women whose infants were infected via intrauterine route, implying this is associated with intrauterine infection of HBV. Given that placenta is the pregnancy-specific component of innate immune system [Guleria and Pollard, 2000; Abrahams et al., 2006] and anti-microbials is important part of this component [Noguchi et al., 2007], the findings in this study suggest that the immune response to HBV by placental trophoblast is central in preventing intrauterine infection of HBV and upregulation of A3G and HBD-3 expression may be part of the immune response to HBV infection. Placenta is the pregnancy-specific organ and covered with a layer of trophoblast cells consisting of syncytiotrophoblasts and cytotrophoblasts. The syncytiotrophoblast constitutes the maternal–fetal barrier. Guleria et al. [Guleria and Pollard, 2000] found that trophoblast synthesized the neutrophil chemoattractants and macrophage inflammatory protein (MIP)-2 to recruit neutrophils to the site of listerial (a Grampositive intracellular bacterium) infection at the maternal–fetal interface and proposed that placenta is the pregnancy-specific component innate immune system and placental trophoblast functions as macrophage in recognizing and responding to pathogens. Natural anti-microbials expressed by trophoblast including HBD-3, A3G, and MBL are among the mediators of this innate immune component. APOBEC3G (A3G) is a single-stranded DNA cytidine deaminase targeting a wide range of virus including human HBV [Lei et al., 2006] and inhibits HBV replication in vitro and in vivo through deamination-dependent and -independent mechanisms [Lei et al., 2006; Nguyen et al., 2007; Nguyen and Hu, 2008]. However, no publications are available describing the role and mechanisms of placental APOBEC3G in the prevention of intrauterine transmission of HBV. It is reported that first-trimester
Placental A3G and HBD-3 May Play a Role in HBV Transmission
trophoblast cells produce interferon-b (IFN-b) and APOBEC3G following stimulation with Poly (I:C) through engagement of TLR-3[Abrahams et al., 2006]. Further studies are needed to clarify the mechanisms A3G is involved in the prevention of intrauterine infection of HBV. HBD-3 is an important component of both innate immunity and adaptive immunity exhibiting anti-microbial activities [Harris and Liddament, 2004]. The antiviral property of HBD-3 has been widely discussed, mostly in HIV infection. It is reported that expression of HBD3 is induced by several viruses and regulated by cytokines such as tumor-necrosis factor (TNF) and IL1b [Duits et al., 2003; Ganz, 2003; Sorensen et al., 2005]. However, the study describing the involvement of HBD-3 in the prevention of HBV infection is scanty. Herein, this study reports primary evidence that HBD-3 has a role in preventing intrauterine transmission of HBV, but detailed role and mechanisms need investigating, although the difference did not reach significance between non-infected and infected groups. The absence of the difference in HBD-3 is due mainly to the small sample size of infected group. MBL is a pattern recognition molecule and is central in recognizing and responding to pathogens including HBV. It has been revealed that MBL polymorphisms that confer low levels of MBL are correlated with poor prognoses such as HBV persistence [Thio et al., 2005], disease progression [Yuen et al., 1999; Song le et al., 2003; Chong et al., 2005]. It was shown that low fetal MBL is associated with intrauterine infection of HBV [Wu et al., 2013]. In this study, it was found HBV in vitro up-regulated MBL expression of trophoblast but the expression of placental MBL did not significantly differ among noninfected, infected, and control groups. These findings make uncertainty of MBL in preventing intrauterine HBV transmission and request further studies. The main limitations included the current investigation was observational and the mechanisms by which these factors are involved in the prevention of intrauterine transmission of HBV remain unclear. CONCLUSIONS It was demonstrated that maternal HBV infection induces an increase in placental HBD-3 and A3G levels and the absence of these increases are possibly associated with intrauterine infection of HBV, suggesting that HBD-3 and A3G produced by placenta may play an important role in preventing intrauterine transmission of HBV. REFERENCES Abrahams VM, Schaefer TM, Fahey JV, Visintin I, Wright JA, Aldo PB, Romero R, Wira CR, Mor G. 2006. Expression and secretion of antiviral factors by trophoblast cells following stimulation by the TLR-3 agonist, Poly(I: C). Hum Reprod 21:2432–2439. Bai H, Zhang L, Ma L, Dou XG, Feng GH, Zhao GZ. 2007. Relationship of hepatitis B virus infection of placental barrier
5
and hepatitis B virus intra-uterine transmission mechanism. World J Gastroenterol 13:3625–3630. Bhat P, Anderson DA. 2007. Hepatitis B virus translocates across a trophoblastic barrier. J Virol 81:7200–7207. Chen H, Xu Z, Peng L, Fang X, Yin X, Xu N, Cen P. 2006. Recent advances in the research and development of human defensins. Peptides 27:931–940. Chong WP, To YF, Ip WK, Yuen MF, Poon TP, Wong WH, Lai CL, Lau YL. 2005. Mannose-binding lectin in chronic hepatitis B virus infection. Hepatology 42:1037–1045. Delorme-Axford E, Donker RB, Mouillet JF, Chu T, Bayer A, Ouyang Y, Wang T, Stolz DB, Sarkar SN, Morelli AE, Sadovsky Y, Coyne CB. 2013. Human placental trophoblasts confer viral resistance to recipient cells. Proc Natl Acad Sci U S A 110:12048–12053. Duits LA, Nibbering PH, van Strijen E, Vos JB, MannesseLazeroms SP, van Sterkenburg MA, Hiemstra PS. 2003. Rhinovirus increases human beta-defensin-2 and -3 mRNA expression in cultured bronchial epithelial cells. FEMS Immunol Med Microbiol 38:59–64. Ganz T. 2003. Defensins: Antimicrobial peptides of innate immunity. Nat Rev Immunol 3:710–720. Guleria I, Pollard JW. 2000. The trophoblast is a component of the innate immune system during pregnancy. Nat Med 6:589–593. Guo Z, Shi XH, Feng YL, Wang B, Feng LP, Wang SP, Zhang YW. 2013. Risk factors of HBV intrauterine transmission among HBsAg-positive pregnant women. J Viral Hepat 20:317–321. Harris RS, Liddament MT. 2004. Retroviral restriction by APOBEC proteins. Nat Rev Immunol 4:868–877. Lavanchy D. 2004. Hepatitis B virus epidemiology, disease burden, treatment, and current and emerging prevention and control measures. J Viral Hepat 11:97–107. Lei YC, Hao YH, Zhang ZM, Tian YJ, Wang BJ, Yang Y, Zhao XP, Lu MJ, Gong FL, Yang DL. 2006. Inhibition of hepatitis B virus replication by APOBEC3G in vitro and in vivo. World J Gastroenterol 12:4492–4497. Maisetta G, Batoni G, Esin S, Luperini F, Pardini M, Bottai D, Florio W, Giuca MR, Gabriele M, Campa M. 2003. Activity of human beta-defensin 3 alone or combined with other antimicrobial agents against oral bacteria. Antimicrob Agents Chemother 47:3349–3351. Nguyen DH, Gummuluru S, Hu J. 2007. Deamination-independent inhibition of hepatitis B virus reverse transcription by APOBEC3G. J Virol 81:4465–4472. Nguyen DH, Hu J. 2008. Reverse transcriptase- and RNA packaging signal-dependent incorporation of APOBEC3G into hepatitis B virus nucleocapsids. J Virol 82:6852–6861. Noguchi C, Hiraga N, Mori N, Tsuge M, Imamura M, Takahashi S, Fujimoto Y, Ochi H, Abe H, Maekawa T, Yatsuji H, Shirakawa K, Takaori-Kondo A, Chayama K. 2007. Dual effect of APOBEC3G on Hepatitis B virus. J Gen Virol 88:432–440. Quinones-Mateu ME, Lederman MM, Feng Z, Chakraborty B, Weber J, Rangel HR, Marotta ML, Mirza M, Jiang B, Kiser P, Medvik K, Sieg SF, Weinberg A. 2003. Human epithelial betadefensins 2 and 3 inhibit HIV-1 replication. AIDS 17:F39–48. Song le H, Binh VQ, Duy DN, Juliger S, Bock TC, Luty AJ, Kremsner PG, Kun JF. 2003. Mannose-binding lectin gene polymorphisms and hepatitis B virus infection in Vietnamese patients. Mutat Res 522:119–125. Sorensen OE, Thapa DR, Rosenthal A, Liu L, Roberts AA, Ganz T. 2005. Differential regulation of beta-defensin expression in human skin by microbial stimuli. J Immunol 174:4870–4879. Thio CL, Mosbruger T, Astemborski J, Greer S, Kirk GD, O’Brien SJ, Thomas DL. 2005. Mannose binding lectin genotypes influence recovery from hepatitis B virus infection. J Virol 79:9192– 9196. Weinberg A, Quinones-Mateu ME, Lederman MM. 2006. Role of human beta-defensins in HIV infection. Adv Dent Res 19:42–48. Wu Y, Zhou Q, Wang H, Tian T, Zhu Q, Bai X, Yang X, Wang Z, Dong M. 2013. Potential role of mannose-binding lectin in intrauterine transmission of hepatitis B virus. Jpn J Infect Dis 66:391–393. Yuen MF, Lau CS, Lau YL, Wong WM, Cheng CC, Lai CL. 1999. Mannose binding lectin gene mutations are associated with progression of liver disease in chronic hepatitis B infection. Hepatology 29:1248–1251.
J. Med. Virol. DOI 10.1002/jmv
Potential Roles of Placental Human Beta-Defensin-3 and Apolipoprotein B mRNA-editing Enzyme Catalytic Polypeptide 3G in Prevention of Intrauterine Transmission of Hepatitis B Virus Xiaoxia Bai, Ting Tian, Peng Wang, Xiaofu Yang, Zhengping Wang, and Minyue Dong* Women’s Hospital, School of Medicine, Zhejiang University, Hangzhou, Zhejiang Province, China
Approximately 5% of newborns were infected by hepatitis B virus (HBV) via intrauterine transmission and this is the main reason for high prevalence of HBV in endemic regions. However, the mechanisms by which intrauterine transmission is avoided in most cases remain elusive and placental natural anti-microbial factors may play a role in the prevention of HBV intrauterine transmission. The expression levels of human b-defensin-3 (HBD3), apolipoprotein B mRNA-editing enzyme catalytic polypeptide 3G (A3G) and mannose binding lectin (MBL) were determined in the placenta of 30 HBV-seronegative pregnant women (controls), 7 HBV-seropositive pregnant women with infants infected via intrauterine transmission (infected group) and 30 HBVseropositive pregnant women with non-infected infants (non-infected group). The expression of HBD-3, A3G, and MBL of placental trophoblast cell line Swan71 was determined after exposed to HBV. There were significant differences in placental HBD-3 and A3G levels among three groups, but the expression of MBL did not significantly differ. The expressions of HBD-3 and A3G were higher in noninfected group than controls and infected group, but not significantly different between infected group and controls. The exposure to HBV increased significantly the expression of HBD-3, A3G, and MBL by Swan 71. It may be concluded HBV up-regulates HBD-3 and A3G expression in vivo and in vitro in placental trophoblast and lack of this up-regulation is possibly associated with intrauterine transmission of HBV. J. Med. Virol. # 2014 Wiley Periodicals, Inc.
KEY WORDS:
apolipoprotein B mRNA-editing enzyme catalytic polypeptide 3G (A3G); hepatitis B virus;
C 2014 WILEY PERIODICALS, INC.
human b-defensin-3 (HBD-3); intrauterine transmission; pregnancy
INTRODUCTION Hepatitis B virus (HBV) infection is a serious public health problem worldwide. It is estimated that over 350 million people worldwide are infected chronically with HBV, of whom almost one million die annually from HBV-related diseases, such as liver cirrhosis and hepatocellular carcinoma [Lavanchy, 2004]. Motherto-child transmission plays an important role in the endemicity of HBV, and it is the major reason for the high prevalence of HBV infection in endemic regions. Intrauterine infection is one of the important routes for the Mother-to-child transmission of HBV, and the rate of intrauterine infection of HBV is estimated to be 5–10% [Guo et al., 2013]. Although the mechanisms by which HBV translocates across placental barrier and infects the fetus remain unknown, in vivo and in vitro observations provided sound evidence that HBV infects trophoblast [Bai et al., 2007; Bhat Abbreviations: HBV, hepatitis B virus; HBD-3, human bdefensin-3; APOBEC, apolipoprotein B mRNA-editing enzyme catalytic polypeptide; A3G, apolipoprotein B mRNA-editing enzyme catalytic polypeptide 3G; APOBEC, apolipoprotein B mRNA-editing enzyme catalytic polypeptide 3G; MBL, mannose binding lectin Grant sponsor: Natural Science Foundation of Zhejiang Province; Grant number: Y2100416.; Grant sponsor: Natural Science Foundation of China; Grant number: 81300501. Correspondence to: Minyue Dong, MD/PhD, Women’s Hospital, School of Medicine, Zhejiang University, 1 Xueshi Road, Hangzhou, Zhejiang Province, 310006, China. E-mail: [email protected] Accepted 13 August 2014 DOI 10.1002/jmv.24072 Published online in Wiley Online Library (wileyonlinelibrary.com).
2
Bai et al.
and Anderson, 2007]. The infection of HBV to trophoblsast is the first and most important step of intrauterine infection of HBV. On the other hand, the placenta is the specific component of innate immune system and comprises mechanical and immunological barrier restricting microbes to access the fetus [Guleria and Pollard, 2000]. Recently, it has been shown that primary placental trophoblasts are more resistant to virus infection than non-trophoblastic cells [Delorme-Axford et al., 2013]. The mechanisms by which placental trophoblast combats virus need elucidating. However, antiviral innate immune system is crucial at the maternal–fetal interface where vertical transmission of virus from maternal blood to the fetus occurs. Natural anti-microbials are key mediators of innate immune system, and human defensins and Apolipoprotein B mRNA-editing enzyme catalytic polypeptide (APOBEC) are important members of natural anti-microbial peptides. Human b-defensin-3 (HBD-3), a member of defensin family, is abundantly expressed in placenta [Maisetta et al., 2003; Chen et al., 2006] and inhibits HIV infection and replication [Quinones-Mateu et al., 2003; Weinberg et al., 2006], while apolipoprotein B mRNAediting enzyme catalytic polypeptide (APOBEC3G or A3G), a member of APOBEC superfamily expressed by placental trophoblast [Abrahams et al., 2006], possesses antiviral activity against a broad range of viruses including HBV [Harris and Liddament, 2004; Lei et al., 2006; Noguchi et al., 2007]. However, the roles of HBD-3 and A3G in preventing intrauterine HBV transmission have never been elucidated. On the basis of their expression in placenta and their antiviral property, we hypothesized that placental HBD-3 and A3G play a role in preventing intrauterine transmission of HBV. To verify this hypothesis, mRNA expression of HBD-3 and A3G was determined in the placenta of pregnant women whose fetuses were infected via intrauterine transmission, placenta of pregnant women whose fetuses were not infected, and placenta of normal pregnant women. And then, the response of trophoblast cells to HBV regarding mRNA expression of HBD-3 and A3G was observed. The possible role of placental mannose binding lectin (MBL), a pattern
recognition molecule, in intrauterine transmission of HBV was also explored. MATERIALS AND METHODS Subjects Seven HBV carrier women whose infants were found to be infected by the intrauterine route composed infected group (infected) and 30 women of chronic HBV carrier whose neonates were not infected comprised non-infected group (non-infected). In addition, 30 HBV seronegative pregnant women served as controls. There were no significant differences in maternal age (P ¼ 0.675), gestational age at delivery (P ¼ 0.251), maternal body weight (P ¼ 0.933), neonatal birth weight (P ¼ 0.138), and neonatal gender (P ¼ 0.303) among three groups (Table I). Maternal HBV–DNA load (P ¼ 0.306) and the prevalence of HBeAg (P ¼ 0.606) were not significantly different between infected and non-infected groups. HBV DNA was negative in non-infected neonates but positive (ranging from 2,400 to 25,700 copies/ml) in infected neonates. Chronic maternal HBV infection was diagnosed on the basis of the seropositive hepatitis B surface antigen (HBsAg), the presence of HBV DNA in maternal serum, normal liver tests and absence of symptoms of acute hepatitis during pregnancy. Intrauterine infection of HBV was defined as the seropositive HBsAg and the presence of HBV DNA in serum of neonates taken on the third days of delivery. To exclude the possible effects of labor on the intrauterine transmission of HBV, only mothers with selective Cesarean section were included. The indication for selective cesarean section was history of caesarean delivery, macrosomia, breech presentation, cephalopelvic disproportion or maternal request. All subjects were negative for serum markers of hepatitis A, C, and E. Exclusion criteria included acute HBV infection, presence of pregnancy complications (such as preterm labor, preterm rupture of membrane, and pre-eclampsia), fetal distress, auto-immune diseases, abnormal liver and kidney tests, human immunodeficiency virus (HIV), syphilis, infectious diseases, and other diseases.
TABLE I. Clinical Data
N Maternal age (year) Gestational age (year) Maternal body weight (kg) Primiparity Neonatal birth weight (g) Neonatal gender (F/M) Maternal HBsAg (þ) Maternal HBeAg (þ) Maternal DNA level (106 copies) J. Med. Virol. DOI 10.1002/jmv
Control
Non-infected
Infected
P
30 29.13 3.08 39.03 1.13 70.07 6.39 29 3510 397 15/15 0 0 —
30 28.40 2.88 38.70 0.79 70.62 8.65 27 3397 438 19/11 30 18 62.5 (22.6, 170.3)
7 28.86 4.85 38.43 1.27 69.57 8.56 5 3164 430 3/4 7 4 67.8 (27.4, 159.0)
0.675 0.251 0.933 0.105 0.138 0.303 — 0.606 0.306
Placental A3G and HBD-3 May Play a Role in HBV Transmission
Standard passive and active immunoprophylaxis strategy was provided for all infants born to HBVpositive mothers. Vaccination strategy included the administration of 100 IU HBI g (human hepatitis B immunoglobulin) and HBV vaccine (5 mg) within 12 hr of birth. Vaccination series were later completed with two additional doses of HBV vaccine (one at 4 weeks of age and one at 6 month of age). The protocol of the current investigation was approved by the Ethics Committee of Women’s Hospital, School of Medicine, Zhejiang University and the informed consents were obtained from all the participants. Sample Collection For the assay of HBV markers, maternal blood samples were taken at the admission to hospital, and neonatal blood samples on the third day after delivery. Blood samples were centrifuged at 1500g for 15 min after standing for at least 30 min in room temperature and serum was separated. For trophoblast response test, blood samples were taken from high-level HBV carriers (HBV DNA > 1.0 108 copies/ml) with normal liver function test and healthy volunteers with a negative serum HBV marker and serum were separated aseptically. A 0.22 mm filtration device (Corning, Glendale, CA) was used for further sterilization. The complement was inactivated at 56C for 30 min and serum was stored at 80˚C until assay. Placental samples were collected immediately after the placentas were delivered. Placental cotyledons were dissected at middle zone, washed thoroughly with ice-cold normal saline after amniotic membranes, deciduas, and connective tissues were removed. They were snap-frozen with liquid-nitrogen, and then stored at 80˚C until assay.
3
(corresponding to approximately 100 viral genomes equivalent/cell). After 48 hr of incubation, cells were then washed three times with PBS, trypsinized, and collected after extensively washed. Assays Serum markers of hepatitis A, B, C, and E including HAV IgM, HBsAg, HBeAg, anti-HBc, anti-HBe, HCV IgG, and HEV IgM were routinely detected with ELISA (Sino-American Biotechnology, Beijing, China) and HBV DNA with real-time PCR (Zhongshan University DaAn Gene Company, Zhongshan, China). Total RNA was isolated from placental tissue and trophoblastic cells by using the Trizol RNA reagent (Invitrogen Life Technologies, Carlsbad, CA). Reverse transcription was performed with random primers using PrimeScript RT reagent kit (Takara Bio, Tokyo, Japan). The RNA and cDNA samples were stored at 80˚C. The primers were designed by using an online program BatchPrimer3 (USDA, Albany, NY) and the sequences of primers of HBD3, A3G, MBL, and the internal control genes are listed in Table II. All primers were synthesized by Shanghai Sangon Biological Engineering Technology (Shanghai, China). Real-time PCR was performed on the ABI7900 HT Fast Real-Time PCR System (Applied Biosystems, Carlsbad, CA) using the SYBR Premix EXTaq (Takara Bio, Tokyo, Japan) according to the manufacturer’s instructions. Thermal cycling conditions included pre-incubation at 95˚C for 10 min followed by 40 cycles of 95˚C for 15 sec, 60˚C for 30 sec, 72˚C for 10 sec. LightCycler collected data automatically and analyzed the value of threshold cycle (Ct). All PCR reactions were performed in triplicate. The changes of A3G, MBL, and HBD3 mRNA expression were presented and compared in 2DDCt method.
Cell Culture Placental trophoblast cell lineage Swan 71 was cultured in DMEM/F12 medium supplemented with 10% fetal bovine serum and antibiotics (penicillin 100 U/ml and streptomycin 100 mg/ml) at 37˚C/5% CO2. Cells were seeded at a concentration of 2 105 cells/ml in tissue culture dishes and cultured overnight and then the medium was changed. When the cells reached a confluence of 50%–60%, serum containing high quantity of HBV was added
Statistical Analysis Data distribution was tested with Kolmogorov– Smirnov test and data were presented in mean and SD or median and quartiles according to their distribution. Significance was tested with one-way ANOVA, Mann–Whitney test, Student t test or Chisquare test. SPSS statistic package (SPSS Company, Chicago, IL) was used for data analysis.
TABLE II. Sequences of Primers Gene
Sequence of primers
Length of product (bp)
A3G
Forward: GCTGTGCTTCCTGGACGTGA Reverse: GGTGGTCCACAAAGGTGTCCC Forward: AGCTCTGCCTTACCATTGGGTTC Reverse: TCCAGCCACAGCTGCAATTC Forward: CCACTTGAGACAGCACTATGTAGGA Reverse: GACAGCCCAGAAACAGACACAC Forward: AGAAAATCTGGCACCACACC Reverse: TAGCACAGCCTGGATAGCAA
284
HBD3 MBL b-Actin
140 111 173
J. Med. Virol. DOI 10.1002/jmv
4
Bai et al.
Fig. 1. Comparison of placental expression of HBD-3, A3G, and MBL. There were significant differences in placental mRNA expression of A3G (F ¼ 4.716, P ¼ 0.014) and HBD-3 (F ¼ 4.958, P ¼ 0.003) among the three groups. The expression of MBL did not significantly differ (F ¼ 2.064, P ¼ 0.135). The expression levels of A3G mRNA were significantly higher in non-infected group than those of control group and infected group (P ¼ 0.007 and P ¼ 0.043, respectively), however, were not significantly different between infected group and control group (P ¼ 0.975). The expression levels of HBD-3 mRNA were significantly higher in non-infected group than those of control group (P ¼ 0.003), however, were not significantly different between infected group and infected group or control group (P ¼ 0.119 and P ¼ 0.240).
RESULTS As shown in Figure 1, there were significant differences in placental mRNA expression of A3G (F ¼ 4.716, P ¼ 0.014) and HBD-3 (F ¼ 4.958, P ¼ 0.003) among the three groups, but the expression of MBL did not significantly differ (F ¼ 2.064, P ¼ 0.135). The expression levels A3G mRNA were significantly higher in non-infected group than controls and infected group (P ¼ 0.007 and P ¼ 0.043, respectively), however, were not significantly different between controls and infected groups (P ¼ 0.975). The expression levels of HBD-3 mRNA were significantly higher in non-infected group than controls (P ¼ 0.003), however, were not significantly different between infected group and noninfected group (P ¼ 0.119) and between infected group and controls (P ¼ 0.240). To determine if HBV induced the expression of HBD-3, A3G, and MBL, Swan71 cells were cultured in the presence (HBV-exposure) or absence (control) of HBV and the expression of HBD-3, A3G, and MBL mRNA was detected. There was an significant increase in the expression of A3G (P < 0.001), HBD-3 (P ¼ 0.0419), and MBL (P ¼ 0.0236) when trophoblast cells were exposed to HBV compare to control (Fig. 2), suggesting trophoblast cells recognize and respond to HBV and up-regulate the expression of anti-microbial peptides. DISCUSSION In the current investigation, it was found that placental expression of HBD-3 and A3G was markedly increased in HBV carrier women and the exposure to HBV enhanced HBD-3 and A3G expression by trophoblastic cell Swan 71, indicating that HBV upregulates HBD-3 and A3G expression of placental trophoblast in vivo and in vitro. It was also shown J. Med. Virol. DOI 10.1002/jmv
Fig. 2. Change of expression of A3G, HBD-3 and MBL by trophoblast after exposed to HBV. The mRNA levels of A3G, HBD-3, and MBL were significantly higher (P < 0.001, P ¼ 0.0419, and P ¼ 0.0236, respectively) in HBV-exposed cells than control.
that the increase in the expression of A3G was absent in the placenta of women whose infants were infected via intrauterine route, implying this is associated with intrauterine infection of HBV. Given that placenta is the pregnancy-specific component of innate immune system [Guleria and Pollard, 2000; Abrahams et al., 2006] and anti-microbials is important part of this component [Noguchi et al., 2007], the findings in this study suggest that the immune response to HBV by placental trophoblast is central in preventing intrauterine infection of HBV and upregulation of A3G and HBD-3 expression may be part of the immune response to HBV infection. Placenta is the pregnancy-specific organ and covered with a layer of trophoblast cells consisting of syncytiotrophoblasts and cytotrophoblasts. The syncytiotrophoblast constitutes the maternal–fetal barrier. Guleria et al. [Guleria and Pollard, 2000] found that trophoblast synthesized the neutrophil chemoattractants and macrophage inflammatory protein (MIP)-2 to recruit neutrophils to the site of listerial (a Grampositive intracellular bacterium) infection at the maternal–fetal interface and proposed that placenta is the pregnancy-specific component innate immune system and placental trophoblast functions as macrophage in recognizing and responding to pathogens. Natural anti-microbials expressed by trophoblast including HBD-3, A3G, and MBL are among the mediators of this innate immune component. APOBEC3G (A3G) is a single-stranded DNA cytidine deaminase targeting a wide range of virus including human HBV [Lei et al., 2006] and inhibits HBV replication in vitro and in vivo through deamination-dependent and -independent mechanisms [Lei et al., 2006; Nguyen et al., 2007; Nguyen and Hu, 2008]. However, no publications are available describing the role and mechanisms of placental APOBEC3G in the prevention of intrauterine transmission of HBV. It is reported that first-trimester
Placental A3G and HBD-3 May Play a Role in HBV Transmission
trophoblast cells produce interferon-b (IFN-b) and APOBEC3G following stimulation with Poly (I:C) through engagement of TLR-3[Abrahams et al., 2006]. Further studies are needed to clarify the mechanisms A3G is involved in the prevention of intrauterine infection of HBV. HBD-3 is an important component of both innate immunity and adaptive immunity exhibiting anti-microbial activities [Harris and Liddament, 2004]. The antiviral property of HBD-3 has been widely discussed, mostly in HIV infection. It is reported that expression of HBD3 is induced by several viruses and regulated by cytokines such as tumor-necrosis factor (TNF) and IL1b [Duits et al., 2003; Ganz, 2003; Sorensen et al., 2005]. However, the study describing the involvement of HBD-3 in the prevention of HBV infection is scanty. Herein, this study reports primary evidence that HBD-3 has a role in preventing intrauterine transmission of HBV, but detailed role and mechanisms need investigating, although the difference did not reach significance between non-infected and infected groups. The absence of the difference in HBD-3 is due mainly to the small sample size of infected group. MBL is a pattern recognition molecule and is central in recognizing and responding to pathogens including HBV. It has been revealed that MBL polymorphisms that confer low levels of MBL are correlated with poor prognoses such as HBV persistence [Thio et al., 2005], disease progression [Yuen et al., 1999; Song le et al., 2003; Chong et al., 2005]. It was shown that low fetal MBL is associated with intrauterine infection of HBV [Wu et al., 2013]. In this study, it was found HBV in vitro up-regulated MBL expression of trophoblast but the expression of placental MBL did not significantly differ among noninfected, infected, and control groups. These findings make uncertainty of MBL in preventing intrauterine HBV transmission and request further studies. The main limitations included the current investigation was observational and the mechanisms by which these factors are involved in the prevention of intrauterine transmission of HBV remain unclear. CONCLUSIONS It was demonstrated that maternal HBV infection induces an increase in placental HBD-3 and A3G levels and the absence of these increases are possibly associated with intrauterine infection of HBV, suggesting that HBD-3 and A3G produced by placenta may play an important role in preventing intrauterine transmission of HBV. REFERENCES Abrahams VM, Schaefer TM, Fahey JV, Visintin I, Wright JA, Aldo PB, Romero R, Wira CR, Mor G. 2006. Expression and secretion of antiviral factors by trophoblast cells following stimulation by the TLR-3 agonist, Poly(I: C). Hum Reprod 21:2432–2439. Bai H, Zhang L, Ma L, Dou XG, Feng GH, Zhao GZ. 2007. Relationship of hepatitis B virus infection of placental barrier
5
and hepatitis B virus intra-uterine transmission mechanism. World J Gastroenterol 13:3625–3630. Bhat P, Anderson DA. 2007. Hepatitis B virus translocates across a trophoblastic barrier. J Virol 81:7200–7207. Chen H, Xu Z, Peng L, Fang X, Yin X, Xu N, Cen P. 2006. Recent advances in the research and development of human defensins. Peptides 27:931–940. Chong WP, To YF, Ip WK, Yuen MF, Poon TP, Wong WH, Lai CL, Lau YL. 2005. Mannose-binding lectin in chronic hepatitis B virus infection. Hepatology 42:1037–1045. Delorme-Axford E, Donker RB, Mouillet JF, Chu T, Bayer A, Ouyang Y, Wang T, Stolz DB, Sarkar SN, Morelli AE, Sadovsky Y, Coyne CB. 2013. Human placental trophoblasts confer viral resistance to recipient cells. Proc Natl Acad Sci U S A 110:12048–12053. Duits LA, Nibbering PH, van Strijen E, Vos JB, MannesseLazeroms SP, van Sterkenburg MA, Hiemstra PS. 2003. Rhinovirus increases human beta-defensin-2 and -3 mRNA expression in cultured bronchial epithelial cells. FEMS Immunol Med Microbiol 38:59–64. Ganz T. 2003. Defensins: Antimicrobial peptides of innate immunity. Nat Rev Immunol 3:710–720. Guleria I, Pollard JW. 2000. The trophoblast is a component of the innate immune system during pregnancy. Nat Med 6:589–593. Guo Z, Shi XH, Feng YL, Wang B, Feng LP, Wang SP, Zhang YW. 2013. Risk factors of HBV intrauterine transmission among HBsAg-positive pregnant women. J Viral Hepat 20:317–321. Harris RS, Liddament MT. 2004. Retroviral restriction by APOBEC proteins. Nat Rev Immunol 4:868–877. Lavanchy D. 2004. Hepatitis B virus epidemiology, disease burden, treatment, and current and emerging prevention and control measures. J Viral Hepat 11:97–107. Lei YC, Hao YH, Zhang ZM, Tian YJ, Wang BJ, Yang Y, Zhao XP, Lu MJ, Gong FL, Yang DL. 2006. Inhibition of hepatitis B virus replication by APOBEC3G in vitro and in vivo. World J Gastroenterol 12:4492–4497. Maisetta G, Batoni G, Esin S, Luperini F, Pardini M, Bottai D, Florio W, Giuca MR, Gabriele M, Campa M. 2003. Activity of human beta-defensin 3 alone or combined with other antimicrobial agents against oral bacteria. Antimicrob Agents Chemother 47:3349–3351. Nguyen DH, Gummuluru S, Hu J. 2007. Deamination-independent inhibition of hepatitis B virus reverse transcription by APOBEC3G. J Virol 81:4465–4472. Nguyen DH, Hu J. 2008. Reverse transcriptase- and RNA packaging signal-dependent incorporation of APOBEC3G into hepatitis B virus nucleocapsids. J Virol 82:6852–6861. Noguchi C, Hiraga N, Mori N, Tsuge M, Imamura M, Takahashi S, Fujimoto Y, Ochi H, Abe H, Maekawa T, Yatsuji H, Shirakawa K, Takaori-Kondo A, Chayama K. 2007. Dual effect of APOBEC3G on Hepatitis B virus. J Gen Virol 88:432–440. Quinones-Mateu ME, Lederman MM, Feng Z, Chakraborty B, Weber J, Rangel HR, Marotta ML, Mirza M, Jiang B, Kiser P, Medvik K, Sieg SF, Weinberg A. 2003. Human epithelial betadefensins 2 and 3 inhibit HIV-1 replication. AIDS 17:F39–48. Song le H, Binh VQ, Duy DN, Juliger S, Bock TC, Luty AJ, Kremsner PG, Kun JF. 2003. Mannose-binding lectin gene polymorphisms and hepatitis B virus infection in Vietnamese patients. Mutat Res 522:119–125. Sorensen OE, Thapa DR, Rosenthal A, Liu L, Roberts AA, Ganz T. 2005. Differential regulation of beta-defensin expression in human skin by microbial stimuli. J Immunol 174:4870–4879. Thio CL, Mosbruger T, Astemborski J, Greer S, Kirk GD, O’Brien SJ, Thomas DL. 2005. Mannose binding lectin genotypes influence recovery from hepatitis B virus infection. J Virol 79:9192– 9196. Weinberg A, Quinones-Mateu ME, Lederman MM. 2006. Role of human beta-defensins in HIV infection. Adv Dent Res 19:42–48. Wu Y, Zhou Q, Wang H, Tian T, Zhu Q, Bai X, Yang X, Wang Z, Dong M. 2013. Potential role of mannose-binding lectin in intrauterine transmission of hepatitis B virus. Jpn J Infect Dis 66:391–393. Yuen MF, Lau CS, Lau YL, Wong WM, Cheng CC, Lai CL. 1999. Mannose binding lectin gene mutations are associated with progression of liver disease in chronic hepatitis B infection. Hepatology 29:1248–1251.
J. Med. Virol. DOI 10.1002/jmv
