http://informahealthcare.com/phb ISSN 1388-0209 print/ISSN 1744-5116 online Editor-in-Chief: John M. Pezzuto Pharm Biol, Early Online: 1–5 ! 2014 Informa Healthcare USA, Inc. DOI: 10.3109/13880209.2014.900808
ORIGINAL PAPER
Possible mechanisms of the antifungal activity of fluconazole in combination with terbinafine against Candida albicans Alireza Khodavandi1, Fahimeh Alizadeh2, Nasim Aghai Vanda3, Golgis Karimi4, and Pei Pei Chong5
Pharmaceutical Biology Downloaded from informahealthcare.com by University of Maastricht on 06/15/14 For personal use only.
1
Department of Paramedical Sciences, Gachsaran Branch, Islamic Azad University, Gachsaran, Iran, 2Department of Microbiology, Yasouj Branch, Islamic Azad University, Yasouj, Iran, 3Department of Microbiology, Science and Research Branch, Islamic Azad University, Fars, Iran, 4Department of Nutrition, Faculty of Medicine and Health Sciences, University Putra Malaysia, Serdang, Malaysia, and 5Department of Biomedical Sciences, Faculty of Medicine and Health Sciences, Universiti Putra Malaysia, Serdang, Malaysia Abstract
Keywords
Context: Candidiasis is a term describing infections by yeasts from the genus Candida, the majority Candida albicans. Treatment of such infections often requires antifungals such as the azoles, but increased use of these drugs has led to selection of yeasts with increased resistance to these drugs. Objective: Combination therapy would be one of the best strategies for the treatment of candidiasis due to increased resistance to azoles. Materials and methods: The antifungal activities of fluconazole and terbinafine were evaluated in vitro alone and in combination using broth microdilution test and time kill study. Eventually the expression level of selected genes involved in ergosterol biosynthesis of Candida was evaluated using semi-quantitative RT-PCR. Results: The obtained results showed the significant MICs ranging from 0.25 to 8 mg/mL followed by FICs ranged from 0.37 to 1 in combination with fluconazole/terbinafine. Our findings have demonstrated that the combination of fluconazole and terbinafine could also significantly reduce the expression of ERG1, 3, and 11 in the cell membrane of Candida in all concentrations tested ranging from 1.73- to 6.99-fold. Discussion and conclusion: This study was undertaken with the ultimate goal of finding the probable targets of fluconazole/terbinafine in C. albicans by looking at its effects on cell membrane synthesis.
Candidiasis, gene expression, synergistic activity
Introduction Candidiasis is a common term that usually results from overgrowth of Candida albicans in the human body treated by antifungal agents such as azoles (like fluconazole) and allylamines (like terbinafine) as the common antifungal drugs (Ferahbas et al., 2006; Rossie & Guggenheimer, 1997). The primary target of azoles may be the heme protein, which cocatalyzes cytochrome-P450-dependent 14a-demethylation of lanosterol in the last stage of ergosterol biosynthesis, while allylamines act by inhibiting the early stages. Indeed, the inhibition of squalene epoxidase by terbinafine (early step) or 14a-demethylase by fluconazole (last step) of ergosteroln’s biosynthesis has principal role in a play of depletion of ergosterol and agglomeration of sterol precursors, resulting some alteration in the structure and function of cell membrane in Candida cells (Borecka´-Melkusova´ et al., 2009; EspinelIngroff, 2008; Ghannoum & Rice, 1999; Spampinato & Leonardi, 2013). Correspondence: A. Khodavandi, Department of Paramedical Sciences, Gachsaran Branch, Islamic Azad University, Gachsaran, Iran. Tel: +987423332036. Fax: +987423333533. E-mail: [email protected], [email protected], [email protected]
History Received 7 December 2013 Revised 13 February 2014 Accepted 28 February 2014 Published online 16 May 2014
Sometimes, Candida seen in immunocompromised or hospitalized individuals is resistant to main types of antifungal agents (Park & Perlin, 2005). Ergosterol biosynthesis genes including ERG1, ERG3, and ERG11 are the most significant genes involved in the resistance to azoles and the other antifungals such as allylamines. In contrast, the up-regulation of these genes resulting in alteration of enzyme targeted by fluconazole (encoded by ERG11) or terbinafine (encoded by ERG1) which may result in the resistance to drugs. Moreover, mutation of these genes could lead to resistance to these antifungals (Borecka´-Melkusova´ et al., 2009; Espinel-Ingroff, 2008). Nowadays increasing incidence of resistance to antifungal therapy has required that novel therapies be used. Some reports have shown that combination of fluconazole/terbinafine was effective to inhibiting Candida growth in vitro (Ghannoum & Elewski, 1999; Perea et al., 2002). In the present study, in vitro antifungal activities of fluconazole and terbinafine alone and in combination against C. albicans were examined. Subsequently, the expression of significant genes involved in ergosterol biosynthesis of Candida such as ERG1, ERG3, and ERG11 were analyzed with fluconazole/terbinafine combination therapy.
2
A. Khodavandi et al.
Pharm Biol, Early Online: 1–5
Materials and methods Inoculum Five clinical isolates of C. albicans which were obtained from systemic candidiasis-patients and C. albicans ATCC 10231 as a reference quality-control strain were used. All isolates grown on Sabouraud dextrose agar and the cell density was adjusted at 530 nm wavelength to acquire the yeast stock suspension containing 1–5 106 cells/mL. Antifungals
Pharmaceutical Biology Downloaded from informahealthcare.com by University of Maastricht on 06/15/14 For personal use only.
Fluconazole and terbinafine were obtained from Sigma Chemicals Co. (St. Louis, MO) and were dissolved in dimethylsulfoxide at 5 mg/mL according to the manufacturers’ recommendations. Determination of MIC using broth microdilution assay According to CLSI document M27-A3 for yeast, 50 or 100 mL of the two-fold dilution of the drugs alone or in combination, respectively, dissolved in a standard RPMI 1640 medium with 0.2% glucose [buffered to pH 7.0 with 0.165 M morpholinophos-phonyl sulfate (MOPS)] using 96-well microplates. Subsequently, 100 mL of a suspension containing 5 102– 2.5 103 yeast cells/mL was added to the former mixture and incubated at 35 C for 24 h. The endpoint was calculated as the lowest concentration of each drug that caused at least 50 and 90% growth inhibition compared with the control-growth. Time kill study Four mL of C. albicans ATCC 10231 (1 106 cells/mL) were dissolved in RPMI 1640 (as described above) and mixed with 2, 4, and 0.25 mg/mL of fluconazole, terbinafine, and fluconazole/terbinafine, respectively, and grown at 35 C. After different time intervals, 100 mL of each mixture was loaded and plated on Sabouraud dextrose agar and was incubated at 35 C for 48 h. Eventually, colonies were counted and the CFU were calculated. RNA extraction and cDNA synthesis Total RNA of each sample contained C. albicans ATCC 10231, fluconazole and terbinafine alone and in combination was extracted using RNeasy mini kit (Qiagen, Hilden, Germany) with slight modifications for yeast cells. Subsequently, 2 mL of sorbitol lysis buffer (1 M sorbitol and 0.1 M EDTA pH 7.4) was added to each sample and then 50U
lyticase/zymolyase (ICN Chemicals, Newburyport, MA) and 10 mL of b-mercaptoethanol were added, respectively, to the former mixture. The extracted RNA was also treated using 1U DNase I (Promega, Southampton, UK) according to the manufacturer’s operating instructions. RNA quality, concentrations, and absorbance ratio were checked using 1.2% (w/v) formaldehyde-denaturing agarose gel electrophoresis and Nanodrop ND-1000 spectrophotometer, respectively. In the next step, 1 mg extracted RNA was used to achieve the single-stranded cDNA according to the manufacturer’s protocol as described in our previous work (Khodavandi et al., 2011). Semi-quantitative RT-PCR for comparing ERG1, ERG3, and ERG11 gene expression levels ERG1, ERG3, and ERG11 genes of C. albicans ATCC 10231 were amplified using the synthesized cDNA as prepared in former stages. b-Actin gene was also amplified as a housekeeping gene and an internal control as explained entirely in our previous work (Khodavandi et al., 2011). The primer sequences which were used in this work are listed in Table 1. Finally, the PCR products were analyzed by gel electrophoresis and visualized using an Alpha Imager HP imaging system. The concentration of PCR products was measured and the relative quantification was calculated using the following formula (Khodavandi et al., 2011): Fold change in target gene expression ¼ Ratio of target gene expression ðexperiment=untreated controlÞ Ratio of reference gene expressionðexperiment=untreated controlÞ
All statistical analyses were done using the SPSS software (version 21; SPSS Inc., Chicago, IL). We used normality and ANOVA test to analyze the gene expression. In all statistical analyses, p50.05 was considered significant.
Results The MICs range of fluconazole against C. albicans was 0.5– 128 mg/mL. Indeed, except C. albicans clinical isolate number 5 (CI-5), 80% of isolates were susceptible to fluconazole (MIC564 mg/mL). However, no specific breakpoints were proposed based on the terbinafine, all isolates have shown MICs less 16 mg/mL and ranged from 0.5 to 32 mg/mL (Table 2). Table 2 also indicates that the combination of fluconazole/ terbinafine was highly active. While 50% of isolates show
Table 1. Oligonucleotide primers used for PCR. Primer
Length
Orientation
Sequence 0
Reference 0
ERG1
84
Forward Reverse
5 ACTAATGTTCCACCATTGGCTCT 3 50 CACATGACCTTTGCCCTTAGCT 30
Borecka´-Melkusova´ et al. (2009)
ERG3
179
Forward Reverse
50 TCCAGTTGATGGGTTCTTCC 30 50 GGACAGTGTGACAAGCGGTA 30
This study
ERG11
163
Forward Reverse
50 TTGGTGGTGGTAGACATA 30 50 TCTGCTGGTTCAGTAGGT 30
This study
ACT
516
Forward Reverse
50 ACCGAAGCTCCAATGAATCCAAAATCC 30 50 GTTTGGTCAATACCAGCAGCTTCCAAA 30
Khodavandi et al. (2011)
Fluconazole in combination with terbinafine
DOI: 10.3109/13880209.2014.900808
3
Table 2. MICs and FICs value of Candida albicans to antifungals tested. Fluconazolea
Isolates C. C. C. C. C. C.
albicans albicans albicans albicans albicans albicans
ATCC 10231 CI_1b CI_2b CI_3b CI_4b CI_5b
Terbinafinea
Fluconazole/Terbinafinea
MIC50/MIC90
MIC range
MIC50/MIC90
MIC range
MIC50
FIC50
MIC90
FIC90
1/2 8/32 16/32 8/16 16/32 32/ 64
0.5/4 4/32 8/32 8/32 16/32 16/128
0.5/4 4/16 2/4 1/4 4/8 4/16
0.25/4 4/32 1/4 1/4 2/16 4/16
0.25/0.125 2/0.5 4/1 4/0.125 8/2 16/0.5
0.50 0.37 0.50 0.62 0.75 0.62
0.5/0.25 4/2 8/2 4/2 8/1 8/0.125
0.19 0.25 1.00 0.75 0.62 0.13
a
mg/mL. CI: Clinical isolates.
strong synergistic activity after treatment by fluconazole in combination with terbinafine, only 33 and 16.7% of the combination of fluconazole/terbinafine were partial synergism and additive activities, respectively (Khodavandi et al., 2011). The inhibitory effect of antifungals tested is shown in Figure 2. Both fluconazole and terbinafine decreased the number of cells after time intervals, significantly. The combination of fluconazole/terbinafine was significantly more efficacious than the antifungal tested alone (p50.05). Gene expression analysis data indicated significant downregulation (p50.05) of selected genes in all concentration tested for both fluconazole and terbinafine alone. Indeed the expression level of ERG3 and ERG11 was down-regulated 2.02–3.96- and 2.39–4.46-fold, respectively, for different concentrations of fluconazole alone based on MIC (data not shown). Terbinafine was also effective to decrease the expression level of ERG1 ranged from 1.63 to 3.05 (data not shown). Moreover, antifungals with combination could able to down-regulate all selected genes as well as fluconazole and terbinafine alone. ERG1, ERG3, and ERG11 were down-regulated 1.73–4.11-, 2.29–4.85-, and 3.95–6.99-fold, respectively, for different concentrations of fluconazole/ terbinafine based on MIC (Figures 3 and 4).
N
(A)
N N N
N OH
Antifungal drugs including azoles such as fluconazole, polyenes, allylamines such as terbinafine and flucytosine are mostly commonly used to treat Candida infections. Most of these antifungal agents are phenolic structured. The phenolic compounds show the highest anti-Candida bioactivity (Figure 1) (Yang, 2003). In the recent years, treatment failure of fungal infections such as candidiasis is apparently increasing due to low efficacy of anticandidal drugs and occurrence of drug-resistance in the number of immunocompromised patients (Al-Mohsen & Hughes, 1998; Bruzual et al., 2007; Odds, 1996). Therefore, there is a need to find the new ways to increase the efficacy of antifungals with minimal drug resistance to treat Candida infections. Towards this goal, combination of drugs with synergistic effect and understanding the molecular mechanisms are fundamental to discover and develop of new anti-infective strategies. Indeed, the combination of fluconazole with terbinafine was shown to be significant in terms of growth inhibition in C. albicans by some reports (Ghannoum & Elewski, 1999;
F CH3
(B) CH3
CH3 CH3
N
Figure 1. Chemical structure of fluconazole (A) and terbinafine (B). Untreated control Terbinafine
14
Discussion
F
N
Log10CFU of C. albicans/ml
Pharmaceutical Biology Downloaded from informahealthcare.com by University of Maastricht on 06/15/14 For personal use only.
b
Fluconazole 12
Fluconazole/Terbinafine
10 8 6 4 2 0 0
6
12
18
24
30
36
42
48
Time (h)
Figure 2. Time kill curves of fluconazole (2 mg/mL) and terbinafine (4 mg/mL) and fluconazole/terbinafine (0.25 mg/mL) against Candida albicans ATCC 10231 at different time intervals.
Ghannoum & Rice, 1999; Perea et al., 2002; Scheid et al., 2012). Determination of MICs is a simple and reproducible approach that can be applied to show the ability of growth
4
A. Khodavandi et al.
Pharm Biol, Early Online: 1–5
b-ACT ERG1 ERG3
ERG11 2× MIC
1× MIC
1 /2 × MIC
1 /4 × MIC
Figure 3. Gel electrophoresis of semi-quantitative RT-PCR products of ERG genes from Candida albicans ATCC 10231 treated with fluconazole/terbinafine.
effect was observed in most of isolates tested and ranged from 0.13 to 0.25 (Table 2). The time kill curve showed a significant reduction (p50.05) the number of Candida comparing untreated controls for those fluconazole and terbinafine alone and in combination after 6 h incubation at 35 C. Interestingly, the terbinafine was almost as efficiently as fluconazole in terms of the growth of the yeast cells (p40.05) until 36 h incubation at 35 C, while fluconazole was significantly stronger than terbinafine (p50.05) after 42 h incubation at 35 C (Figure 2). This may be due to potential of azoles to destroy the membrane of Candida through the inhibition activities of both critical enzymes in ergosterol biosynthesis such as 14ademethylase and desaturase, while allylamine could inhibit the activity of squalene epoxidase only during ergosterol biosynthesis (Ghannoum & Rice, 1999; Lupetti et al., 2002). The combination therapy may be one of the viable therapeutic options due to increase of azole-resistance phenomena. The in vitro activities of fluconazole with terbinafine were reported by several investigations (Canto´n et al., 2005; Cavalheiro et al., 2009; Ghannoum & Elewski, 1999; Perea et al., 2002). All of them were persisted that the antifungal activity of fluconazole in combination with terbinafine could increase significantly and no antagonistic effects were observed. Nonetheless, the possible molecular mechanisms of those activities are not understood. In the present study, we have attempted to clear one of the probable mechanisms with a standard and accessible method. In fact, the relative expression level of transcript mRNA of genes involved in
Normalized rao (ERG3/ACT)
(B) 1.4 (A) Normalized rao (ERG1/ACT)
1.4 1.2 1 0.8 0.6 0.4 0.2
1.2 1 0.8 0.6 0.4 0.2 0
0 Untreated 1/4 MIC 1/2 MIC 1 MIC 2 MIC control Fluconazole/Terbinafine concentaraons
Untreated 1/4 MIC 1/2 MIC 1 MIC 2 MIC control Fluconazole/Terbinafine concentraons
(C) 1.6 Normalized rao (ERG11/ACT)
Pharmaceutical Biology Downloaded from informahealthcare.com by University of Maastricht on 06/15/14 For personal use only.
inhibition of Candida cells by antifungals. The MICs values for fluconazole alone ranged from 0.5 to 128 mg/mL (Table 2). Interestingly, most of clinical isolates were susceptible to fluconazole except one clinical isolate, while MICs of drugs in combination was significantly decreased and resistant was not observed. One of the best examples of this is fluconazoleresistant C. albicans clinical isolate (CI-5), where the MIC90 of this isolate is markedly decreased (512-fold) with the combination of fluconazole/terbinafine (Table 2). Meanwhile, FICs values also were demonstrated that terbinafine could be able to increase the antifungal activities of fluconazole when they were used in combination. This significant synergistic
1.4 1.2 1 0.8 0.6 0.4 0.2 0 Untreated control
1/4 MIC
1/2 MIC
1 MIC
2 MIC
Fluconazole/Terbinafine concentraons
Figure 4. Relative quantitation of ERG1 (A), ERG3 (B), and ERG11 (C) expression (normalized to house-keeping gene, actin) in Candida albicans ATCC 10231 after 24 h of treatment with different concentrations of fluconazole/terbinafine.
Pharmaceutical Biology Downloaded from informahealthcare.com by University of Maastricht on 06/15/14 For personal use only.
DOI: 10.3109/13880209.2014.900808
biosynthesis of ergosterol in the cell membrane of C. albicans was evaluated with fluconazole and terbinafine monotherapy or in combination using semi-quantitative RT-PCR. As explained above the main target of both fluconazole and terbinafine is the cell membrane of Candida. Indeed, squalene, a precursor of ergosterol, is converted to lanosterol with squalene epoxidase encoded by ERG1 gene. Squalene epoxidase is inhibited in the presence of allylamines resulting in cell membrane destruction (Lupetti et al., 2002; Pasrija et al., 2005). Our results showed that the expression level of ERG1 was significantly down-regulated (p50.05) after treatment of C. albicans ATCC 10231 (1.63–3.05 folds) with terbinafine alone, while the expression of those ERG3, 11 was not changed as expected (data not shown). In contrast, the expression level of ERG3, 11 was down-regulated significantly (p50.05) after treatment of C. albicans ATCC 10231 using fluconazole alone (2.02–3.96 and 2.39–4.46fold, respectively) and ERG1 was not significantly changed (data no shown). This is also justified by the role of fluconazole to inhibit the possible target genes including ERG3 and ERG11 (Geber et al., 1995; Ghannoum & Rice, 1999; Lupetti et al., 2002). Combination of fluconazole/terbinafine was decreased the expression level of all genes tested significantly at level p 0.05 in compared with the untreated control (Figures 3 and 4). Clearly, significant genes involved in ergosterol biosynthesis of C. albicans ATCC 10231 including ERG1, 3, and 11 were down-regulated ranged from 1.73- to 6.99-fold with combination therapy of fluconazole/terbinafine. Hence combination of fluconazole/terbinafine could destroy the cell membrane through the inhibition of all three key enzymes in ergosterol biosynthesis of C. albicans. Therefore, the ergosterol suppression by combination of fluconazole/terbinafine seems to be related to ERG genes. Further experiments need to be performed in order to investigate the effect of these combinations on other significant genes contributing to the cell membrane of C. albicans with different techniques such as relative real time RT-PCR and microarray tests.
Declaration of interest The authors declare that they have no competing interests.
References Al-Mohsen I, Hughes WT. (1998). Systemic antifungal therapy: Past, present and future. Ann Saudi Med 18:28–38.
Fluconazole in combination with terbinafine
5
Borecka´-Melkusova´ S, Moran GP, Sullivan DJ, et al. (2009). The expression of genes involved in the ergosterol biosynthesis pathway in Candida albicans and Candida dubliniensis biofilms exposed to fluconazole. Mycoses 52:118–28. Bruzual I, Riggle P, Hadley S, Kumamoto CA. (2007). Biofilm formation by fluconazole-resistant Candida albicans strains is inhibited by fluconazole. J Antimicrob Chemother 59:441–50. Canto´n E, Pema´n J, Gobernado M, et al. (2005). Synergistic activities of fluconazole and voriconazole with terbinafine against four Candida species determined by checkerboard, time-kill, and Etest methods. Antimicrob Agents Chemother 49:1593–6. Cavalheiro AS, Maboni G, de Azevedo MI, et al. (2009). In vitro activity of terbinafine combined with caspofungin and azoles against Pythium insidiosum. Antimicrob Agents Chemother 53:2136–8. Espinel-Ingroff A. (2008). Mechanisms of resistance to antifungal agents: Yeasts and filamentous fungi. Rev Iberoam Micol 25:101–6. Ferahbas A, Koc AN, Uksal U, et al. (2006). Terbinafine versus itraconazole and fluconazole in the treatment of vulvovaginal candidiasis. Am J Ther 13:332–6. Geber A, Hitchcock CA, Swartz JE, et al. (1995). Deletion of the Candida glabrata ERG3 and ERG11 genes: Effect on cell viability, cell growth, sterol composition, and antifungal susceptibility. Antimicrob Agents Chemother 39:2708–17. Ghannoum M, Elewski B. (1999). Successful treatment of fluconazoleresistant oropharyngeal candidiasis by a combination of fluconazole and terbinafine. Clin Diagn Lab Immun 6:921–3. Ghannoum MA, Rice LB. (1999). Antifungal agents: Mode of action, mechanisms of resistance, and correlation of these mechanisms with bacterial resistance. Clin Microbiol Rev 12:501–17. Khodavandi A, Alizadeh F, Harmal NS, et al. (2011). Expression analysis of SIR2 and SAPs1-4 gene expression in Candida albicans treated with allicin compared to fluconazole. Trop Biomed 28:589–98. Lupetti A, Danesi R, Campa M, et al. (2002). Molecular basis of resistance to azole antifungals. Trends Mol Med 8:76–81. Odds FC. (1996). Resistance of clinically important yeasts to antifungal agents. Int J Antimicrob Agents 6:145–7. Park S, Perlin DS. (2005). Establishing surrogate markers for fluconazole resistance in Candida albicans. Microb Drug Resist 11:232–8. Pasrija R, Krishnamurthy S, Prasad T, et al. (2005). Squalene epoxidase encoded by ERG1 affects morphogenesis and drug susceptibilities of Candida albicans. J Antimicrob Chemother 55:905–13. Perea S, Gonzalez G, Fothergill AW, Rinaldi MG. (2002). In vitro activities of terbinafine in combination with fluconazole, itraconazole, voriconazole, and posaconazole against clinical isolates of Candida glabrata with decreased susceptibility to azoles. J Clin Microbiol 40: 1831–3. Rossie K, Guggenheimer J. (1997). Oral candidiasis: Clinical manifestation, diagnosis, and treatment. Pract Periodontics Aesthet Dent 9: 635–41. Scheid LA, Mario DAN, Kubic¸a TF, et al. (2012). In vitro activities of antifungal agents alone and in combination against fluconazolesusceptible and resistant strains of Candida dubliniensis. Braz J Infect Dis 16:78–81. Spampinato C, Leonardi D. (2013). Candida infections, causes, targets, and resistance mechanisms: Traditional and alternative antifungal agents. Biomed Res Int 2013:204237. Yang YL. (2003). Virulence factors of Candida species. J Microbiol Immunol Infect 36:223–8.
ORIGINAL PAPER
Possible mechanisms of the antifungal activity of fluconazole in combination with terbinafine against Candida albicans Alireza Khodavandi1, Fahimeh Alizadeh2, Nasim Aghai Vanda3, Golgis Karimi4, and Pei Pei Chong5
Pharmaceutical Biology Downloaded from informahealthcare.com by University of Maastricht on 06/15/14 For personal use only.
1
Department of Paramedical Sciences, Gachsaran Branch, Islamic Azad University, Gachsaran, Iran, 2Department of Microbiology, Yasouj Branch, Islamic Azad University, Yasouj, Iran, 3Department of Microbiology, Science and Research Branch, Islamic Azad University, Fars, Iran, 4Department of Nutrition, Faculty of Medicine and Health Sciences, University Putra Malaysia, Serdang, Malaysia, and 5Department of Biomedical Sciences, Faculty of Medicine and Health Sciences, Universiti Putra Malaysia, Serdang, Malaysia Abstract
Keywords
Context: Candidiasis is a term describing infections by yeasts from the genus Candida, the majority Candida albicans. Treatment of such infections often requires antifungals such as the azoles, but increased use of these drugs has led to selection of yeasts with increased resistance to these drugs. Objective: Combination therapy would be one of the best strategies for the treatment of candidiasis due to increased resistance to azoles. Materials and methods: The antifungal activities of fluconazole and terbinafine were evaluated in vitro alone and in combination using broth microdilution test and time kill study. Eventually the expression level of selected genes involved in ergosterol biosynthesis of Candida was evaluated using semi-quantitative RT-PCR. Results: The obtained results showed the significant MICs ranging from 0.25 to 8 mg/mL followed by FICs ranged from 0.37 to 1 in combination with fluconazole/terbinafine. Our findings have demonstrated that the combination of fluconazole and terbinafine could also significantly reduce the expression of ERG1, 3, and 11 in the cell membrane of Candida in all concentrations tested ranging from 1.73- to 6.99-fold. Discussion and conclusion: This study was undertaken with the ultimate goal of finding the probable targets of fluconazole/terbinafine in C. albicans by looking at its effects on cell membrane synthesis.
Candidiasis, gene expression, synergistic activity
Introduction Candidiasis is a common term that usually results from overgrowth of Candida albicans in the human body treated by antifungal agents such as azoles (like fluconazole) and allylamines (like terbinafine) as the common antifungal drugs (Ferahbas et al., 2006; Rossie & Guggenheimer, 1997). The primary target of azoles may be the heme protein, which cocatalyzes cytochrome-P450-dependent 14a-demethylation of lanosterol in the last stage of ergosterol biosynthesis, while allylamines act by inhibiting the early stages. Indeed, the inhibition of squalene epoxidase by terbinafine (early step) or 14a-demethylase by fluconazole (last step) of ergosteroln’s biosynthesis has principal role in a play of depletion of ergosterol and agglomeration of sterol precursors, resulting some alteration in the structure and function of cell membrane in Candida cells (Borecka´-Melkusova´ et al., 2009; EspinelIngroff, 2008; Ghannoum & Rice, 1999; Spampinato & Leonardi, 2013). Correspondence: A. Khodavandi, Department of Paramedical Sciences, Gachsaran Branch, Islamic Azad University, Gachsaran, Iran. Tel: +987423332036. Fax: +987423333533. E-mail: [email protected], [email protected], [email protected]
History Received 7 December 2013 Revised 13 February 2014 Accepted 28 February 2014 Published online 16 May 2014
Sometimes, Candida seen in immunocompromised or hospitalized individuals is resistant to main types of antifungal agents (Park & Perlin, 2005). Ergosterol biosynthesis genes including ERG1, ERG3, and ERG11 are the most significant genes involved in the resistance to azoles and the other antifungals such as allylamines. In contrast, the up-regulation of these genes resulting in alteration of enzyme targeted by fluconazole (encoded by ERG11) or terbinafine (encoded by ERG1) which may result in the resistance to drugs. Moreover, mutation of these genes could lead to resistance to these antifungals (Borecka´-Melkusova´ et al., 2009; Espinel-Ingroff, 2008). Nowadays increasing incidence of resistance to antifungal therapy has required that novel therapies be used. Some reports have shown that combination of fluconazole/terbinafine was effective to inhibiting Candida growth in vitro (Ghannoum & Elewski, 1999; Perea et al., 2002). In the present study, in vitro antifungal activities of fluconazole and terbinafine alone and in combination against C. albicans were examined. Subsequently, the expression of significant genes involved in ergosterol biosynthesis of Candida such as ERG1, ERG3, and ERG11 were analyzed with fluconazole/terbinafine combination therapy.
2
A. Khodavandi et al.
Pharm Biol, Early Online: 1–5
Materials and methods Inoculum Five clinical isolates of C. albicans which were obtained from systemic candidiasis-patients and C. albicans ATCC 10231 as a reference quality-control strain were used. All isolates grown on Sabouraud dextrose agar and the cell density was adjusted at 530 nm wavelength to acquire the yeast stock suspension containing 1–5 106 cells/mL. Antifungals
Pharmaceutical Biology Downloaded from informahealthcare.com by University of Maastricht on 06/15/14 For personal use only.
Fluconazole and terbinafine were obtained from Sigma Chemicals Co. (St. Louis, MO) and were dissolved in dimethylsulfoxide at 5 mg/mL according to the manufacturers’ recommendations. Determination of MIC using broth microdilution assay According to CLSI document M27-A3 for yeast, 50 or 100 mL of the two-fold dilution of the drugs alone or in combination, respectively, dissolved in a standard RPMI 1640 medium with 0.2% glucose [buffered to pH 7.0 with 0.165 M morpholinophos-phonyl sulfate (MOPS)] using 96-well microplates. Subsequently, 100 mL of a suspension containing 5 102– 2.5 103 yeast cells/mL was added to the former mixture and incubated at 35 C for 24 h. The endpoint was calculated as the lowest concentration of each drug that caused at least 50 and 90% growth inhibition compared with the control-growth. Time kill study Four mL of C. albicans ATCC 10231 (1 106 cells/mL) were dissolved in RPMI 1640 (as described above) and mixed with 2, 4, and 0.25 mg/mL of fluconazole, terbinafine, and fluconazole/terbinafine, respectively, and grown at 35 C. After different time intervals, 100 mL of each mixture was loaded and plated on Sabouraud dextrose agar and was incubated at 35 C for 48 h. Eventually, colonies were counted and the CFU were calculated. RNA extraction and cDNA synthesis Total RNA of each sample contained C. albicans ATCC 10231, fluconazole and terbinafine alone and in combination was extracted using RNeasy mini kit (Qiagen, Hilden, Germany) with slight modifications for yeast cells. Subsequently, 2 mL of sorbitol lysis buffer (1 M sorbitol and 0.1 M EDTA pH 7.4) was added to each sample and then 50U
lyticase/zymolyase (ICN Chemicals, Newburyport, MA) and 10 mL of b-mercaptoethanol were added, respectively, to the former mixture. The extracted RNA was also treated using 1U DNase I (Promega, Southampton, UK) according to the manufacturer’s operating instructions. RNA quality, concentrations, and absorbance ratio were checked using 1.2% (w/v) formaldehyde-denaturing agarose gel electrophoresis and Nanodrop ND-1000 spectrophotometer, respectively. In the next step, 1 mg extracted RNA was used to achieve the single-stranded cDNA according to the manufacturer’s protocol as described in our previous work (Khodavandi et al., 2011). Semi-quantitative RT-PCR for comparing ERG1, ERG3, and ERG11 gene expression levels ERG1, ERG3, and ERG11 genes of C. albicans ATCC 10231 were amplified using the synthesized cDNA as prepared in former stages. b-Actin gene was also amplified as a housekeeping gene and an internal control as explained entirely in our previous work (Khodavandi et al., 2011). The primer sequences which were used in this work are listed in Table 1. Finally, the PCR products were analyzed by gel electrophoresis and visualized using an Alpha Imager HP imaging system. The concentration of PCR products was measured and the relative quantification was calculated using the following formula (Khodavandi et al., 2011): Fold change in target gene expression ¼ Ratio of target gene expression ðexperiment=untreated controlÞ Ratio of reference gene expressionðexperiment=untreated controlÞ
All statistical analyses were done using the SPSS software (version 21; SPSS Inc., Chicago, IL). We used normality and ANOVA test to analyze the gene expression. In all statistical analyses, p50.05 was considered significant.
Results The MICs range of fluconazole against C. albicans was 0.5– 128 mg/mL. Indeed, except C. albicans clinical isolate number 5 (CI-5), 80% of isolates were susceptible to fluconazole (MIC564 mg/mL). However, no specific breakpoints were proposed based on the terbinafine, all isolates have shown MICs less 16 mg/mL and ranged from 0.5 to 32 mg/mL (Table 2). Table 2 also indicates that the combination of fluconazole/ terbinafine was highly active. While 50% of isolates show
Table 1. Oligonucleotide primers used for PCR. Primer
Length
Orientation
Sequence 0
Reference 0
ERG1
84
Forward Reverse
5 ACTAATGTTCCACCATTGGCTCT 3 50 CACATGACCTTTGCCCTTAGCT 30
Borecka´-Melkusova´ et al. (2009)
ERG3
179
Forward Reverse
50 TCCAGTTGATGGGTTCTTCC 30 50 GGACAGTGTGACAAGCGGTA 30
This study
ERG11
163
Forward Reverse
50 TTGGTGGTGGTAGACATA 30 50 TCTGCTGGTTCAGTAGGT 30
This study
ACT
516
Forward Reverse
50 ACCGAAGCTCCAATGAATCCAAAATCC 30 50 GTTTGGTCAATACCAGCAGCTTCCAAA 30
Khodavandi et al. (2011)
Fluconazole in combination with terbinafine
DOI: 10.3109/13880209.2014.900808
3
Table 2. MICs and FICs value of Candida albicans to antifungals tested. Fluconazolea
Isolates C. C. C. C. C. C.
albicans albicans albicans albicans albicans albicans
ATCC 10231 CI_1b CI_2b CI_3b CI_4b CI_5b
Terbinafinea
Fluconazole/Terbinafinea
MIC50/MIC90
MIC range
MIC50/MIC90
MIC range
MIC50
FIC50
MIC90
FIC90
1/2 8/32 16/32 8/16 16/32 32/ 64
0.5/4 4/32 8/32 8/32 16/32 16/128
0.5/4 4/16 2/4 1/4 4/8 4/16
0.25/4 4/32 1/4 1/4 2/16 4/16
0.25/0.125 2/0.5 4/1 4/0.125 8/2 16/0.5
0.50 0.37 0.50 0.62 0.75 0.62
0.5/0.25 4/2 8/2 4/2 8/1 8/0.125
0.19 0.25 1.00 0.75 0.62 0.13
a
mg/mL. CI: Clinical isolates.
strong synergistic activity after treatment by fluconazole in combination with terbinafine, only 33 and 16.7% of the combination of fluconazole/terbinafine were partial synergism and additive activities, respectively (Khodavandi et al., 2011). The inhibitory effect of antifungals tested is shown in Figure 2. Both fluconazole and terbinafine decreased the number of cells after time intervals, significantly. The combination of fluconazole/terbinafine was significantly more efficacious than the antifungal tested alone (p50.05). Gene expression analysis data indicated significant downregulation (p50.05) of selected genes in all concentration tested for both fluconazole and terbinafine alone. Indeed the expression level of ERG3 and ERG11 was down-regulated 2.02–3.96- and 2.39–4.46-fold, respectively, for different concentrations of fluconazole alone based on MIC (data not shown). Terbinafine was also effective to decrease the expression level of ERG1 ranged from 1.63 to 3.05 (data not shown). Moreover, antifungals with combination could able to down-regulate all selected genes as well as fluconazole and terbinafine alone. ERG1, ERG3, and ERG11 were down-regulated 1.73–4.11-, 2.29–4.85-, and 3.95–6.99-fold, respectively, for different concentrations of fluconazole/ terbinafine based on MIC (Figures 3 and 4).
N
(A)
N N N
N OH
Antifungal drugs including azoles such as fluconazole, polyenes, allylamines such as terbinafine and flucytosine are mostly commonly used to treat Candida infections. Most of these antifungal agents are phenolic structured. The phenolic compounds show the highest anti-Candida bioactivity (Figure 1) (Yang, 2003). In the recent years, treatment failure of fungal infections such as candidiasis is apparently increasing due to low efficacy of anticandidal drugs and occurrence of drug-resistance in the number of immunocompromised patients (Al-Mohsen & Hughes, 1998; Bruzual et al., 2007; Odds, 1996). Therefore, there is a need to find the new ways to increase the efficacy of antifungals with minimal drug resistance to treat Candida infections. Towards this goal, combination of drugs with synergistic effect and understanding the molecular mechanisms are fundamental to discover and develop of new anti-infective strategies. Indeed, the combination of fluconazole with terbinafine was shown to be significant in terms of growth inhibition in C. albicans by some reports (Ghannoum & Elewski, 1999;
F CH3
(B) CH3
CH3 CH3
N
Figure 1. Chemical structure of fluconazole (A) and terbinafine (B). Untreated control Terbinafine
14
Discussion
F
N
Log10CFU of C. albicans/ml
Pharmaceutical Biology Downloaded from informahealthcare.com by University of Maastricht on 06/15/14 For personal use only.
b
Fluconazole 12
Fluconazole/Terbinafine
10 8 6 4 2 0 0
6
12
18
24
30
36
42
48
Time (h)
Figure 2. Time kill curves of fluconazole (2 mg/mL) and terbinafine (4 mg/mL) and fluconazole/terbinafine (0.25 mg/mL) against Candida albicans ATCC 10231 at different time intervals.
Ghannoum & Rice, 1999; Perea et al., 2002; Scheid et al., 2012). Determination of MICs is a simple and reproducible approach that can be applied to show the ability of growth
4
A. Khodavandi et al.
Pharm Biol, Early Online: 1–5
b-ACT ERG1 ERG3
ERG11 2× MIC
1× MIC
1 /2 × MIC
1 /4 × MIC
Figure 3. Gel electrophoresis of semi-quantitative RT-PCR products of ERG genes from Candida albicans ATCC 10231 treated with fluconazole/terbinafine.
effect was observed in most of isolates tested and ranged from 0.13 to 0.25 (Table 2). The time kill curve showed a significant reduction (p50.05) the number of Candida comparing untreated controls for those fluconazole and terbinafine alone and in combination after 6 h incubation at 35 C. Interestingly, the terbinafine was almost as efficiently as fluconazole in terms of the growth of the yeast cells (p40.05) until 36 h incubation at 35 C, while fluconazole was significantly stronger than terbinafine (p50.05) after 42 h incubation at 35 C (Figure 2). This may be due to potential of azoles to destroy the membrane of Candida through the inhibition activities of both critical enzymes in ergosterol biosynthesis such as 14ademethylase and desaturase, while allylamine could inhibit the activity of squalene epoxidase only during ergosterol biosynthesis (Ghannoum & Rice, 1999; Lupetti et al., 2002). The combination therapy may be one of the viable therapeutic options due to increase of azole-resistance phenomena. The in vitro activities of fluconazole with terbinafine were reported by several investigations (Canto´n et al., 2005; Cavalheiro et al., 2009; Ghannoum & Elewski, 1999; Perea et al., 2002). All of them were persisted that the antifungal activity of fluconazole in combination with terbinafine could increase significantly and no antagonistic effects were observed. Nonetheless, the possible molecular mechanisms of those activities are not understood. In the present study, we have attempted to clear one of the probable mechanisms with a standard and accessible method. In fact, the relative expression level of transcript mRNA of genes involved in
Normalized rao (ERG3/ACT)
(B) 1.4 (A) Normalized rao (ERG1/ACT)
1.4 1.2 1 0.8 0.6 0.4 0.2
1.2 1 0.8 0.6 0.4 0.2 0
0 Untreated 1/4 MIC 1/2 MIC 1 MIC 2 MIC control Fluconazole/Terbinafine concentaraons
Untreated 1/4 MIC 1/2 MIC 1 MIC 2 MIC control Fluconazole/Terbinafine concentraons
(C) 1.6 Normalized rao (ERG11/ACT)
Pharmaceutical Biology Downloaded from informahealthcare.com by University of Maastricht on 06/15/14 For personal use only.
inhibition of Candida cells by antifungals. The MICs values for fluconazole alone ranged from 0.5 to 128 mg/mL (Table 2). Interestingly, most of clinical isolates were susceptible to fluconazole except one clinical isolate, while MICs of drugs in combination was significantly decreased and resistant was not observed. One of the best examples of this is fluconazoleresistant C. albicans clinical isolate (CI-5), where the MIC90 of this isolate is markedly decreased (512-fold) with the combination of fluconazole/terbinafine (Table 2). Meanwhile, FICs values also were demonstrated that terbinafine could be able to increase the antifungal activities of fluconazole when they were used in combination. This significant synergistic
1.4 1.2 1 0.8 0.6 0.4 0.2 0 Untreated control
1/4 MIC
1/2 MIC
1 MIC
2 MIC
Fluconazole/Terbinafine concentraons
Figure 4. Relative quantitation of ERG1 (A), ERG3 (B), and ERG11 (C) expression (normalized to house-keeping gene, actin) in Candida albicans ATCC 10231 after 24 h of treatment with different concentrations of fluconazole/terbinafine.
Pharmaceutical Biology Downloaded from informahealthcare.com by University of Maastricht on 06/15/14 For personal use only.
DOI: 10.3109/13880209.2014.900808
biosynthesis of ergosterol in the cell membrane of C. albicans was evaluated with fluconazole and terbinafine monotherapy or in combination using semi-quantitative RT-PCR. As explained above the main target of both fluconazole and terbinafine is the cell membrane of Candida. Indeed, squalene, a precursor of ergosterol, is converted to lanosterol with squalene epoxidase encoded by ERG1 gene. Squalene epoxidase is inhibited in the presence of allylamines resulting in cell membrane destruction (Lupetti et al., 2002; Pasrija et al., 2005). Our results showed that the expression level of ERG1 was significantly down-regulated (p50.05) after treatment of C. albicans ATCC 10231 (1.63–3.05 folds) with terbinafine alone, while the expression of those ERG3, 11 was not changed as expected (data not shown). In contrast, the expression level of ERG3, 11 was down-regulated significantly (p50.05) after treatment of C. albicans ATCC 10231 using fluconazole alone (2.02–3.96 and 2.39–4.46fold, respectively) and ERG1 was not significantly changed (data no shown). This is also justified by the role of fluconazole to inhibit the possible target genes including ERG3 and ERG11 (Geber et al., 1995; Ghannoum & Rice, 1999; Lupetti et al., 2002). Combination of fluconazole/terbinafine was decreased the expression level of all genes tested significantly at level p 0.05 in compared with the untreated control (Figures 3 and 4). Clearly, significant genes involved in ergosterol biosynthesis of C. albicans ATCC 10231 including ERG1, 3, and 11 were down-regulated ranged from 1.73- to 6.99-fold with combination therapy of fluconazole/terbinafine. Hence combination of fluconazole/terbinafine could destroy the cell membrane through the inhibition of all three key enzymes in ergosterol biosynthesis of C. albicans. Therefore, the ergosterol suppression by combination of fluconazole/terbinafine seems to be related to ERG genes. Further experiments need to be performed in order to investigate the effect of these combinations on other significant genes contributing to the cell membrane of C. albicans with different techniques such as relative real time RT-PCR and microarray tests.
Declaration of interest The authors declare that they have no competing interests.
References Al-Mohsen I, Hughes WT. (1998). Systemic antifungal therapy: Past, present and future. Ann Saudi Med 18:28–38.
Fluconazole in combination with terbinafine
5
Borecka´-Melkusova´ S, Moran GP, Sullivan DJ, et al. (2009). The expression of genes involved in the ergosterol biosynthesis pathway in Candida albicans and Candida dubliniensis biofilms exposed to fluconazole. Mycoses 52:118–28. Bruzual I, Riggle P, Hadley S, Kumamoto CA. (2007). Biofilm formation by fluconazole-resistant Candida albicans strains is inhibited by fluconazole. J Antimicrob Chemother 59:441–50. Canto´n E, Pema´n J, Gobernado M, et al. (2005). Synergistic activities of fluconazole and voriconazole with terbinafine against four Candida species determined by checkerboard, time-kill, and Etest methods. Antimicrob Agents Chemother 49:1593–6. Cavalheiro AS, Maboni G, de Azevedo MI, et al. (2009). In vitro activity of terbinafine combined with caspofungin and azoles against Pythium insidiosum. Antimicrob Agents Chemother 53:2136–8. Espinel-Ingroff A. (2008). Mechanisms of resistance to antifungal agents: Yeasts and filamentous fungi. Rev Iberoam Micol 25:101–6. Ferahbas A, Koc AN, Uksal U, et al. (2006). Terbinafine versus itraconazole and fluconazole in the treatment of vulvovaginal candidiasis. Am J Ther 13:332–6. Geber A, Hitchcock CA, Swartz JE, et al. (1995). Deletion of the Candida glabrata ERG3 and ERG11 genes: Effect on cell viability, cell growth, sterol composition, and antifungal susceptibility. Antimicrob Agents Chemother 39:2708–17. Ghannoum M, Elewski B. (1999). Successful treatment of fluconazoleresistant oropharyngeal candidiasis by a combination of fluconazole and terbinafine. Clin Diagn Lab Immun 6:921–3. Ghannoum MA, Rice LB. (1999). Antifungal agents: Mode of action, mechanisms of resistance, and correlation of these mechanisms with bacterial resistance. Clin Microbiol Rev 12:501–17. Khodavandi A, Alizadeh F, Harmal NS, et al. (2011). Expression analysis of SIR2 and SAPs1-4 gene expression in Candida albicans treated with allicin compared to fluconazole. Trop Biomed 28:589–98. Lupetti A, Danesi R, Campa M, et al. (2002). Molecular basis of resistance to azole antifungals. Trends Mol Med 8:76–81. Odds FC. (1996). Resistance of clinically important yeasts to antifungal agents. Int J Antimicrob Agents 6:145–7. Park S, Perlin DS. (2005). Establishing surrogate markers for fluconazole resistance in Candida albicans. Microb Drug Resist 11:232–8. Pasrija R, Krishnamurthy S, Prasad T, et al. (2005). Squalene epoxidase encoded by ERG1 affects morphogenesis and drug susceptibilities of Candida albicans. J Antimicrob Chemother 55:905–13. Perea S, Gonzalez G, Fothergill AW, Rinaldi MG. (2002). In vitro activities of terbinafine in combination with fluconazole, itraconazole, voriconazole, and posaconazole against clinical isolates of Candida glabrata with decreased susceptibility to azoles. J Clin Microbiol 40: 1831–3. Rossie K, Guggenheimer J. (1997). Oral candidiasis: Clinical manifestation, diagnosis, and treatment. Pract Periodontics Aesthet Dent 9: 635–41. Scheid LA, Mario DAN, Kubic¸a TF, et al. (2012). In vitro activities of antifungal agents alone and in combination against fluconazolesusceptible and resistant strains of Candida dubliniensis. Braz J Infect Dis 16:78–81. Spampinato C, Leonardi D. (2013). Candida infections, causes, targets, and resistance mechanisms: Traditional and alternative antifungal agents. Biomed Res Int 2013:204237. Yang YL. (2003). Virulence factors of Candida species. J Microbiol Immunol Infect 36:223–8.
