RESEARCH ARTICLE Molecular Reproduction & Development 81:462–469 (2014)
Porcine Natriuretic Peptide Type B (pNPPB) Maintains Mouse Oocyte Meiotic Arrest Via Natriuretic Peptide Receptor 2 (NPR2) in Cumulus Cells YU ZHANG, XIAOQIONG HAO, XI XIANG, KAIWEN WEI, GUOLIANG XIA,
AND
MEIJIA ZHANG*
State Key Laboratory for Agrobiotechnology, College of Biological Sciences, China Agricultural University, Beijing, People’s Republic of China
SUMMARY In mouse ovarian follicles, the oocyte is maintained in meiotic prophase arrest by natriuretic peptide type C (NPPC) acting via its cognate receptor, natriuretic peptide receptor 2 (NPR2). As there is a marked species difference in the receptor selectivity of the natriuretic peptide family, this study examined the functional effect of other natriuretic peptides, type A (NPPA) and type B (NPPB), acting via NPR2 on mouseoocyte meiotic arrest. The results by quantitative, reverse-transcriptase PCR showed that Npr2 was the predominant natriuretic peptide receptor transcript, and that Npr1 and Npr3 mRNA levels were negligible in cumulus cells isolated from equine chorionic gonadotropin (eCG)-primed, immature female mice. While NPPA and NPPB from human and rat had no effect on oocyte maturation, porcine NPPB (pNPPB) maintained oocyte meiotic arrest in a dose-dependent manner. Furthermore, pNPPBmediated meiotic arrest and cGMP production could be completely blocked by the NPR2 inhibitor sphingosine-1-phosphate (S1P). Neither the NPR1 antagonist anantin or Npr1 knockout had an effect on pNPPB-mediated meiotic arrest. Thus, pNPPB can functionally maintain mouse-oocyte meiotic arrest by the receptor NPR2 of cumulus cells. These findings demonstrate that pNPPB may be used as a probe to identify the essential amino acid sequences for activation of NPR2.
Mol. Reprod. Dev. 81: 462469, 2014. ß 2014 Wiley Periodicals, Inc. Received 18 November 2013; Accepted 5 February 2014
INTRODUCTION Full-grown mammalian oocytes in antral follicles acquire the ability to complete meiosis, but are held in meioticprophase arrest. Oocytes generate sufficient cyclic adenosine 30 ,50 -monophosphate (cAMP) to maintain meiotic arrest via the G-protein-coupled receptors (GPR) GPR3 and/or GPR12, which activate adenylyl cyclase (Mehlmann et al., 2004; Hinckley et al., 2005). Recent studies with genetically modified mice have revealed that natriuretic
ß 2014 WILEY PERIODICALS, INC.
Corresponding author: State Key Laboratory of Agro-Biotechnology College of Biological Science China Agricultural University 100193 Beijing People’s Republic of China. E-mail: [email protected]
Yu Zhang and Xiaoqiong Hao contributed equally to this work. Grant sponsor: National Basic Research Program of China; Grant numbers: 2012CB944401, 2014CB943202; Grant sponsor: National Natural Science Foundation of China; Grant number: 31272523
Published online 23 April 2014 in Wiley Online Library (wileyonlinelibrary.com). DOI 10.1002/mrd.22311
peptide type C (NPPC, also known as CNP) is essential for maintaining oocyte meiotic arrest (Zhang et al., 2010; Tsuji et al., 2012). NPPC produced by follicular mural
Abbreviations: cAMP, cyclic adenosine 30 ,50 -monophosphate; COC, cumulusoocyte complex; cGMP, cyclic guanosine 30 ,50 -monophosphate; eCG, equine chorionic gonadotropin; GVBD, germinal-vesicle breakdown; [p]NPPA/B/C, [porcine] natriuretic peptide type A/B/C; NPR1/2/3, natriuretic peptide receptor 1; PDE3A, phosphodiesterase 3A; S1P, sphingosine-1-phosphate.
pNPPB MAINTAINS MEIOTIC ARREST
granulosa cells stimulates the generation of cyclic guanosine 30 ,50 -monophosphate (cGMP) by cumulus-cell natriuretic peptide receptor 2 (NPR2). cGMP diffuses into the oocyte via gap junctions, and acts to maintain meiotic arrest by inhibiting phosphodiesterase 3A (PDE3A) activity and cAMP hydrolysis (Richards, 2001; Norris et al., 2009; Vaccari et al., 2009; Zhang and Xia, 2012). Estradiol promotes the expression of Npr2 in cumulus cells, and helps sustain NPPC-mediated meiotic arrest (Zhang et al., 2011). Additionally, loss-of-function mutants of either Nppc or Npr2 results in precocious resumption of meiosis by oocytes enclosed within antral follicles (Zhang et al., 2010; Tsuji et al., 2012; Geister et al., 2013). NPPC is expressed in a wide variety of central and peripheral tissues, and acts locally as an autocrine and paracrine regulator through NPR2, a guanylyl cyclasecoupled receptor (Koller et al., 1991; Zhang et al., 2010). In addition to NPPC, the natriuretic peptide family also includes natriuretic peptide type A (NPPA, also known as ANP) and natriuretic peptide type B (NPPB, also known as BNP) (Rosenzweig and Seidman, 1991). NPPA and NPPB are cardiac hormones predominantly synthesized in atrial and ventricular cardiomyocytes, respectively. They are released into circulation upon stretch, and play important roles in the regulation of cardiovascular homeostasis, primarily through the guanylyl cyclase-coupled receptor NPR1 (Suga et al., 1992). A third receptor, NPR3, is considered a clearance receptor for its lack of the intracellular guanylyl cyclase activity and its capacity for ligand-mediated internalization although data suggest it vre negatively couples to adenylyl cyclase via Gi (Lelie et al., 2006). NPR3 has a higher affinity for NPPC than for NPPA or NPPB, but it can bind to all three isoforms (Joffy and Rosner, 2005). Homology among the natriuretic peptides is mixed through phylogeny. The amino acid sequence of mammalian NPPA is highly conserved among species (Flynn et al., 1983; Kangawa and Matsuo, 1984) while the coding sequence of NPPC precursor cDNA is identical among human, mouse, rat, and pig (Ogawa et al., 1994). The sequence of NPPB, on the other hand, is divergent among species (Fig. 1) (Suga et al., 1992). Human, mouse, rat, porcine, bovine, goat, and dog NPPBs are respectively 32-, 45-, 45-, 26-, 35-, 29- and 32-amino acid peptides (Sudoh et al., 1988; Kambayashi et al., 1989, 1990; Nguyen et al., 1989; Potter et al., 2006; Peng et al., 2013). The potency of NPPB to trigger cGMP production depends not only on subtypes of the biologically active receptor, but also in the molecular structure of receptors expressed by different species. Porcine NPPB (pNPPB), for example, shows a high affinity for NPR2 in human mesangial cells and rat aortic smooth muscle cells based on cGMP production (Chang et al., 1989; Suga et al., 1992). Since the biological action and molecular form of NPPB are known to be markedly divergent among species, we examined the functional effect of NPPB on mouse oocyte meiotic arrest via the biologically active receptor NPR2 on cumulus cells.
Mol. Reprod. Dev. 81:462–469 (2014)
BY
NPR2
Figure 1. The amino acid sequences of natriuretic peptides NPPA, NPPB, and NPPC. Identical residues in NPPA or NPPB are boxed.
RESULTS The Expression Pattern of Transcripts Encoding Natriuretic Peptide Receptors in Cumulus Cells To clarify which subtype of the biologically active receptor is expressed in mouse cumulus cells, Npr1, Npr2, and Npr3 mRNA levels were measured by quantitative, reversetranscriptase PCR on RNA samples from cumulus cells of equine chorionic gonadotropin (eCG)-primed mice. Npr2 mRNA abundance was more than 2,500-fold higher than that of Npr1 and Npr3 mRNA (Fig. 2). Further, the expression of Npr1 and Npr3 mRNA was negligible in cumulus cells, consistent with previous studies that reported Npr1 and Npr3 mRNA are undetectable in mouse cumulus cells by in situ hybridization (Sriraman et al., 2006; Lee et al., 2013). Thus, NPR2 is the predominant natriuretic peptide receptor expressed in mouse cumulus cells.
Effects of Natriuretic Peptides on Meiotic Arrest Previous studies reveal the presence of a marked species difference in the receptor selectivity of the natriuretic peptide family, especially among NPPBs (Suga et al., 1992). Here, we investigated NPR2 selectivity for members of the natriuretic peptide family using a meiotic arrest assay involving cultured cumulus-oocyte-complexes (COCs). COCs were cultured for 4 hr in MEMa medium containing 100 nM natriuretic peptides from humans (hNPPA. hNPPB), rat (rNPPA, rNPPB), pig (pNPPB), and the positive-control, NPPC. At the end of the culture, oocyte meiotic resumption was evaluated by scoring released oocytes for germinal-vesicle breakdown (GVBD) after removal of cumulus cells. While hNPPA, rNPPA, hNPPB, and rNPPB had no effect on spontaneous meiotic resumption (Fig. 3), pNPPB maintained meiotic arrest as well as NPPC (Zhang et al., 2010). Tenfold more pNPPB (100 nM) was required to achieve a similar level of oocyte meiotic arrest as that of
463
Molecular Reproduction & Development
ZHANG
ET AL.
tory effect of 100 nM pNPPB on meiotic resumption decreased after 24 hr in culture (57.8%; Fig. 4B), and could be completely eliminated after further culture for 4 hr without the drug. pNPPB also had no effect on denuded oocyte maturation (Fig. 4C), consistent with the observation that the oocyte has negligible expression of the natriuretic peptide receptors (Zhang et al., 2010; Lee et al., 2013).
Contribution of NPR1 to pNPPB-Mediated Meiotic Arrest
Figure 2. Npr2 is the predominant natriuretic peptide receptor transcript in mouse cumulus cells. Quantitative, reverse-transcriptase PCR for natriuretic peptide receptor mRNA in cumulus cells from mice that were primed with eCG for 48 hr. Bars show the mean standard error of the mean of three independent samples. Bars with different letters are significantly different (P < 0.05).
The signaling activity of NPPB is thought to occur primarily through the guanylyl cyclase-coupled receptor NPR1 (Suga et al., 1992), thus we asked if NPR1 was involved in pNPPB-mediated meiotic arrest. As shown in Figure 5A, the NPR1 antagonist anantin (100 nM) could not reverse the inhibitory effect of pNPPB on oocyte meiotic resumption in wild-type (WT) mice. Furthermore, pNPPB also maintained meiotic arrest of COCs isolated from
10 nM NPPC, suggesting that the affinity of pNPPB for the NPR2 receptor is likely significantly lower than for NPPC.
Kinetics of pNPPB on Meiotic Arrest pNPPB inhibited oocyte meiotic resumption in a dosedependent manner [from 10 (82.5%) to 1,000 nM (10.9%)] compared to control (96.7%; Fig. 4A; P < 0.05). The inhibi-
Figure 3. Effects of natriuretic peptides on meiotic arrest of cumulus cell-enclosed oocytes. COCs isolated from eCG-primed mice were cultured for 4 hr in MEMa medium containing 100 nM NPPA (from human or rat), 100 nM NPPB (from human, rat, or porcine), or different doses of NPPC (from human), and assessed for GVBD. Both porcine NPPB (pNPPB) and human NPPC dramatically inhibited the resumption of meiosis whereas NPPA and NPPB from human and rat had no effect on oocyte maturation. Bars indicate the mean standard error of the mean of four independent experiments, with at least 40 COCs assessed per condition in each experiment. Bars with different letters are significantly different (P < 0.05).
464
Figure 4. Kinetics of pNPPB on meiotic arrest. A: COCs were cultured for 4 hr in medium containing different doses of pNPPB. pNPPB dosedependently inhibited meiotic resumption of COCs, with a maximum effect at 1,000 nM. ( P < 0.05, P < 0.001 compared to untreated control). B: COCs were cultured for 2, 4, 8, 16, or 24 hr in medium containing 100 nM pNPPB. In one experiment, COCs were incubated with pNPPB for 24 hr, and then in drug-free medium for another 4 hr ( P < 0.001 compared with corresponding control). C: Denuded oocytes (DO) were cultured for 4 hr in medium containing 100 nM pNPPB, and assessed for GVBD. Bars indicate the mean standard error of the mean of four independent experiments with at least 40 COCs assessed per condition in each experiment.
Mol. Reprod. Dev. 81:462–469 (2014)
pNPPB MAINTAINS MEIOTIC ARREST
Npr1tm1Gar/tm1Gar (NPR1 mutant) mice (Fig. 5B), suggesting that the biologically active receptor NPR1 is not involved in pNPPB-mediated meiotic arrest.
Contribution of NPR2 to pNPPB-Mediated Meiotic Arrest It is reported that pNPPB shows a high affinity for guanylyl cyclase-coupled receptor NPR2 in human mesangial cells and rat aortic smooth muscle cells (Suga et al., 1992). We therefore asked if NPR2 was involved in pNPPB-mediated meiotic arrest. The effect of NPR2 on pNPPB-mediated meiotic arrest was evaluated by sphingosine-1-phosphate (S1P), an inhibitor of NPR2 that acts in calcium-dependent manner (Abbey-Hosch et al., 2004; Garbers et al., 2006; Wang et al., 2013). As shown in Figure 6A, 40 mM S1P completely reversed the inhibitory effects of pNPPB and NPPC on oocyte meiotic resumption. In our previous study, estradiol stabilized NPPCmediated meiotic arrest by promoting the expression of
Figure 5. Effect of NPR1 on pNPPB-mediated meiotic arrest. A: COCs isolated from eCG-primed mice (NPR1 WT) were cultured for 4 hr in medium containing 100 nM pNPPB, and/or 100 nM anantin. B: COCs isolated from eCG-primed Npr1tm1Gar/tm1Gar (NPR1 mutant) mice were culture for 4 hr in medium containing 100 nM pNPPB. Bars indicate the mean standard error of the mean of three independent experiments, with at least 40 COCs assessed per condition in each experiment ( P < 0.001 compared with control). An, anantin.
Mol. Reprod. Dev. 81:462–469 (2014)
BY
NPR2
NPR2 and maintaining its function by cGMP production in cumulus cells (Zhang et al., 2011). So we also studied the effect of estradiol on pNPPB-mediated meiotic arrest. While more than 60% of the oocytes underwent GVBD after 24 hr of culture with 100 nM pNPPB, adding 100 nM estradiol could maintain pNPPB-mediated meiotic arrest (Fig. 6B). Thus, pNPPB maintains meiotic arrest through NPR2 on cumulus cells.
Effect of pNPPB on cGMP Levels in Cumulus Cells and Oocytes It is reported that NPPC maintains meiotic arrest by acting through NPR2 to increase cGMP levels in cumulus cells, which diffuses to oocytes (Zhang et al., 2010). To determine if pNPPB maintained meiotic arrest by cGMP production, COCs isolated from eCG-primed mice were
Figure 6. Effect of NPR2 on pNPPB-mediated meiotic arrest. A: COCs isolated from eCG-primed mice were cultured for 4 hr in medium containing 30 nM NPPC, 100 nM pNPPB, and/or 40 mM S1P. B: COCs were cultured with 100 nM pNPPB and/or 100 nM estradiol. The proportion of oocytes that underwent GVBD was determined at 4 and 24 hr of culture. Bars indicate the mean standard error of the mean of four independent experiments, with at least 40 COCs assessed per condition in each experiment. Bars with different letters are significantly different (P < 0.05).
465
Molecular Reproduction & Development
cultured in medium supplemented with 100 nM pNPPB and/or 40 mM S1P for 1 hr, and the levels of cGMP were measured in cumulus cells and oocytes. As shown in Figure 7, the cGMP levels in both cumulus and oocytes increased from pNPPB treatment, consistent with the previously observed effect of NPPC treatment (Zhang et al., 2010, 2011). pNPPB-promoted cGMP production was completely reversed by NPR2 inhibitor S1P (Fig. 7), however, suggesting that pNPPB increases cGMP levels through the activation of NPR2.
DISCUSSION NPPC-promoted cGMP production is essential for oocyte meiotic arrest, and acts through its cognate receptor NPR2. Here, we assessed the functional effect of other natriuretic peptide family members on meiotic arrest since the potency of the natriuretic peptide family for cGMP production is divergent among species. NPR2 was the predominant natriuretic peptide receptor in mouse cumulus cells, whereas expression was low for the other guanylyl cyclase-coupled receptor, NPR1. Of the natriuretic peptides tested, only pNPPB maintained oocyte meiotic arrest via cGMP production, and both phenotypes were reversed by the NPR2 inhibitor S1P. Thus, pNPPB maintains mouse oocyte meiotic arrest through the receptor NPR2 on cumulus cells. NPR2 was the predominant, biologically active natriuretic peptide receptor. NPR1 and NPR3 levels were low in mouse cumulus cells, consistent with previous studies that the expression of Npr1 and Npr3 mRNA is restricted to mural granulosa cells in the preovulatory follicle (Sriraman et al., 2006; Lee et al., 2013). cGMP produced
Figure 7. Effect of pNPPB on cGMP levels in cumulus cells and oocytes. COCs were cultured for 1 hr in medium containing 100 nM pNPPB and/or 40 mM S1P, then cGMP levels in cumulus cells and oocytes were quantified. Values indicate the mean standard error of the mean of three independent experiments, with at least 100 COCs assessed per condition in each experiment. ( P < 0.05 compared with control).
466
ZHANG
ET AL.
by NPPC/NPR2 passes through gap junctions into the oocyte, where it inhibits the hydrolysis of cAMP by PDE3A and thus blocks meiotic progression (Norris et al., 2009; Vaccari et al., 2009; Zhang et al., 2010). Although NPPC also has a high affinity for NPR3 (Joffy and Rosner, 2005), the expression of Npr3 mRNA levels was low in cumulus cells, and NPR3 lacks intracellular vre guanylyl cyclase activity (Porter et al., 1988; Lelie et al., 2006), so NPR3 might be not involved in this process of meiotic arrest. NPPA and NPPB are cardiac hormones that play important roles in the regulation of cardiovascular homeostasis, and act primarily via the biologically active receptor NPR1. NPPA and NPPB from human and rat had no effect on COCs maturation in the present study, consistent with the low expression of NPR1 in cumulus cells (Fig. 2) (Sriraman et al., 2006). These observations suggest that very little functional receptor NPR1 is present in cumulus cells. pNPPB, however, exhibited a marked species difference in light of the predicted receptor selectivity of the natriuretic peptide family, which is somewhat consistent with its sequence divergence among species (Suga et al., 1992). pNPPB is equipotent to NPPA in cGMP production when matched with a biologically active receptor NPR1 in humans (Chang et al., 1989) and in cattle (Suga et al., 1992). On the other hand, studies in monkey-derived COS-7 cells transfected with a cDNA expression vector revealed that the NPR1 receptor is more sensitive to NPPA than to pNPPB (Schulz et al., 1989). The NPR2 receptor is preferentially activated by pNPPB compared to NPPA in both humans (Chang et al., 1989) and rats (Schulz et al., 1989; Suga et al., 1992). In our study, pNPPB showed a similar effect to that of NPPC on cGMP production and oocyte meiotic arrest, and these effects could be blocked by the NPR2 inhibitor S1P. Furthermore, pNPPB-mediated meiotic arrest was also stabilized for at least 24 hr when estradiol was used to promote and maintain expression of NPR2 in cumulus cells (Zhang et al., 2011). Thus, pNPPB maintains meiotic arrest through the biologically active receptor NPR2 in mouse cumulus cells. These observations suggest that pNPPB has a higher affinity for mouse NPR2 compared with NPPA and human and rat NPPB. It is reported that the C-terminal 26-amino acid sequences of bovine and goat NPPB are identical to pNPPB, which is known to be the portion of NPPB essential for its biological action (Fig. 1) (Suga et al., 1992). It would therefore be of interest to test if these two NPPBs have the same affinity for NPR2 as that of pNPPB. Also, when a mouse NPPB becomes available, it will be important to compare the physiological effect of mouse NPPB on meiotic arrest through its native NPR2 in cumulus cells. Despite the potency of pNPPB for cGMP production by NPR2, among the non-native natriuretic peptides tested, it was less effective than NPPC in maintaining mouse oocyte meiotic arrest via NPR2 in cumulus cells. NPPC, acting through its endogenous NPR2 receptor, is also responsible for meiotic arrest in porcine oocytes (Hiradate et al., 2013). The hierarchy of cross-species activity we observed is consistent with previous studies that reported the
Mol. Reprod. Dev. 81:462–469 (2014)
pNPPB MAINTAINS MEIOTIC ARREST
requirement of relatively high amounts of pNPPB to elicit a response through NPR2 (Schulz et al., 1989; Suga et al., 1992). Thus, pNPPB may function as a partial agonist to the mouse NPR2 receptor. The functional effect of pNPPB through NPR2 provides new insight into our understanding of NPR2 activation, and gives rise to new clinical implications regarding the natriuretic peptide system. For example, as heterotopic heart transplants to non-human primates using organs from pig are under development, in a step towards clinical application (Kuwaki et al., 2005), there is the potential that physiologically active pNPPB from the grafted heart could affect other organ systems in the body. Clearly, this relationship between pNPPB and non-native NPR2 activation needs further study.
MATERIALS AND METHODS
BY
NPR2
culture, cumulus cells were stripped from the oocytes by gentle trituration in and out of glass pipettes whose diameter was slightly smaller than that of the oocytes. Oocytes were then examined for the presence or absence of a germinal vesicle (GV) using a stereomicroscope; the presence of a GV indicated that the oocyte had been maintained in meiotic arrest. GVBD, an indicator of meiotic resumption, was presented as the percentage of oocytes that had undergone GVBD or first polar body-extrusion by the end of culture. All the cultures were maintained at 378C in a modular incubation chamber (Billups Rothenberg, Del Mar, CA) infused with 5% O2, 5% CO2 and 90% N2. Each experiment was repeated more than three times. In the experiments for quantitative, reverse-transcriptase PCR, cumulus cells were isolated from eCG-primed, immature female mice. All samples were immediately frozen in liquid nitrogen and stored at 808C until analyzed for gene expression, as described below.
Animals (C57BL/6J X SJL/J)F1 mice raised in the colonies of the investigators were used in these studies. Npr1-knockout mice were obtained from The Jackson Laboratory (Bar Harbor, ME), and maintained in the investigators’ colony at China Agricultural University. Mice were used between the ages of 20 and 22 days. Homozygous-mutant 129Npr1tm1Gar/J (Npr1tm1Gar/Npr1tm1Gar) mice were produced by crossing heterozygous males and females. Npr1 mice were genotyped following the protocol described previously (http://jaxmice.jax.org/strain/004374.html). All animaltreatment procedures were approved by the Animal Care Committee of China Agricultural University, and all experiments were conducted in accordance with the guidelines for laboratory animals.
Chemicals All chemicals were purchased from SigmaAldrich (St. Louis, MO) unless otherwise noted. Natriuretic peptides rat NPPA (rNPPA, A8208), rat NPPB (rNPPB, B9901), pNPPB (B0777), human NPPA (hNPPA, A1663), human NPPB (hNPPB, B5900), human NPPC (N8768), and anantin were prepared as 10 mM stock solutions in phosphatebuffered saline (PBS). S1P was dissolved in ethanol, as described previously (Abbey-Hosch et al., 2004).COCs
Quantitative, Reverse-Transcriptase PCR Analysis Total RNA was isolated and purified from frozen samples using the RNeasy micro-RNA isolation kit (Qiagen, Valencia, CA), according to the manufacturer’s instructions. Reverse transcription was carried out directly after RNA isolation using the QuantiTek reverse transcription system (Qiagen). Quantitative, reverse-transcriptase PCR was then conducted to quantify the steady-state mRNA levels using an ABI 7500 real-time PCR instrument (Applied Biosystems, Foster City, CA). Real-time PCR analyses were carried out as described previously (Livak and Schmittgen, 2001; Sugiura et al., 2007). PCR primer sequences for Npr2, Npr3, and ribosomal protein L 19 (Rpl19) were reported previously (Zhang et al., 2010; Lee et al., 2013). Npr1 primer sequences were: (forward) 50 GTGCGTGAGCGACTCAACAT and (reverse) 50 GCATCCGGAGAACTGCAGAT. The identities of all amplicons were validated by sequencing the purified PCR products. Levels of mRNA were normalized to the abundance of the endogenous, control housekeeping transcript Rpl19. Relative levels of target gene expression for each sample were calculated using the formula 2DDCt , as described previously (Su et al., 2007).
Isolation and Culture of COCs
Measurement of cGMP Levels in Cumulus Cells and Oocytes
Ovaries from eCG-stimulated mice were immersed in culture medium supplemented with 4 mM hypoxanthine to prevent spontaneous meiotic resumption during the collection. Isolated cumulus COCs were washed in the medium of final incubation, and then cultured for spontaneous maturation in bicarbonate-buffered MEMa (Life Technologies, Inc., Grand Island, NY) with Earles’ salts, supplemented with 75 mg/ml penicillin G, 50 mg/ml streptomycin sulfate, 0.23 mM pyruvate, and 3 mg/ml bovine serum albumin. Groups of 4050 oocytes were transferred into individual wells of a four-well Nunclon dish (Nunclon; Nunc, Roskilde, Denmark) with 0.5-ml culture medium. At the termination of
COCs were incubated in MEMa medium with different treatments for 1 hr. Cumulus cells and their associated oocytes were manually dissociated from groups of 100200 COCs by pipetting with a small fine-bore pipette in culture medium containing 0.2 mM 3-isobutyl-1methylxanthine (IBMX). After washing with PBS, the samples were solubilized in 100 ml of 0.1 M HCl on ice for at least 10 min, snap frozen in liquid nitrogen, and transferred and stored at 808C. For cGMP assays, samples were thawed and centrifuged at 12,000g for 5 min. The supernatant was collected into a tube, and dried in an oven at 608C. The samples were then subjected to cGMP immunoassay by
Mol. Reprod. Dev. 81:462–469 (2014)
467
Molecular Reproduction & Development
ZHANG
ET AL.
the same protocol as described in our previous study (Zhang et al., 2010), using cGMP-EIA kits obtained from Cayman Chemicals (Ann Arbor, MI).
Kambayashi Y, Nakao K, Mukoyama M, Saito Y, Ogawa Y, Shiono S, Inouye K, Yoshida N, Imura H. 1990. Isolation and sequence determination of human brain natriuretic peptide in human atrium. FEBS Lett 259:341345.
Statistics
Kangawa K, Matsuo H. 1984. Purification and complete amino acid sequence of alpha-human atrial natriuretic polypeptide (alpha-hANP). Biochem Biophys Res Commun 118:131139.
Experiments were performed at least three times, and the values are given as the mean standard error of the mean. All proportional data were subjected to an arcsine transformation and analyzed by ANOVA using StatView software (SAS Institute, Inc., Cary, NC). P < 0.05 was considered statistically significant.
ACKNOWLEDGMENTS We thank Dr. John J. Eppig for his helpful suggestions.
REFERENCES Abbey-Hosch SE, Cody AN, Potter LR. 2004. Sphingosine-1phosphate inhibits C-type natriuretic peptide activation of guanylyl cyclase B (GC-B/NPR-B). Hypertension 43:11031109. Chang MS, Lowe DG, Lewis M, Hellmiss R, Chen E, Goeddel DV. 1989. Differential activation by atrial and brain natriuretic peptides of two different receptor guanylate cyclases. Nature 341:6872. Flynn TG, de Bold ML, de Bold AJ. 1983. The amino acid sequence of an atrial peptide with potent diuretic and natriuretic properties. Biochem Biophys Res Commun 117:859865. Garbers DL, Chrisman TD, Wiegn P, Katafuchi T, Albanesi JP, Bielinski V, Barylko B, Redfield MM, Burnett JC Jr. 2006. Membrane guanylyl cyclase receptors: An update. Trends Endocrinol Metab 17:251258. Geister KA, Brinkmeier ML, Hsieh M, Faust SM, Karolyi IJ, Perosky JE, Kozloff KM, Conti M, Camper SA. 2013. A novel loss-of-function mutation in Npr2 clarifies primary role in female reproduction and reveals a potential therapy for acromesomelic dysplasia, Maroteaux type. Hum Mol Genet 22:345357. Hinckley M, Vaccari S, Horner K, Chen R, Conti M. 2005. The G-protein-coupled receptors GPR3 and GPR12 are involved in cAMP signaling and maintenance of meiotic arrest in rodent oocytes. Dev Biol 287:249261. Hiradate Y, Hoshino Y, Tanemura K, Sato E. 2013. C-type natriuretic peptide inhibits porcine oocyte meiotic resumption. Zygote 16 [E-pub ahead of print]. Joffy S, Rosner MH. 2005. Natriuretic peptides in ESRD. Am J Kidney Dis 46:110. Kambayashi Y, Nakao K, Itoh H, Hosoda K, Saito Y, Yamada T, Mukoyama M, Arai H, Shirakami G, Suga S, Ogawa Y, Jougasaki M, Minamino N, Kangawa K, Matsuo H, Inouye K, Imura H. 1989. Isolation and sequence determination of rat cardiac natriuretic peptide. Biochem Biophys Res Commun 163: 233240.
468
Koller KJ, Lowe DG, Bennett GL, Minamino N, Kangawa K, Matsuo H, Goeddel DV. 1991. Selective activation of the B natriuretic peptide receptor by C-type natriuretic peptide (CNP). Science 252:120123. Kuwaki K, Tseng YL, Dor FJ, Shimizu A, Houser SL, Sanderson TM, Lancos CJ, Prabharasuth DD, Cheng J, Moran K, Hisashi Y, Mueller N, Yamada K, Greenstein JL, Hawley RJ, Patience C, Awwad M, Fishman JA, Robson SC, Schuurman HJ, Sachs DH, Cooper DK. 2005. Heart transplantation in baboons using alpha1,3-galactosyltransferase gene-knockout pigs as donors: Initial experience. Nat Med 11:2931. Lee KB, Zhang M, Sugiura K, Wigglesworth K, Uliasz T, Jaffe LA, Eppig JJ. 2013. Hormonal coordination of natriuretic peptide type C and natriuretic peptide receptor 3 expression in mouse granulosa cells. Biol Reprod 88:42. vre V, Hu Z, Ioffe Y, Byun JY, Flores A, Seksenyan A, Waschek Lelie JA. 2006. Paradoxical antagonism of PACAP receptor signaling by VIP in Xenopus oocytes via the type-C natriuretic peptide receptor. Cell Signal 18:20132021. Livak KJ, Schmittgen TD. 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 25:402408. Mehlmann LM, Saeki Y, Tanaka S, Brennan TJ, Evsikov AV, Pendola FL, Knowles BB, Eppig JJ, Jaffe LA. 2004. The Gslinked receptor GPR3 maintains meiotic arrest in mammalian oocytes. Science 306:19471950. Nguyen TT, Lazure C, Babinski K, Chretien M, Ong H, De Lean A. 1989. Aldosterone secretion inhibitory factor: A novel neuropeptide in bovine chromaffin cells. Endocrinology 124:15911593. Norris RP, Ratzan WJ, Freudzon M, Mehlmann LM, Krall J, Movsesian MA, Wang H, Ke H, Nikolaev VO, Jaffe LA. 2009. Cyclic GMP from the surrounding somatic cells regulates cyclic AMP and meiosis in the mouse oocyte. Development 136: 18691878. Ogawa Y, Itoh H, Yoshitake Y, Inoue M, Yoshimasa T, Serikawa T, Nakao K. 1994. Molecular cloning and chromosomal assignment of the mouse C-type natriuretic peptide (CNP) gene (Nppc): Comparison with the human CNP gene (NPPC). Genomics 24:383387. Peng JY, Xin HY, Han P, Zhao HB, Bai L, An XP, Cao BY. 2013. Identification and gene expression analyses of natriuretic peptide system in the ovary of goat (Capra hircus). Gene 524:105113. Porter JG, Wang Y, Schwartz K, Arfsten A, Loffredo A, Spratt K, Schenk DB, Fuller F, Scarborough RM, Lewicki JA. 1988.
Mol. Reprod. Dev. 81:462–469 (2014)
pNPPB MAINTAINS MEIOTIC ARREST
BY
NPR2
Characterization of the atrial natriuretic peptide clearance receptor using a vaccinia virus expression vector. J Biol Chem 263:1882718833.
Receptor selectivity of natriuretic peptide family, atrial natriuretic peptide, brain natriuretic peptide, and C-type natriuretic peptide. Endocrinology 130:229239.
Potter LR, Abbey-Hosch S, Dickey DM. 2006. Natriuretic peptides, their receptors, and cyclic guanosine monophosphatedependent signaling functions. Endocr Rev 27:4772.
Sugiura K, Su YQ, Diaz FJ, Pangas SA, Sharma S, Wigglesworth K, O’Brien MJ, Matzuk MM, Shimasaki S, Eppig JJ. 2007. Oocyte-derived BMP15 and FGFs cooperate to promote glycolysis in cumulus cells. Development 134:25932603.
Richards JS. 2001. New signaling pathways for hormones and cyclic adenosine 30 ,50 -monophosphate action in endocrine cells. Mol Endocrinol 15:209218. Rosenzweig A, Seidman CE. 1991. Atrial natriuretic factor and related peptide hormones. Annu Rev Biochem 60:229255. Schulz S, Singh S, Bellet RA, Singh G, Tubb DJ, Chin H, Garbers DL. 1989. The primary structure of a plasma membrane guanylate cyclase demonstrates diversity within this new receptor family. Cell 58:11551162. Sriraman V, Rudd MD, Lohmann SM, Mulders SM, Richards JS. 2006. Cyclic guanosine 50 -monophosphate-dependent protein kinase II is induced by luteinizing hormone and progesterone receptor-dependent mechanisms in granulosa cells and cumulus oocyte complexes of ovulating follicles. Mol Endocrinol 20:348361. Su YQ, Sugiura K, Woo Y, Wigglesworth K, Kamdar S, Affourtit J, Eppig JJ. 2007. Selective degradation of transcripts during meiotic maturation of mouse oocytes. Dev Biol 302:104117.
Tsuji T, Kiyosu C, Akiyama K, Kunieda T. 2012. CNP/NPR2 signaling maintains oocyte meiotic arrest in early antral follicles and is suppressed by EGFR-mediated signaling in preovulatory follicles. Mol Reprod Dev 79:795802. Vaccari S, Weeks JL II, Hsieh M, Menniti FS, Conti M. 2009. Cyclic GMP signaling is involved in the luteinizing hormone-dependent meiotic maturation of mouse oocytes. Biol Reprod 81:595604. Wang Y, Kong N, Li N, Hao X, Wei K, Xiang X, Xia G, Zhang M. 2013. Epidermal growth factor receptor signaling-dependent calcium elevation in cumulus cells is required for NPR2 inhibition and meiotic resumption in mouse oocytes. Endocrinology 154:34013409. Zhang M, Su YQ, Sugiura K, Wigglesworth K, Xia G, Eppig JJ. 2011. Estradiol promotes and maintains cumulus cell expression of natriuretic peptide receptor 2 (NPR2) and meiotic arrest in mouse oocytes in vitro. Endocrinology 152:43774385.
Sudoh T, Kangawa K, Minamino N, Matsuo H. 1988. A new natriuretic peptide in porcine brain. Nature 332:7881.
Zhang M, Su YQ, Sugiura K, Xia G, Eppig JJ. 2010. Granulosa cell ligand NPPC and its receptor NPR2 maintain meiotic arrest in mouse oocytes. Science 330:366369.
Suga S, Nakao K, Hosoda K, Mukoyama M, Ogawa Y, Shirakami G, Arai H, Saito Y, Kambayashi Y, Inouye K, Imura H. 1992.
Zhang M, Xia G. 2012. Hormonal control of mammalian oocyte meiosis at diplotene stage. Cell Mol Life Sci 69:12791288.
Mol. Reprod. Dev. 81:462–469 (2014)
469
Porcine Natriuretic Peptide Type B (pNPPB) Maintains Mouse Oocyte Meiotic Arrest Via Natriuretic Peptide Receptor 2 (NPR2) in Cumulus Cells YU ZHANG, XIAOQIONG HAO, XI XIANG, KAIWEN WEI, GUOLIANG XIA,
AND
MEIJIA ZHANG*
State Key Laboratory for Agrobiotechnology, College of Biological Sciences, China Agricultural University, Beijing, People’s Republic of China
SUMMARY In mouse ovarian follicles, the oocyte is maintained in meiotic prophase arrest by natriuretic peptide type C (NPPC) acting via its cognate receptor, natriuretic peptide receptor 2 (NPR2). As there is a marked species difference in the receptor selectivity of the natriuretic peptide family, this study examined the functional effect of other natriuretic peptides, type A (NPPA) and type B (NPPB), acting via NPR2 on mouseoocyte meiotic arrest. The results by quantitative, reverse-transcriptase PCR showed that Npr2 was the predominant natriuretic peptide receptor transcript, and that Npr1 and Npr3 mRNA levels were negligible in cumulus cells isolated from equine chorionic gonadotropin (eCG)-primed, immature female mice. While NPPA and NPPB from human and rat had no effect on oocyte maturation, porcine NPPB (pNPPB) maintained oocyte meiotic arrest in a dose-dependent manner. Furthermore, pNPPBmediated meiotic arrest and cGMP production could be completely blocked by the NPR2 inhibitor sphingosine-1-phosphate (S1P). Neither the NPR1 antagonist anantin or Npr1 knockout had an effect on pNPPB-mediated meiotic arrest. Thus, pNPPB can functionally maintain mouse-oocyte meiotic arrest by the receptor NPR2 of cumulus cells. These findings demonstrate that pNPPB may be used as a probe to identify the essential amino acid sequences for activation of NPR2.
Mol. Reprod. Dev. 81: 462469, 2014. ß 2014 Wiley Periodicals, Inc. Received 18 November 2013; Accepted 5 February 2014
INTRODUCTION Full-grown mammalian oocytes in antral follicles acquire the ability to complete meiosis, but are held in meioticprophase arrest. Oocytes generate sufficient cyclic adenosine 30 ,50 -monophosphate (cAMP) to maintain meiotic arrest via the G-protein-coupled receptors (GPR) GPR3 and/or GPR12, which activate adenylyl cyclase (Mehlmann et al., 2004; Hinckley et al., 2005). Recent studies with genetically modified mice have revealed that natriuretic
ß 2014 WILEY PERIODICALS, INC.
Corresponding author: State Key Laboratory of Agro-Biotechnology College of Biological Science China Agricultural University 100193 Beijing People’s Republic of China. E-mail: [email protected]
Yu Zhang and Xiaoqiong Hao contributed equally to this work. Grant sponsor: National Basic Research Program of China; Grant numbers: 2012CB944401, 2014CB943202; Grant sponsor: National Natural Science Foundation of China; Grant number: 31272523
Published online 23 April 2014 in Wiley Online Library (wileyonlinelibrary.com). DOI 10.1002/mrd.22311
peptide type C (NPPC, also known as CNP) is essential for maintaining oocyte meiotic arrest (Zhang et al., 2010; Tsuji et al., 2012). NPPC produced by follicular mural
Abbreviations: cAMP, cyclic adenosine 30 ,50 -monophosphate; COC, cumulusoocyte complex; cGMP, cyclic guanosine 30 ,50 -monophosphate; eCG, equine chorionic gonadotropin; GVBD, germinal-vesicle breakdown; [p]NPPA/B/C, [porcine] natriuretic peptide type A/B/C; NPR1/2/3, natriuretic peptide receptor 1; PDE3A, phosphodiesterase 3A; S1P, sphingosine-1-phosphate.
pNPPB MAINTAINS MEIOTIC ARREST
granulosa cells stimulates the generation of cyclic guanosine 30 ,50 -monophosphate (cGMP) by cumulus-cell natriuretic peptide receptor 2 (NPR2). cGMP diffuses into the oocyte via gap junctions, and acts to maintain meiotic arrest by inhibiting phosphodiesterase 3A (PDE3A) activity and cAMP hydrolysis (Richards, 2001; Norris et al., 2009; Vaccari et al., 2009; Zhang and Xia, 2012). Estradiol promotes the expression of Npr2 in cumulus cells, and helps sustain NPPC-mediated meiotic arrest (Zhang et al., 2011). Additionally, loss-of-function mutants of either Nppc or Npr2 results in precocious resumption of meiosis by oocytes enclosed within antral follicles (Zhang et al., 2010; Tsuji et al., 2012; Geister et al., 2013). NPPC is expressed in a wide variety of central and peripheral tissues, and acts locally as an autocrine and paracrine regulator through NPR2, a guanylyl cyclasecoupled receptor (Koller et al., 1991; Zhang et al., 2010). In addition to NPPC, the natriuretic peptide family also includes natriuretic peptide type A (NPPA, also known as ANP) and natriuretic peptide type B (NPPB, also known as BNP) (Rosenzweig and Seidman, 1991). NPPA and NPPB are cardiac hormones predominantly synthesized in atrial and ventricular cardiomyocytes, respectively. They are released into circulation upon stretch, and play important roles in the regulation of cardiovascular homeostasis, primarily through the guanylyl cyclase-coupled receptor NPR1 (Suga et al., 1992). A third receptor, NPR3, is considered a clearance receptor for its lack of the intracellular guanylyl cyclase activity and its capacity for ligand-mediated internalization although data suggest it vre negatively couples to adenylyl cyclase via Gi (Lelie et al., 2006). NPR3 has a higher affinity for NPPC than for NPPA or NPPB, but it can bind to all three isoforms (Joffy and Rosner, 2005). Homology among the natriuretic peptides is mixed through phylogeny. The amino acid sequence of mammalian NPPA is highly conserved among species (Flynn et al., 1983; Kangawa and Matsuo, 1984) while the coding sequence of NPPC precursor cDNA is identical among human, mouse, rat, and pig (Ogawa et al., 1994). The sequence of NPPB, on the other hand, is divergent among species (Fig. 1) (Suga et al., 1992). Human, mouse, rat, porcine, bovine, goat, and dog NPPBs are respectively 32-, 45-, 45-, 26-, 35-, 29- and 32-amino acid peptides (Sudoh et al., 1988; Kambayashi et al., 1989, 1990; Nguyen et al., 1989; Potter et al., 2006; Peng et al., 2013). The potency of NPPB to trigger cGMP production depends not only on subtypes of the biologically active receptor, but also in the molecular structure of receptors expressed by different species. Porcine NPPB (pNPPB), for example, shows a high affinity for NPR2 in human mesangial cells and rat aortic smooth muscle cells based on cGMP production (Chang et al., 1989; Suga et al., 1992). Since the biological action and molecular form of NPPB are known to be markedly divergent among species, we examined the functional effect of NPPB on mouse oocyte meiotic arrest via the biologically active receptor NPR2 on cumulus cells.
Mol. Reprod. Dev. 81:462–469 (2014)
BY
NPR2
Figure 1. The amino acid sequences of natriuretic peptides NPPA, NPPB, and NPPC. Identical residues in NPPA or NPPB are boxed.
RESULTS The Expression Pattern of Transcripts Encoding Natriuretic Peptide Receptors in Cumulus Cells To clarify which subtype of the biologically active receptor is expressed in mouse cumulus cells, Npr1, Npr2, and Npr3 mRNA levels were measured by quantitative, reversetranscriptase PCR on RNA samples from cumulus cells of equine chorionic gonadotropin (eCG)-primed mice. Npr2 mRNA abundance was more than 2,500-fold higher than that of Npr1 and Npr3 mRNA (Fig. 2). Further, the expression of Npr1 and Npr3 mRNA was negligible in cumulus cells, consistent with previous studies that reported Npr1 and Npr3 mRNA are undetectable in mouse cumulus cells by in situ hybridization (Sriraman et al., 2006; Lee et al., 2013). Thus, NPR2 is the predominant natriuretic peptide receptor expressed in mouse cumulus cells.
Effects of Natriuretic Peptides on Meiotic Arrest Previous studies reveal the presence of a marked species difference in the receptor selectivity of the natriuretic peptide family, especially among NPPBs (Suga et al., 1992). Here, we investigated NPR2 selectivity for members of the natriuretic peptide family using a meiotic arrest assay involving cultured cumulus-oocyte-complexes (COCs). COCs were cultured for 4 hr in MEMa medium containing 100 nM natriuretic peptides from humans (hNPPA. hNPPB), rat (rNPPA, rNPPB), pig (pNPPB), and the positive-control, NPPC. At the end of the culture, oocyte meiotic resumption was evaluated by scoring released oocytes for germinal-vesicle breakdown (GVBD) after removal of cumulus cells. While hNPPA, rNPPA, hNPPB, and rNPPB had no effect on spontaneous meiotic resumption (Fig. 3), pNPPB maintained meiotic arrest as well as NPPC (Zhang et al., 2010). Tenfold more pNPPB (100 nM) was required to achieve a similar level of oocyte meiotic arrest as that of
463
Molecular Reproduction & Development
ZHANG
ET AL.
tory effect of 100 nM pNPPB on meiotic resumption decreased after 24 hr in culture (57.8%; Fig. 4B), and could be completely eliminated after further culture for 4 hr without the drug. pNPPB also had no effect on denuded oocyte maturation (Fig. 4C), consistent with the observation that the oocyte has negligible expression of the natriuretic peptide receptors (Zhang et al., 2010; Lee et al., 2013).
Contribution of NPR1 to pNPPB-Mediated Meiotic Arrest
Figure 2. Npr2 is the predominant natriuretic peptide receptor transcript in mouse cumulus cells. Quantitative, reverse-transcriptase PCR for natriuretic peptide receptor mRNA in cumulus cells from mice that were primed with eCG for 48 hr. Bars show the mean standard error of the mean of three independent samples. Bars with different letters are significantly different (P < 0.05).
The signaling activity of NPPB is thought to occur primarily through the guanylyl cyclase-coupled receptor NPR1 (Suga et al., 1992), thus we asked if NPR1 was involved in pNPPB-mediated meiotic arrest. As shown in Figure 5A, the NPR1 antagonist anantin (100 nM) could not reverse the inhibitory effect of pNPPB on oocyte meiotic resumption in wild-type (WT) mice. Furthermore, pNPPB also maintained meiotic arrest of COCs isolated from
10 nM NPPC, suggesting that the affinity of pNPPB for the NPR2 receptor is likely significantly lower than for NPPC.
Kinetics of pNPPB on Meiotic Arrest pNPPB inhibited oocyte meiotic resumption in a dosedependent manner [from 10 (82.5%) to 1,000 nM (10.9%)] compared to control (96.7%; Fig. 4A; P < 0.05). The inhibi-
Figure 3. Effects of natriuretic peptides on meiotic arrest of cumulus cell-enclosed oocytes. COCs isolated from eCG-primed mice were cultured for 4 hr in MEMa medium containing 100 nM NPPA (from human or rat), 100 nM NPPB (from human, rat, or porcine), or different doses of NPPC (from human), and assessed for GVBD. Both porcine NPPB (pNPPB) and human NPPC dramatically inhibited the resumption of meiosis whereas NPPA and NPPB from human and rat had no effect on oocyte maturation. Bars indicate the mean standard error of the mean of four independent experiments, with at least 40 COCs assessed per condition in each experiment. Bars with different letters are significantly different (P < 0.05).
464
Figure 4. Kinetics of pNPPB on meiotic arrest. A: COCs were cultured for 4 hr in medium containing different doses of pNPPB. pNPPB dosedependently inhibited meiotic resumption of COCs, with a maximum effect at 1,000 nM. ( P < 0.05, P < 0.001 compared to untreated control). B: COCs were cultured for 2, 4, 8, 16, or 24 hr in medium containing 100 nM pNPPB. In one experiment, COCs were incubated with pNPPB for 24 hr, and then in drug-free medium for another 4 hr ( P < 0.001 compared with corresponding control). C: Denuded oocytes (DO) were cultured for 4 hr in medium containing 100 nM pNPPB, and assessed for GVBD. Bars indicate the mean standard error of the mean of four independent experiments with at least 40 COCs assessed per condition in each experiment.
Mol. Reprod. Dev. 81:462–469 (2014)
pNPPB MAINTAINS MEIOTIC ARREST
Npr1tm1Gar/tm1Gar (NPR1 mutant) mice (Fig. 5B), suggesting that the biologically active receptor NPR1 is not involved in pNPPB-mediated meiotic arrest.
Contribution of NPR2 to pNPPB-Mediated Meiotic Arrest It is reported that pNPPB shows a high affinity for guanylyl cyclase-coupled receptor NPR2 in human mesangial cells and rat aortic smooth muscle cells (Suga et al., 1992). We therefore asked if NPR2 was involved in pNPPB-mediated meiotic arrest. The effect of NPR2 on pNPPB-mediated meiotic arrest was evaluated by sphingosine-1-phosphate (S1P), an inhibitor of NPR2 that acts in calcium-dependent manner (Abbey-Hosch et al., 2004; Garbers et al., 2006; Wang et al., 2013). As shown in Figure 6A, 40 mM S1P completely reversed the inhibitory effects of pNPPB and NPPC on oocyte meiotic resumption. In our previous study, estradiol stabilized NPPCmediated meiotic arrest by promoting the expression of
Figure 5. Effect of NPR1 on pNPPB-mediated meiotic arrest. A: COCs isolated from eCG-primed mice (NPR1 WT) were cultured for 4 hr in medium containing 100 nM pNPPB, and/or 100 nM anantin. B: COCs isolated from eCG-primed Npr1tm1Gar/tm1Gar (NPR1 mutant) mice were culture for 4 hr in medium containing 100 nM pNPPB. Bars indicate the mean standard error of the mean of three independent experiments, with at least 40 COCs assessed per condition in each experiment ( P < 0.001 compared with control). An, anantin.
Mol. Reprod. Dev. 81:462–469 (2014)
BY
NPR2
NPR2 and maintaining its function by cGMP production in cumulus cells (Zhang et al., 2011). So we also studied the effect of estradiol on pNPPB-mediated meiotic arrest. While more than 60% of the oocytes underwent GVBD after 24 hr of culture with 100 nM pNPPB, adding 100 nM estradiol could maintain pNPPB-mediated meiotic arrest (Fig. 6B). Thus, pNPPB maintains meiotic arrest through NPR2 on cumulus cells.
Effect of pNPPB on cGMP Levels in Cumulus Cells and Oocytes It is reported that NPPC maintains meiotic arrest by acting through NPR2 to increase cGMP levels in cumulus cells, which diffuses to oocytes (Zhang et al., 2010). To determine if pNPPB maintained meiotic arrest by cGMP production, COCs isolated from eCG-primed mice were
Figure 6. Effect of NPR2 on pNPPB-mediated meiotic arrest. A: COCs isolated from eCG-primed mice were cultured for 4 hr in medium containing 30 nM NPPC, 100 nM pNPPB, and/or 40 mM S1P. B: COCs were cultured with 100 nM pNPPB and/or 100 nM estradiol. The proportion of oocytes that underwent GVBD was determined at 4 and 24 hr of culture. Bars indicate the mean standard error of the mean of four independent experiments, with at least 40 COCs assessed per condition in each experiment. Bars with different letters are significantly different (P < 0.05).
465
Molecular Reproduction & Development
cultured in medium supplemented with 100 nM pNPPB and/or 40 mM S1P for 1 hr, and the levels of cGMP were measured in cumulus cells and oocytes. As shown in Figure 7, the cGMP levels in both cumulus and oocytes increased from pNPPB treatment, consistent with the previously observed effect of NPPC treatment (Zhang et al., 2010, 2011). pNPPB-promoted cGMP production was completely reversed by NPR2 inhibitor S1P (Fig. 7), however, suggesting that pNPPB increases cGMP levels through the activation of NPR2.
DISCUSSION NPPC-promoted cGMP production is essential for oocyte meiotic arrest, and acts through its cognate receptor NPR2. Here, we assessed the functional effect of other natriuretic peptide family members on meiotic arrest since the potency of the natriuretic peptide family for cGMP production is divergent among species. NPR2 was the predominant natriuretic peptide receptor in mouse cumulus cells, whereas expression was low for the other guanylyl cyclase-coupled receptor, NPR1. Of the natriuretic peptides tested, only pNPPB maintained oocyte meiotic arrest via cGMP production, and both phenotypes were reversed by the NPR2 inhibitor S1P. Thus, pNPPB maintains mouse oocyte meiotic arrest through the receptor NPR2 on cumulus cells. NPR2 was the predominant, biologically active natriuretic peptide receptor. NPR1 and NPR3 levels were low in mouse cumulus cells, consistent with previous studies that the expression of Npr1 and Npr3 mRNA is restricted to mural granulosa cells in the preovulatory follicle (Sriraman et al., 2006; Lee et al., 2013). cGMP produced
Figure 7. Effect of pNPPB on cGMP levels in cumulus cells and oocytes. COCs were cultured for 1 hr in medium containing 100 nM pNPPB and/or 40 mM S1P, then cGMP levels in cumulus cells and oocytes were quantified. Values indicate the mean standard error of the mean of three independent experiments, with at least 100 COCs assessed per condition in each experiment. ( P < 0.05 compared with control).
466
ZHANG
ET AL.
by NPPC/NPR2 passes through gap junctions into the oocyte, where it inhibits the hydrolysis of cAMP by PDE3A and thus blocks meiotic progression (Norris et al., 2009; Vaccari et al., 2009; Zhang et al., 2010). Although NPPC also has a high affinity for NPR3 (Joffy and Rosner, 2005), the expression of Npr3 mRNA levels was low in cumulus cells, and NPR3 lacks intracellular vre guanylyl cyclase activity (Porter et al., 1988; Lelie et al., 2006), so NPR3 might be not involved in this process of meiotic arrest. NPPA and NPPB are cardiac hormones that play important roles in the regulation of cardiovascular homeostasis, and act primarily via the biologically active receptor NPR1. NPPA and NPPB from human and rat had no effect on COCs maturation in the present study, consistent with the low expression of NPR1 in cumulus cells (Fig. 2) (Sriraman et al., 2006). These observations suggest that very little functional receptor NPR1 is present in cumulus cells. pNPPB, however, exhibited a marked species difference in light of the predicted receptor selectivity of the natriuretic peptide family, which is somewhat consistent with its sequence divergence among species (Suga et al., 1992). pNPPB is equipotent to NPPA in cGMP production when matched with a biologically active receptor NPR1 in humans (Chang et al., 1989) and in cattle (Suga et al., 1992). On the other hand, studies in monkey-derived COS-7 cells transfected with a cDNA expression vector revealed that the NPR1 receptor is more sensitive to NPPA than to pNPPB (Schulz et al., 1989). The NPR2 receptor is preferentially activated by pNPPB compared to NPPA in both humans (Chang et al., 1989) and rats (Schulz et al., 1989; Suga et al., 1992). In our study, pNPPB showed a similar effect to that of NPPC on cGMP production and oocyte meiotic arrest, and these effects could be blocked by the NPR2 inhibitor S1P. Furthermore, pNPPB-mediated meiotic arrest was also stabilized for at least 24 hr when estradiol was used to promote and maintain expression of NPR2 in cumulus cells (Zhang et al., 2011). Thus, pNPPB maintains meiotic arrest through the biologically active receptor NPR2 in mouse cumulus cells. These observations suggest that pNPPB has a higher affinity for mouse NPR2 compared with NPPA and human and rat NPPB. It is reported that the C-terminal 26-amino acid sequences of bovine and goat NPPB are identical to pNPPB, which is known to be the portion of NPPB essential for its biological action (Fig. 1) (Suga et al., 1992). It would therefore be of interest to test if these two NPPBs have the same affinity for NPR2 as that of pNPPB. Also, when a mouse NPPB becomes available, it will be important to compare the physiological effect of mouse NPPB on meiotic arrest through its native NPR2 in cumulus cells. Despite the potency of pNPPB for cGMP production by NPR2, among the non-native natriuretic peptides tested, it was less effective than NPPC in maintaining mouse oocyte meiotic arrest via NPR2 in cumulus cells. NPPC, acting through its endogenous NPR2 receptor, is also responsible for meiotic arrest in porcine oocytes (Hiradate et al., 2013). The hierarchy of cross-species activity we observed is consistent with previous studies that reported the
Mol. Reprod. Dev. 81:462–469 (2014)
pNPPB MAINTAINS MEIOTIC ARREST
requirement of relatively high amounts of pNPPB to elicit a response through NPR2 (Schulz et al., 1989; Suga et al., 1992). Thus, pNPPB may function as a partial agonist to the mouse NPR2 receptor. The functional effect of pNPPB through NPR2 provides new insight into our understanding of NPR2 activation, and gives rise to new clinical implications regarding the natriuretic peptide system. For example, as heterotopic heart transplants to non-human primates using organs from pig are under development, in a step towards clinical application (Kuwaki et al., 2005), there is the potential that physiologically active pNPPB from the grafted heart could affect other organ systems in the body. Clearly, this relationship between pNPPB and non-native NPR2 activation needs further study.
MATERIALS AND METHODS
BY
NPR2
culture, cumulus cells were stripped from the oocytes by gentle trituration in and out of glass pipettes whose diameter was slightly smaller than that of the oocytes. Oocytes were then examined for the presence or absence of a germinal vesicle (GV) using a stereomicroscope; the presence of a GV indicated that the oocyte had been maintained in meiotic arrest. GVBD, an indicator of meiotic resumption, was presented as the percentage of oocytes that had undergone GVBD or first polar body-extrusion by the end of culture. All the cultures were maintained at 378C in a modular incubation chamber (Billups Rothenberg, Del Mar, CA) infused with 5% O2, 5% CO2 and 90% N2. Each experiment was repeated more than three times. In the experiments for quantitative, reverse-transcriptase PCR, cumulus cells were isolated from eCG-primed, immature female mice. All samples were immediately frozen in liquid nitrogen and stored at 808C until analyzed for gene expression, as described below.
Animals (C57BL/6J X SJL/J)F1 mice raised in the colonies of the investigators were used in these studies. Npr1-knockout mice were obtained from The Jackson Laboratory (Bar Harbor, ME), and maintained in the investigators’ colony at China Agricultural University. Mice were used between the ages of 20 and 22 days. Homozygous-mutant 129Npr1tm1Gar/J (Npr1tm1Gar/Npr1tm1Gar) mice were produced by crossing heterozygous males and females. Npr1 mice were genotyped following the protocol described previously (http://jaxmice.jax.org/strain/004374.html). All animaltreatment procedures were approved by the Animal Care Committee of China Agricultural University, and all experiments were conducted in accordance with the guidelines for laboratory animals.
Chemicals All chemicals were purchased from SigmaAldrich (St. Louis, MO) unless otherwise noted. Natriuretic peptides rat NPPA (rNPPA, A8208), rat NPPB (rNPPB, B9901), pNPPB (B0777), human NPPA (hNPPA, A1663), human NPPB (hNPPB, B5900), human NPPC (N8768), and anantin were prepared as 10 mM stock solutions in phosphatebuffered saline (PBS). S1P was dissolved in ethanol, as described previously (Abbey-Hosch et al., 2004).COCs
Quantitative, Reverse-Transcriptase PCR Analysis Total RNA was isolated and purified from frozen samples using the RNeasy micro-RNA isolation kit (Qiagen, Valencia, CA), according to the manufacturer’s instructions. Reverse transcription was carried out directly after RNA isolation using the QuantiTek reverse transcription system (Qiagen). Quantitative, reverse-transcriptase PCR was then conducted to quantify the steady-state mRNA levels using an ABI 7500 real-time PCR instrument (Applied Biosystems, Foster City, CA). Real-time PCR analyses were carried out as described previously (Livak and Schmittgen, 2001; Sugiura et al., 2007). PCR primer sequences for Npr2, Npr3, and ribosomal protein L 19 (Rpl19) were reported previously (Zhang et al., 2010; Lee et al., 2013). Npr1 primer sequences were: (forward) 50 GTGCGTGAGCGACTCAACAT and (reverse) 50 GCATCCGGAGAACTGCAGAT. The identities of all amplicons were validated by sequencing the purified PCR products. Levels of mRNA were normalized to the abundance of the endogenous, control housekeeping transcript Rpl19. Relative levels of target gene expression for each sample were calculated using the formula 2DDCt , as described previously (Su et al., 2007).
Isolation and Culture of COCs
Measurement of cGMP Levels in Cumulus Cells and Oocytes
Ovaries from eCG-stimulated mice were immersed in culture medium supplemented with 4 mM hypoxanthine to prevent spontaneous meiotic resumption during the collection. Isolated cumulus COCs were washed in the medium of final incubation, and then cultured for spontaneous maturation in bicarbonate-buffered MEMa (Life Technologies, Inc., Grand Island, NY) with Earles’ salts, supplemented with 75 mg/ml penicillin G, 50 mg/ml streptomycin sulfate, 0.23 mM pyruvate, and 3 mg/ml bovine serum albumin. Groups of 4050 oocytes were transferred into individual wells of a four-well Nunclon dish (Nunclon; Nunc, Roskilde, Denmark) with 0.5-ml culture medium. At the termination of
COCs were incubated in MEMa medium with different treatments for 1 hr. Cumulus cells and their associated oocytes were manually dissociated from groups of 100200 COCs by pipetting with a small fine-bore pipette in culture medium containing 0.2 mM 3-isobutyl-1methylxanthine (IBMX). After washing with PBS, the samples were solubilized in 100 ml of 0.1 M HCl on ice for at least 10 min, snap frozen in liquid nitrogen, and transferred and stored at 808C. For cGMP assays, samples were thawed and centrifuged at 12,000g for 5 min. The supernatant was collected into a tube, and dried in an oven at 608C. The samples were then subjected to cGMP immunoassay by
Mol. Reprod. Dev. 81:462–469 (2014)
467
Molecular Reproduction & Development
ZHANG
ET AL.
the same protocol as described in our previous study (Zhang et al., 2010), using cGMP-EIA kits obtained from Cayman Chemicals (Ann Arbor, MI).
Kambayashi Y, Nakao K, Mukoyama M, Saito Y, Ogawa Y, Shiono S, Inouye K, Yoshida N, Imura H. 1990. Isolation and sequence determination of human brain natriuretic peptide in human atrium. FEBS Lett 259:341345.
Statistics
Kangawa K, Matsuo H. 1984. Purification and complete amino acid sequence of alpha-human atrial natriuretic polypeptide (alpha-hANP). Biochem Biophys Res Commun 118:131139.
Experiments were performed at least three times, and the values are given as the mean standard error of the mean. All proportional data were subjected to an arcsine transformation and analyzed by ANOVA using StatView software (SAS Institute, Inc., Cary, NC). P < 0.05 was considered statistically significant.
ACKNOWLEDGMENTS We thank Dr. John J. Eppig for his helpful suggestions.
REFERENCES Abbey-Hosch SE, Cody AN, Potter LR. 2004. Sphingosine-1phosphate inhibits C-type natriuretic peptide activation of guanylyl cyclase B (GC-B/NPR-B). Hypertension 43:11031109. Chang MS, Lowe DG, Lewis M, Hellmiss R, Chen E, Goeddel DV. 1989. Differential activation by atrial and brain natriuretic peptides of two different receptor guanylate cyclases. Nature 341:6872. Flynn TG, de Bold ML, de Bold AJ. 1983. The amino acid sequence of an atrial peptide with potent diuretic and natriuretic properties. Biochem Biophys Res Commun 117:859865. Garbers DL, Chrisman TD, Wiegn P, Katafuchi T, Albanesi JP, Bielinski V, Barylko B, Redfield MM, Burnett JC Jr. 2006. Membrane guanylyl cyclase receptors: An update. Trends Endocrinol Metab 17:251258. Geister KA, Brinkmeier ML, Hsieh M, Faust SM, Karolyi IJ, Perosky JE, Kozloff KM, Conti M, Camper SA. 2013. A novel loss-of-function mutation in Npr2 clarifies primary role in female reproduction and reveals a potential therapy for acromesomelic dysplasia, Maroteaux type. Hum Mol Genet 22:345357. Hinckley M, Vaccari S, Horner K, Chen R, Conti M. 2005. The G-protein-coupled receptors GPR3 and GPR12 are involved in cAMP signaling and maintenance of meiotic arrest in rodent oocytes. Dev Biol 287:249261. Hiradate Y, Hoshino Y, Tanemura K, Sato E. 2013. C-type natriuretic peptide inhibits porcine oocyte meiotic resumption. Zygote 16 [E-pub ahead of print]. Joffy S, Rosner MH. 2005. Natriuretic peptides in ESRD. Am J Kidney Dis 46:110. Kambayashi Y, Nakao K, Itoh H, Hosoda K, Saito Y, Yamada T, Mukoyama M, Arai H, Shirakami G, Suga S, Ogawa Y, Jougasaki M, Minamino N, Kangawa K, Matsuo H, Inouye K, Imura H. 1989. Isolation and sequence determination of rat cardiac natriuretic peptide. Biochem Biophys Res Commun 163: 233240.
468
Koller KJ, Lowe DG, Bennett GL, Minamino N, Kangawa K, Matsuo H, Goeddel DV. 1991. Selective activation of the B natriuretic peptide receptor by C-type natriuretic peptide (CNP). Science 252:120123. Kuwaki K, Tseng YL, Dor FJ, Shimizu A, Houser SL, Sanderson TM, Lancos CJ, Prabharasuth DD, Cheng J, Moran K, Hisashi Y, Mueller N, Yamada K, Greenstein JL, Hawley RJ, Patience C, Awwad M, Fishman JA, Robson SC, Schuurman HJ, Sachs DH, Cooper DK. 2005. Heart transplantation in baboons using alpha1,3-galactosyltransferase gene-knockout pigs as donors: Initial experience. Nat Med 11:2931. Lee KB, Zhang M, Sugiura K, Wigglesworth K, Uliasz T, Jaffe LA, Eppig JJ. 2013. Hormonal coordination of natriuretic peptide type C and natriuretic peptide receptor 3 expression in mouse granulosa cells. Biol Reprod 88:42. vre V, Hu Z, Ioffe Y, Byun JY, Flores A, Seksenyan A, Waschek Lelie JA. 2006. Paradoxical antagonism of PACAP receptor signaling by VIP in Xenopus oocytes via the type-C natriuretic peptide receptor. Cell Signal 18:20132021. Livak KJ, Schmittgen TD. 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 25:402408. Mehlmann LM, Saeki Y, Tanaka S, Brennan TJ, Evsikov AV, Pendola FL, Knowles BB, Eppig JJ, Jaffe LA. 2004. The Gslinked receptor GPR3 maintains meiotic arrest in mammalian oocytes. Science 306:19471950. Nguyen TT, Lazure C, Babinski K, Chretien M, Ong H, De Lean A. 1989. Aldosterone secretion inhibitory factor: A novel neuropeptide in bovine chromaffin cells. Endocrinology 124:15911593. Norris RP, Ratzan WJ, Freudzon M, Mehlmann LM, Krall J, Movsesian MA, Wang H, Ke H, Nikolaev VO, Jaffe LA. 2009. Cyclic GMP from the surrounding somatic cells regulates cyclic AMP and meiosis in the mouse oocyte. Development 136: 18691878. Ogawa Y, Itoh H, Yoshitake Y, Inoue M, Yoshimasa T, Serikawa T, Nakao K. 1994. Molecular cloning and chromosomal assignment of the mouse C-type natriuretic peptide (CNP) gene (Nppc): Comparison with the human CNP gene (NPPC). Genomics 24:383387. Peng JY, Xin HY, Han P, Zhao HB, Bai L, An XP, Cao BY. 2013. Identification and gene expression analyses of natriuretic peptide system in the ovary of goat (Capra hircus). Gene 524:105113. Porter JG, Wang Y, Schwartz K, Arfsten A, Loffredo A, Spratt K, Schenk DB, Fuller F, Scarborough RM, Lewicki JA. 1988.
Mol. Reprod. Dev. 81:462–469 (2014)
pNPPB MAINTAINS MEIOTIC ARREST
BY
NPR2
Characterization of the atrial natriuretic peptide clearance receptor using a vaccinia virus expression vector. J Biol Chem 263:1882718833.
Receptor selectivity of natriuretic peptide family, atrial natriuretic peptide, brain natriuretic peptide, and C-type natriuretic peptide. Endocrinology 130:229239.
Potter LR, Abbey-Hosch S, Dickey DM. 2006. Natriuretic peptides, their receptors, and cyclic guanosine monophosphatedependent signaling functions. Endocr Rev 27:4772.
Sugiura K, Su YQ, Diaz FJ, Pangas SA, Sharma S, Wigglesworth K, O’Brien MJ, Matzuk MM, Shimasaki S, Eppig JJ. 2007. Oocyte-derived BMP15 and FGFs cooperate to promote glycolysis in cumulus cells. Development 134:25932603.
Richards JS. 2001. New signaling pathways for hormones and cyclic adenosine 30 ,50 -monophosphate action in endocrine cells. Mol Endocrinol 15:209218. Rosenzweig A, Seidman CE. 1991. Atrial natriuretic factor and related peptide hormones. Annu Rev Biochem 60:229255. Schulz S, Singh S, Bellet RA, Singh G, Tubb DJ, Chin H, Garbers DL. 1989. The primary structure of a plasma membrane guanylate cyclase demonstrates diversity within this new receptor family. Cell 58:11551162. Sriraman V, Rudd MD, Lohmann SM, Mulders SM, Richards JS. 2006. Cyclic guanosine 50 -monophosphate-dependent protein kinase II is induced by luteinizing hormone and progesterone receptor-dependent mechanisms in granulosa cells and cumulus oocyte complexes of ovulating follicles. Mol Endocrinol 20:348361. Su YQ, Sugiura K, Woo Y, Wigglesworth K, Kamdar S, Affourtit J, Eppig JJ. 2007. Selective degradation of transcripts during meiotic maturation of mouse oocytes. Dev Biol 302:104117.
Tsuji T, Kiyosu C, Akiyama K, Kunieda T. 2012. CNP/NPR2 signaling maintains oocyte meiotic arrest in early antral follicles and is suppressed by EGFR-mediated signaling in preovulatory follicles. Mol Reprod Dev 79:795802. Vaccari S, Weeks JL II, Hsieh M, Menniti FS, Conti M. 2009. Cyclic GMP signaling is involved in the luteinizing hormone-dependent meiotic maturation of mouse oocytes. Biol Reprod 81:595604. Wang Y, Kong N, Li N, Hao X, Wei K, Xiang X, Xia G, Zhang M. 2013. Epidermal growth factor receptor signaling-dependent calcium elevation in cumulus cells is required for NPR2 inhibition and meiotic resumption in mouse oocytes. Endocrinology 154:34013409. Zhang M, Su YQ, Sugiura K, Wigglesworth K, Xia G, Eppig JJ. 2011. Estradiol promotes and maintains cumulus cell expression of natriuretic peptide receptor 2 (NPR2) and meiotic arrest in mouse oocytes in vitro. Endocrinology 152:43774385.
Sudoh T, Kangawa K, Minamino N, Matsuo H. 1988. A new natriuretic peptide in porcine brain. Nature 332:7881.
Zhang M, Su YQ, Sugiura K, Xia G, Eppig JJ. 2010. Granulosa cell ligand NPPC and its receptor NPR2 maintain meiotic arrest in mouse oocytes. Science 330:366369.
Suga S, Nakao K, Hosoda K, Mukoyama M, Ogawa Y, Shirakami G, Arai H, Saito Y, Kambayashi Y, Inouye K, Imura H. 1992.
Zhang M, Xia G. 2012. Hormonal control of mammalian oocyte meiosis at diplotene stage. Cell Mol Life Sci 69:12791288.
Mol. Reprod. Dev. 81:462–469 (2014)
469
