© 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Xenotransplantation 2015: 22: 151–152 doi: 10.1111/xen.12150
XENOTRANSPLANTATION
Letter to the Editor
Porcine endogenous retrovirus infection of human peripheral blood mononuclear cells To the Editor: Rodrigues Costa et al. [1] published recently that porcine endogenous retroviruses (PERVs) cannot infect primary human peripheral blood mononuclear cells (PBMCs) productively. Incubation with cell-free PERV did not result in infection and provirus integration, whereas cocultivation of human PBMCs with PERV-producing cells resulted at least in infection and integration of the provirus, but not in release of progeny virus [1]. For these studies, Rodrigues Costa et al. [1] thought to have used a virus called PERV/5°, which was the result of serial rapid passages (to set up a strong selection pressure) of PERV released from mitogenactivated pig PBMCs on human 293 cells [2–4]. The virus was shown to represent a recombination between PERV-A, which infects human cell, and PERV-C, which infects only pig cells [2]. Viruses of the last passage (PERV/5°) were characterized by an increased infectious titer and multimerization of transcription factor binding sites in the viral long terminal repeat (LTR) (Fig. 1A) [4]. Similar genetic changes in the LTR were also observed, when PERV-A released from PK-15 cells was rapidly passaged on 293 cells [4,5]. A multimerization of repeats in the LTR was described for many retroviruses and was associated with an increased pathogenicity (for literature see [4]). Only using PERV/ 5° or a late passage of PERV-A, but not viruses with less repeats in the LTR, we were able to infect human PBMCs [6,7]. Human cells are known to contain different proteins counteracting with retroviral infections, the so-called intracellular restriction factors. PERVs with an increased number of repeats in the LTR obviously can overcome this restriction. This explains, why viruses of the first passage on human cells [3] or viruses directly released from pig cells and not passaged on human cells [8], all not containing additional repeats in the LTR, did not infect human PBMCs. However, when a recombinant PERV-A/C from another laboratory, 14/220, was used, provirus integration in human PBMCs was observed [9]. PERV 14/220 is approximately 500-fold more infec-
A
a b PERV/3° a b
a b
a b
a b
PERV/5° PERV mutated 478
508
CCACGAAGCGCGGGCTCTCGA TATTTTGAAATGATTGGT TTGTAAAGCGCGGGCTTTG a NF-Y binding site (ATTG) b CEBP binding site (GAAA) B
bp 1000
M
3
4
5 mutated
500 200
Fig. 1. (A) Schematic presentation of repeat sequences in the long terminal repeat (LTR) of different porcine endogenous retroviruses (PERVs), the sequences of the repeats and the localization of transcription factor binding sites are given (a, NF-Y binding site, b, CEBP binding site), arrows mark point mutation. (B) Analysis of PCR amplification products using LTR-specific primers [11], M, marker, 3, amplification of a plasmid corresponding to the LTR of PERV/3°, 4, to the LTR of PERV/4°, 5, to the LTR of PERV/5°, and mutated, to DNA from cells producing the partially back-mutated virus. Arrows indicate the major LTR sequences, the upper arrow corresponds to PERV/5°, the lower arrow indicates the major band and corresponds to a virus with less repeats in the LTR.
tious as the paternal PERV-A, and two mutations in the env sequence were identified as determinants of high infectivity [10]. These mutations were also found in PERV/5° [11]. Later cultivation of PERV/5° on human 293 cells, without any selection pressure, resulted in viruses with different repeat numbers in the LTR, demonstrated as a smear of amplicons in the LTR-PCR with two major bands (Fig. 1). The major sequence (lower arrow in Fig. 1B) was sequenced and showed deletions and point mutations in the LTR, which was associated 151
Letter to the Editor with the loss of two NF-Y binding and one CCAAT enhancer binding protein binding sites (Fig. 1A) [11], indicating that the virus mutated back. Although the major band of the LTR corresponds to a lower repeat number in the LTR compared with PERV/5°, some LTR with more repeats were also found (Fig. 1B, higher arrow) [11]. But the percentage of the LTR sequences with the lower number of repeats is much higher than the percentage of the LTR sequences corresponding to PERV/5°. Therefore, Rodrigues Costa et al. [1] did not use PERV/5° for their experiments but less infectious, partially back-mutated viruses. The virus preparation may have contained still some PERV/5°, but their amount was not sufficient to overcome the cellular restriction. To summarize, we found that human PBMCs can be infected under certain circumstances with PERV, but only with highly infectious virus containing numerous repeats in the LTR such as PERV/5°. This virus was generated by passaging in cell culture using transformed human 293 cells lacking relevant intracellular restriction factors [4]. As PBMCs express the corresponding restriction factors, infection with PERV without additional repeats in the LTR is impossible [1] and subsequent passaging in vivo, in the infected individual, will not happen. This explains why until now no infections with PERV have been observed in the first xenotransplant recipients [12]. Although infection of other primary human cells (endothelial cells, vascular fibroblasts, and mesangial cells) have been reported, the extend of PERV production was not well defined [13]. Whereas the in vitro infection data [1–4] contribute to the evaluation of the virus safety of xenotransplantation, numerous preclinical and clinical trials as well as infection experiments with and without immunosuppression, all showing lack of PERV transmission to the recipient in vivo (for review see [12]), have a much stronger impact on this evaluation.
152
Joachim Denner Robert Koch Institute, Berlin, Germany (E-mail: [email protected])
References 1. RODRIGUES COSTA M, FISCHER N, GULICH B et al. Comparison of porcine endogenous retroviruses infectious potential in supernatants of producer cells and in cocultures. Xenotransplantation 2014; 21: 162–173. 2. WILSON CA, WONG S, MULLER J et al. Type C retrovirus released from porcine primary peripheral blood mononuclear cells infects human cells. J Virol 1998; 72: 3082–3087. 3. WILSON CA, WONG S, VANBROCKLIN M et al. Extended analysis of the in vitro tropism of porcine endogenous retrovirus. J Virol 2000; 74: 49–56. 4. DENNER J, SPECKE V, THIESEN U et al. Genetic alterations of the long terminal repeat of an ecotropic porcine endogenous retrovirus during passage in human cells. Virology 2003; 314: 125–133. 5. SCHEEF G, FISCHER N, KRACH U et al. The number of a U3 repeat box acting as an enhancer in long terminal repeats of polytropic replication-competent porcine endogenous retroviruses dynamically fluctuates during serial virus passages in human cells. J Virol 2001; 75: 6933–6940. 6. SPECKE V, TACKE SJ, BOLLER K et al. Porcine endogenous retroviruses: in vitro host range and attempts to establish small animal models. J Gen Virol 2001; 82: 837–844. 7. SPECKE V, RUBANT S, DENNER J. Productive infection of human primary cells and cell lines with porcine endogenous retroviruses. Virology 2001; 285: 177–180. 8. PATIENCE C, TAKEUCHI Y, WEISS RA. Infection of human cells by an endogenous retrovirus of pigs. Nat Med 1997; 3: 282–286. 9. ERICSSON TA, TAKEUCHI Y, TEMPLIN C et al. Identification of receptors for pig endogenous retrovirus. Proc Natl Acad Sci USA 2003; 100: 6759–6764. 10. HARRISON I, TAKEUCHI Y, BARTOSCH B et al. Determinants of high titer in recombinant porcine endogenous retroviruses. J Virol 2004; 78: 13871–13879. 11. KARLAS A, IRGANG M, VOTTELER J et al. Characterisation of a human cell-adapted porcine endogenous retrovirus PERV-A/C. Ann Transplant 2010; 15: 45–54. € RR. Infection barriers to successful 12. DENNER J, TONJES xenotransplantation focusing on porcine endogenous retroviruses. Clin Microbiol Rev 2012; 25: 318–343. 13. MARTIN U, WINKLER ME, ID M et al. Productive infection of primary human endothelial cells by pig endogenous retrovirus (PERV). Xenotransplantation 2000; 7: 138–142.
Copyright of Xenotransplantation is the property of Wiley-Blackwell and its content may not be copied or emailed to multiple sites or posted to a listserv without the copyright holder's express written permission. However, users may print, download, or email articles for individual use.
Xenotransplantation 2015: 22: 151–152 doi: 10.1111/xen.12150
XENOTRANSPLANTATION
Letter to the Editor
Porcine endogenous retrovirus infection of human peripheral blood mononuclear cells To the Editor: Rodrigues Costa et al. [1] published recently that porcine endogenous retroviruses (PERVs) cannot infect primary human peripheral blood mononuclear cells (PBMCs) productively. Incubation with cell-free PERV did not result in infection and provirus integration, whereas cocultivation of human PBMCs with PERV-producing cells resulted at least in infection and integration of the provirus, but not in release of progeny virus [1]. For these studies, Rodrigues Costa et al. [1] thought to have used a virus called PERV/5°, which was the result of serial rapid passages (to set up a strong selection pressure) of PERV released from mitogenactivated pig PBMCs on human 293 cells [2–4]. The virus was shown to represent a recombination between PERV-A, which infects human cell, and PERV-C, which infects only pig cells [2]. Viruses of the last passage (PERV/5°) were characterized by an increased infectious titer and multimerization of transcription factor binding sites in the viral long terminal repeat (LTR) (Fig. 1A) [4]. Similar genetic changes in the LTR were also observed, when PERV-A released from PK-15 cells was rapidly passaged on 293 cells [4,5]. A multimerization of repeats in the LTR was described for many retroviruses and was associated with an increased pathogenicity (for literature see [4]). Only using PERV/ 5° or a late passage of PERV-A, but not viruses with less repeats in the LTR, we were able to infect human PBMCs [6,7]. Human cells are known to contain different proteins counteracting with retroviral infections, the so-called intracellular restriction factors. PERVs with an increased number of repeats in the LTR obviously can overcome this restriction. This explains, why viruses of the first passage on human cells [3] or viruses directly released from pig cells and not passaged on human cells [8], all not containing additional repeats in the LTR, did not infect human PBMCs. However, when a recombinant PERV-A/C from another laboratory, 14/220, was used, provirus integration in human PBMCs was observed [9]. PERV 14/220 is approximately 500-fold more infec-
A
a b PERV/3° a b
a b
a b
a b
PERV/5° PERV mutated 478
508
CCACGAAGCGCGGGCTCTCGA TATTTTGAAATGATTGGT TTGTAAAGCGCGGGCTTTG a NF-Y binding site (ATTG) b CEBP binding site (GAAA) B
bp 1000
M
3
4
5 mutated
500 200
Fig. 1. (A) Schematic presentation of repeat sequences in the long terminal repeat (LTR) of different porcine endogenous retroviruses (PERVs), the sequences of the repeats and the localization of transcription factor binding sites are given (a, NF-Y binding site, b, CEBP binding site), arrows mark point mutation. (B) Analysis of PCR amplification products using LTR-specific primers [11], M, marker, 3, amplification of a plasmid corresponding to the LTR of PERV/3°, 4, to the LTR of PERV/4°, 5, to the LTR of PERV/5°, and mutated, to DNA from cells producing the partially back-mutated virus. Arrows indicate the major LTR sequences, the upper arrow corresponds to PERV/5°, the lower arrow indicates the major band and corresponds to a virus with less repeats in the LTR.
tious as the paternal PERV-A, and two mutations in the env sequence were identified as determinants of high infectivity [10]. These mutations were also found in PERV/5° [11]. Later cultivation of PERV/5° on human 293 cells, without any selection pressure, resulted in viruses with different repeat numbers in the LTR, demonstrated as a smear of amplicons in the LTR-PCR with two major bands (Fig. 1). The major sequence (lower arrow in Fig. 1B) was sequenced and showed deletions and point mutations in the LTR, which was associated 151
Letter to the Editor with the loss of two NF-Y binding and one CCAAT enhancer binding protein binding sites (Fig. 1A) [11], indicating that the virus mutated back. Although the major band of the LTR corresponds to a lower repeat number in the LTR compared with PERV/5°, some LTR with more repeats were also found (Fig. 1B, higher arrow) [11]. But the percentage of the LTR sequences with the lower number of repeats is much higher than the percentage of the LTR sequences corresponding to PERV/5°. Therefore, Rodrigues Costa et al. [1] did not use PERV/5° for their experiments but less infectious, partially back-mutated viruses. The virus preparation may have contained still some PERV/5°, but their amount was not sufficient to overcome the cellular restriction. To summarize, we found that human PBMCs can be infected under certain circumstances with PERV, but only with highly infectious virus containing numerous repeats in the LTR such as PERV/5°. This virus was generated by passaging in cell culture using transformed human 293 cells lacking relevant intracellular restriction factors [4]. As PBMCs express the corresponding restriction factors, infection with PERV without additional repeats in the LTR is impossible [1] and subsequent passaging in vivo, in the infected individual, will not happen. This explains why until now no infections with PERV have been observed in the first xenotransplant recipients [12]. Although infection of other primary human cells (endothelial cells, vascular fibroblasts, and mesangial cells) have been reported, the extend of PERV production was not well defined [13]. Whereas the in vitro infection data [1–4] contribute to the evaluation of the virus safety of xenotransplantation, numerous preclinical and clinical trials as well as infection experiments with and without immunosuppression, all showing lack of PERV transmission to the recipient in vivo (for review see [12]), have a much stronger impact on this evaluation.
152
Joachim Denner Robert Koch Institute, Berlin, Germany (E-mail: [email protected])
References 1. RODRIGUES COSTA M, FISCHER N, GULICH B et al. Comparison of porcine endogenous retroviruses infectious potential in supernatants of producer cells and in cocultures. Xenotransplantation 2014; 21: 162–173. 2. WILSON CA, WONG S, MULLER J et al. Type C retrovirus released from porcine primary peripheral blood mononuclear cells infects human cells. J Virol 1998; 72: 3082–3087. 3. WILSON CA, WONG S, VANBROCKLIN M et al. Extended analysis of the in vitro tropism of porcine endogenous retrovirus. J Virol 2000; 74: 49–56. 4. DENNER J, SPECKE V, THIESEN U et al. Genetic alterations of the long terminal repeat of an ecotropic porcine endogenous retrovirus during passage in human cells. Virology 2003; 314: 125–133. 5. SCHEEF G, FISCHER N, KRACH U et al. The number of a U3 repeat box acting as an enhancer in long terminal repeats of polytropic replication-competent porcine endogenous retroviruses dynamically fluctuates during serial virus passages in human cells. J Virol 2001; 75: 6933–6940. 6. SPECKE V, TACKE SJ, BOLLER K et al. Porcine endogenous retroviruses: in vitro host range and attempts to establish small animal models. J Gen Virol 2001; 82: 837–844. 7. SPECKE V, RUBANT S, DENNER J. Productive infection of human primary cells and cell lines with porcine endogenous retroviruses. Virology 2001; 285: 177–180. 8. PATIENCE C, TAKEUCHI Y, WEISS RA. Infection of human cells by an endogenous retrovirus of pigs. Nat Med 1997; 3: 282–286. 9. ERICSSON TA, TAKEUCHI Y, TEMPLIN C et al. Identification of receptors for pig endogenous retrovirus. Proc Natl Acad Sci USA 2003; 100: 6759–6764. 10. HARRISON I, TAKEUCHI Y, BARTOSCH B et al. Determinants of high titer in recombinant porcine endogenous retroviruses. J Virol 2004; 78: 13871–13879. 11. KARLAS A, IRGANG M, VOTTELER J et al. Characterisation of a human cell-adapted porcine endogenous retrovirus PERV-A/C. Ann Transplant 2010; 15: 45–54. € RR. Infection barriers to successful 12. DENNER J, TONJES xenotransplantation focusing on porcine endogenous retroviruses. Clin Microbiol Rev 2012; 25: 318–343. 13. MARTIN U, WINKLER ME, ID M et al. Productive infection of primary human endothelial cells by pig endogenous retrovirus (PERV). Xenotransplantation 2000; 7: 138–142.
Copyright of Xenotransplantation is the property of Wiley-Blackwell and its content may not be copied or emailed to multiple sites or posted to a listserv without the copyright holder's express written permission. However, users may print, download, or email articles for individual use.
