bs_bs_banner
doi:10.1111/jog.12362
J. Obstet. Gynaecol. Res. Vol. 40, No. 5: 1235–1242, May 2014
Polymorphism in the epidermal growth factor gene is associated with pre-eclampsia and low birthweight Thurayratnam Chenthuran, Gayani Harendra Galhenagey, Rohan W. Jayasekara and Vajira H. W. Dissanayake Human Genetics Unit, Faculty of Medicine, University of Colombo, Colombo, Sri Lanka
Abstract Aim: We have previously reported that polymorphism in the epidermal growth factor (EGF) gene is associated with pre-eclampsia and birthweight based on case–control association studies involving two single nucleotide polymorphisms (SNP). We extended that work to investigate other SNP in the EGF gene for their association with pre-eclampsia and the weight of babies at birth. Material and Methods: A population-based DNA collection was genotyped to determine whether the selected SNP were polymorphic in the study population. In total, 175 women with pre-eclampsia and 171 matched normotensive controls were genotyped for the polymorphic SNP using polymerase chain reaction/restriction fragment length polymorphism and MassARRAY Sequenom iPLEX methodology. Results: The rs3756261A, rs4444903G, rs2237051G haplotype was associated with the highest increased risk of pre-eclampsia (odds ratio: 3.70, 95% confidence interval: 1.38–9.94; P = 0.016). The rs3756261A allele was the one that contributed to this high degree of significance. The same allele was present in the haplotype rs3756261A, rs11568943G, rs2237051G, rs11569017A, rs4698803T (likelihood ratio statistic = 20.4671, d.f. = 3, P-value = 0.0001), which was associated with the lower birthweight. Conclusions: In this study we found further evidence for the association of polymorphism in the EGF gene with pre-eclampsia and the weight of babies at birth and identified rs3756261A>G as the SNP that makes the most significant contribution to this association. Bioinformatic analysis showed that this effect may be mediated by caudal type homeohox-2, a transcriptional repressor expressed in the trophoblast, for which a binding site is created at this polymorphic site when the rs3756261A allele is present. Key words: birthweight, case–control studies, epidermal growth factor, haplotypes, pre-eclampsia.
Introduction Pre-eclampsia, the occurrence of hypertension and proteinuria in pregnancy, accounts for considerable maternal and fetal morbidity and mortality, and is frequently associated with low-birthweight babies. Preeclampsia has been termed the ‘disease of theories’ due to the confusion surrounding its cause, with immune, infective, dietary, and genetic factors being implicated.1 Our group has focused attention on the role of mater-
nal genetic factors. Identifying maternal genetic variations that could be used to detect women destined to develop pre-eclampsia later in their pregnancies, and those whose babies would be of low birthweight, might provide useful predictive markers as well as identify molecular targets for preventive intervention. We previously reported that single nucleotide polymorphisms (SNP) in the maternal EGF gene and the haplotypes defined by them were associated with the development of pre-eclampsia in Sinhalese women2
Received: May 14 2013. Accepted: November 20 2013. Reprint request to: Professor Vajira H. W. Dissanayake, Human Genetics Unit, Faculty of Medicine, University of Colombo, Kynsey Road, Colombo 8, Sri Lanka. Email: [email protected]
© 2014 The Authors Journal of Obstetrics and Gynaecology Research © 2014 Japan Society of Obstetrics and Gynecology
1235
T. Chenthuran et al.
and the weight of babies of women who had normal pregnancies.3 The latter finding was in fact replicated in two white Western European populations in the UK, lending further support that this is a true association. Later work also supported a role for the fetal EGF in determining birthweight.4 In view of the tight linkage disequilibrium3 across the EGF gene, there were two explanations for these findings. First, it was possible that the SNP studied were causative. Second, it was possible that the SNP studied were in fact in linkage disequilibrium with one or more causative SNP in the EGF gene. It was necessary therefore to explore the role of other SNP in the EGF gene that were polymorphic in Sinhalese to examine whether they play any role in the development of pre-eclampsia and determining the weight of babies at birth. The objectives of this investigation therefore were: (i) to identify SNP in the EGF gene, which were polymorphic in a population-based collection of Sinhalese men and women; (ii) to test the association of maternal EGF genotypes and haplotypes with pre-eclampsia in a case–control comparison of Sinhalese women; and (iii) to test the association between maternal EGF genotypes and haplotypes and birthweight in healthy pregnancies in Sinhalese women.
Methods Subjects The samples for the population genetic study on Sinhalese men and women as well as the samples for the case–control study of pre-eclampsia came from two existing collections in the Human Genetics Unit, Faculty of Medicine, University of Colombo, Sri Lanka. These collections have been made for genetic studies according to protocols approved by the Ethics Review Committee (ERC) of the Faculty of Medicine, University of Colombo. All subjects had been recruited for these studies in Colombo, Sri Lanka between August 2001 and January 2003. All subjects had given written informed consent to participate. The same ERC approved the current study. Subjects for population genetic studies had been recruited from among women attending antenatal clinics, staff and students of the University of Colombo, and persons accompanying patients attending general practice clinics in Colombo. Samples were obtained from 80 (50% male) volunteers each from the three main racial groups in Sri Lanka – Sinhalese, Sri Lankan Tamils, and Moors. The mean ages of these three groups of volunteers were 33 years (range 17–59), 28 years (range 18–45), and 27 years
1236
(range 17–45), respectively. The ethnicity of subjects had been established by grandparental ethnicity. Thirty Sinhalese samples from this collection (15 male and 15 female) were randomly selected for the current investigation. The collection for case–control studies comprised Sinhalese women with pre-eclampsia recruited at the time of diagnosis, and controls recruited within 24 h of a normal full-term delivery, from two tertiary care hospitals in Colombo. Pre-eclampsia was defined as hypertension of ≥140/90 mmHg on two occasions 6 h apart, occurring after 20 weeks of gestation in a previously normotensive woman together with proteinuria of ≥1 + on the urine protein heat coagulation test (HCT; equivalent to 500 mg/day)5 not associated with urinary tract infection or ruptured membranes. The use of the HCT as a measure of proteinuria has been validated in these maternity units.6 Exclusion criteria applied were: non-Sinhalese or women of mixed ethnicity; current pregnancy fathered by a non-Sinhalese man; renal disease, chronic hypertension, or persistent proteinuria (defined as ≥1 + on the HCT in the first three urine samples tested in pregnancy with or without urinary tract infection); ischemic heart disease, cerebrovascular accidents, or insulin or non-insulin dependent diabetes mellitus; body mass index (BMI) ≥ 30 kg/m2 based on height and weight measured at the antenatal booking visit, or postpartum in the case of unbooked pregnancies (to minimize phenotypic heterogeneity, as obesity is itself a risk factor for pre-eclampsia); a previous abortion after 12 weeks of gestation (because the uterus mimics a parous uterus due to uterine vascular re-modeling in such cases); and hydatidiform mole, multiple gestations, or gestational diabetes in the current pregnancy. The initial case–control collection had 180 cases and 180 controls that were matched for ethnicity, age and BMI. A detailed discussion of phenotypic features and recruitment of this cohort has already been published.6 Four women with preeclampsia had elevated blood pressure at follow-up at 6 weeks. One woman with pre-eclampsia died. Nine control women had delivered babies who had a corrected birthweight centile of A (5′ UTR) and rs2237051G>A (exon 14). The dbSNP database (http://www.ncbi.nlm.nih.gov/projects/SNP) was searched for SNP that were reported to be polymorphic in Asian populations or were of functional significance. In addition, scientific literature was searched for papers reporting SNP in the EGF gene to be associated with disease phenotypes.8 The SNP
investigated in this study are summarized in Figure 1. All SNP in exons result in missense mutations.
Genotyping methods SNP were genotyped using new PCR/RFLP methods and using MassARRAY Sequenom iPLEX methodology. The PCR primers and restriction enzymes used for the in-house tests are listed in Table 2. PCR batches had sequenced positive and DNA-free negative controls. Genotypes were assigned after the PCR/RFLP assay by examining the restriction pattern following agarose gel electrophoresis and calling the genotype by two independent observers. The PCR and RFLP conditions are available on request. The SNP genotyped by PCR/RFLP were rs28553469G>C, rs35191533T>A,
© 2014 The Authors Journal of Obstetrics and Gynaecology Research © 2014 Japan Society of Obstetrics and Gynecology
1237
T. Chenthuran et al.
Table 2 PCR primers and restriction enzymes used for the PCR/RFLP genotyping assays SNP ID
Forward primer (5′→ 3′)
Reverse primer (5′→ 3′)
Restriction enzyme
rs28553469G>C rs35191533T>A rs11568992C>G rs11569017A>T rs11569046T>C rs4698803A>T rs11569098C>T
GACAGTTGCCTGCATTTCAA TGGAAAATGAAGACAATTTGGA AATTCAAGAATATTTTACTCAAGCCTA TGCAAAAAGAGGCTTGGAAC AAGCGTTTCTATTTGGAGGTT GCTGATGAAGCTCCTCTTCC CTGTGTTGTTGGCTACATCG
TGTGGACAGAACCTCCATCA CTCATTGTCTGGCTCAAGCA ATCACAGACTGCTTGGCATC CCTGGGACCCACTCCACTAT TGTGAATTTGCCCTTTTCTCTT CAAATTCTCAAGCCCAGCAT CACCCAGCCTATTTCACG
MboI NlaIII AluI BtsCI NspI ApaLI MwoI
PCR, polymerase chain reaction; RFLP, restriction fragment length polymorphism.
rs11568992C>G, rs11569017A>T, rs11569046T>C, rs4698803A>T and rs11569098C>T. MassARRAY Sequenom iPLEX methodology involved the following: The DNA samples were quantified using the PicoGreen method and normalized to 2.5 ng/μl. Primers flanking the gene region containing the SNP were designed using MassArray Designer software. PCR amplifications were carried out using the following conditions: 90°C for 15 min, 45 cycles of 94°C for 20 s, 56°C for 30 s, 72°C for 1 min followed by 72°C for 3 min. MassExtend reaction was carried out with iPLEX assay kit. Primer extension conditions were: 94°C for 30 s, 40 cycles (94°C for 5 s, 5 cycles of [52°C for 5 s, 80°C for 5 s]), and 72°C for 3 min. Genotype calling was obtained by loading the products to a MassARRAY Compact System. The SNP genotyped by MassARRAY Sequenom iPLEX methodology were rs3756261A>G, rs11568835G>A, rs11568849A>C and rs11568943G>A.
Statistical analysis The χ2-test or Fisher’s exact test were used to test the genotypes at each polymorphic locus for Hardy– Weinberg equilibrium (HWE) and to compare allele frequency differences between cases and controls. Linear regression analysis was performed to study the association of SNP genotypes with birthweight in healthy pregnancies, with adjustment for potential confounding variables, including maternal weight, gestation at delivery, and fetal sex. The genotype was treated as a quantitative variable coded 0, 1 or 2 to represent the number of variant alleles, consistent with an additive model. The UNPHASED software suite10 was used to estimate haplotype frequencies, and for hypothesis testing for case–control analysis of the association of haplotypes with pre-eclampsia and the weight of babies at birth. Rare haplotypes occurring at
1238
frequencies of less than 0.05 were dropped from hypothesis testing.
Bioinformatic analysis In silico functional analysis of rs3756261A>G was carried out using FastSNP (freely downloadable from http://fastsnp.ibms.sinica.edu.tw/pages/input _CandidateGeneSearch.jsp).
Results Population genetic studies The following six SNP were not polymorphic: rs11568849A>C, rs28553469G>C, rs35191533T>A, rs11568992C>G, rs11569046T>C and rs11569098C>T. These were not taken forward for genotyping in the case–control study. The alleles found in this population for each SNP were A, G, T, C, T, and C, respectively. The allele frequencies of the polymorphic SNP are shown in Table 3; all were in HWE. Case–control studies Genotypes of all cases and controls were in HWE. The results of case–control analysis for the polymorphic SNP in the EGF gene are in Table 4. rs3756261A>G, rs11568943G>A, and rs11569017A>T were associated with pre-eclampsia (P < 0.05). rs3756261A>G showed the strongest individual association with the A allele found more in cases than in controls (P = 0.01). Thereafter, as the objective of this study was to refine the two SNP (rs4444903G>A and rs2237051G>A) haplotypes reported by us previously to be associated with pre-eclampsia by adding additional SNP, case– control haplotype analysis was undertaken constructing haplotypes by adding one new SNP at a time to the two previous SNP (rs4444903G>A and rs2237051G>A). The SNP added were the three SNP that were
© 2014 The Authors Journal of Obstetrics and Gynaecology Research © 2014 Japan Society of Obstetrics and Gynecology
Pre-eclampsia, low birthweight and EGF
Table 3 Genotype and allele frequencies of polymorphic SNP Genotype frequency n (%)
SNP ID rs3756261A>G rs11568835G>A rs4444903G>A† rs11568943G>A rs2237051G>A† rs11569017A>T rs4698803A>T
AA 25 (93%) GG 24 (86%) GG 35% GG 26 (93%) AA 33% AA 28 (97%) TT 23 (82%)
AG 2 (7%) GA 4 (14%) GA 47.5% GA 2 (7%) AG 43% AT 1 (3%) TA 4 (14%)
GG 0 (0%) AA 0 (0%) AA 17.5% AA 0 (0%) GG 24% TT 0 (0%) AA 1 (4%)
Allele frequency n (%) A 52 (96%) G 52 (93%) G 58.8% G 54 (96%) A 54.7% A 57 (98%) T 50 (89%)
G 2 (4%) A 4 (7%) A 42.2% A 2 (4%) G 45.3% T 1 (2%) A 6 (11%)
†Genotyped previously. SNP, single nucleotide polymorphism.
Table 4 Genotyping results of the SNP in the EGF gene in pre-eclampsia cases and normal pregnancy controls Cases – n (%)
SNP ID rs3756261A>G rs11568835G>A rs4444903G>A† rs11568943G>A rs2237051G>A† rs11569017A>T rs4698803A>T
AA 143 (88%) GG 140 (86%) GG 56 (32%) GG 139 (86%) GG 51 (29%) AA 140 (84%) TT 131 (80%)
AG 17 (11%) GA 21 (13%) GA 79 (45%) GA 20 (12%) GA 85 (49%) AT 26 (16%) AT 31 (19%)
Controls – n (%) GG 2 (1%) AA 2 (1%) AA 39 (22%) AA 2 (1%) AA 39 (22%) TT 1 (1%) AA 2 (1%)
AA 116 (75%) GG 136 (87%) GG 56 (33%) GG 115 (75%) GG 41 (24%) AA 118 (72%) TT 130 (79%)
AG 33 (21%) GA 21 (13%) GA 78 (46%) GA 34 (22%) GA 73 (43%) AT 43 (26%) AT 33 (20%)
GG 5 (3%) AA 0 (0%) AA 37 (22%) AA 5 (3%) AA 57 (33%) TT 2 (1%) AA 2 (1%)
χ2 = 9.02, d.f. = 2, P = 0.01 χ2 = 1.95, d.f. = 2, P = 0.38 χ2 = 0.03, d.f. = 2, P = 0.98 χ2 = 7.03, d.f. = 2, P = 0.03 χ2 = 5.33, d.f. = 2, P = 0.07 χ2 = 6.35, d.f. = 2, P = 0.04 χ2 = 0.06, d.f. = 2, P = 0.97
†Genotyped previously. EGF, epidermal growth factor; SNP, single nucleotide polymorphisms.
associated with pre-eclampsia (rs3756261A>G, rs11568943G>A, and rs11569017A>T). Rare haplotypes occurring in a frequency of less than 5% were excluded from the analysis. The most significant association was found when the haplotypes were defined by rs3756261A>G; rs4444903G>A and rs2237051G>A (likelihood ratio χ2 = 22.5139, d.f. = 4, P-value = 0.0002). The detailed haplotype analysis using these three SNP is in Table 5. The rs3756261A, rs4444903G, rs2237051G haplotype appeared to be the one that was associated with increased risk of pre-eclampsia (odds ratio [OR] = 3.70, 95% confidence interval [CI]: 1.38–9.94; P = 0.016).
Quantitative trait studies The results of analysis of the association of the polymorphic SNP in the EGF gene with the weight of
babies at birth is in Table 6. None of the SNP were individually associated with the weight of babies at birth. Thereafter, as the objective of this study was to refine the two SNP haplotypes reported by us previously to be associated with pre-eclampsia by adding additional SNP, quantitative trait haplotype analysis was undertaken constructing haplotypes by adding one new SNP at a time to the two previous SNP (rs4444903G>A and rs2237051G>A). Rare haplotypes occurring in a frequency of less than 5% were excluded from the analysis. These haplotype combinations were not significantly associated with birthweight. Therefore, the association of haplotypes defined by SNP in combination with the SNP that was individually associated with birthweight (i.e. rs2237051G>A) was analyzed. The most significant association was found when
© 2014 The Authors Journal of Obstetrics and Gynaecology Research © 2014 Japan Society of Obstetrics and Gynecology
1239
T. Chenthuran et al.
Table 5 Haplotype analysis results for the association of haplotypes defined by rs3756261A>G; rs4444903G>A and rs2237051G>A with pre-eclampsia rs3756261A>G A A A G A †Others
Haplotypes rs4444903G>A rs2237051G>A
Frequency Cases f Controls f
Odds ratio
95% Confidence interval
Individual haplotype P-value
A G G G A
0.41 0.39 0.10 0.04 0.03 0.02
2.14 1.98 3.70 0.73 1.00
0.92–4.97 0.85–4.60 1.38–9.94 0.26–2.03 1.00–1.00
0.283 0.826 0.016 0.001 0.121
G A G A A
0.37 0.38 0.05 0.11 0.06 0.03
†Includes 3 more haplotypes which had frequencies of less than 0.05. They were dropped from hypothesis testing. Likelihood ratio χ2 = 22.5139 d.f. = 4 global P-value = 0.0002.
Table 6 Mean and SD birthweights of babies of normotensive pregnant women as a function of the genotypes of SNP in the EGF gene SNP ID
Genotype
N
Mean
SD
P
rs3756261A>G
AA AG GG GG GA AA GG GA AA GG GA AA GG GA AA AA AT TT TT TA AA
116 33 5 136 21 0 56 78 37 115 34 5 41 73 57 118 43 2 130 33 2
3.00 3.10 3.01 3.05 2.91
0.42 0.37 0.34 0.42 0.34
0.46
2.95 3.01 3.12 3.01 3.08 3.19 3.13 3.02 2.93 3.00 3.07 2.85 3.00 3.09 3.03
0.38 0.42 0.44 0.42 0.36 0.50 0.41 0.40 0.41 0.43 0.35 0.50 0.41 0.44 0.52
0.21
rs11568835G>A rs4444903G>A† rs11568943G>A rs2237051G>A† rs11569017A>T rs4698803A>T
0.16
0.29 0.03 0.88 0.59
†Genotyped previously. Data were analyzed by linear regression of birthweight on maternal EGF genotype, adjusting for the following confounders: maternal weight at booking; period of gestation, and sex of baby. All women were non-smokers. EGF, epidermal growth factor; SD, standard deviation; SNP, single nucleotide polymorphisms.
the haplotypes were defined by rs3756261A>G; rs11568943G>A; rs2237051G>A; rs11569017A>T; and rs4698803A>T (likelihood ratio statistic = 20.4671, d.f. = 3, P-value = 0.0001). The results are in Table 7.
Discussion The objective of these investigations was to further explore the results of our previous work on the association of polymorphism in the EGF gene with pre-
1240
eclampsia and the weight of babies at birth. In these investigations we found further support for our original finding. In our initial study we reported that the rs4444903G, rs2237051G haplotype was marginally associated with pre-eclampsia. The current investigation has shed more light on that finding. We report here that the above-mentioned haplotype when found in combination with the rs3756261A allele (i.e. the rs3756261A, rs4444903G, rs2237051G) is highly significantly
© 2014 The Authors Journal of Obstetrics and Gynaecology Research © 2014 Japan Society of Obstetrics and Gynecology
Pre-eclampsia, low birthweight and EGF
Table 7 Haplotype analysis results for the association of haplotypes defined by rs3756261A>G, rs11568943G>A, rs2237051G>A, rs11569017A>T, and rs4698803A>T with the weight of babies at birth rs3756261A>G
rs11568943G>A
Haplotypes rs2237051G>A
rs11569017A>T
rs4698803A>T
A A A G
G G G A
A G G A
A A A T
T A T T
f
Additive value†
0.40 0.08 0.31 0.10
0.20 0.76 1.20 1.40
95%CI −0.50 −0.49 0.36 0.38
0.91 2.01 2.03 2.41
†Additive value gives the change in expected trait value due to each haplotype, relative to the reference haplotype. Likelihood ratio statistic = 20.4671, d.f. = 3, P-value = 0.0001. There were 12 other haplotypes (including the reference haplotype A-A-A-T-A), which had frequencies of less than 0.05. They were dropped from hypothesis testing. CI, confidence interval.
Figure 2 Binding of CDX2 (transcriptional repressor) to its binding site created by rs3756261A in the 5′ near gene region of epidermal growth factor (EGF). The ‘G’ allele at the polymorphic site abolishes the binding site.
associated with pre-eclampsia (OR = 3.70, 95%CI: 1.38– 9.94; P = 0.016). In addition we also report the association of haplotypes defined by the polymorphisms that we studied with the weight of babies at birth. The haplotypes defined by rs3756261A>G; rs11568943G>A; rs2237051G>A; rs11569017A>T; and rs4698803A>T were the ones most significantly associated with birthweight. rs3756261A, rs11568943G, rs2237051G, rs11569017A, rs4698803T haplotype was the one that was associated with the lower birthweight. This haplotype captures almost 80% of the haplotypes containing the rs3756261A, rs4444903G, rs2237051G allele combination, which defines the haplotype showing the most significant association with pre-eclampsia. Interestingly the rs3756261G, rs11568943A, rs2237051A, rs11569017T, rs4698803T haplotype, the only haplotype containing the rs3756261G allele was associated with the higher birthweight. It is interesting to speculate on the role of rs3756261A>G. When the A allele is present it creates a transcription factor binding site for caudal type homeobox-2 (CDX2). The G allele abolishes the binding site. CDX2 is a transcriptional repressor.11 We hypothesize as follows: CDX2 acts as a repressor when it binds to the rs3756261A site in the 5′ near gene region
of EGF. The repressor activity of CDX2 results in downregulation of EGF expression and EGF receptor mediated signaling (Fig. 2) that is necessary for trophoblast differentiation and invasion leading to defective placentation seen in women with pre-eclampsia and women who deliver low-birthweight babies. EGF may not be the only gene regulated by CDX2. In addition, other transcription factors may also be involved by their action through their binding sites on EGF and other genes. Other interacting transcription factors, interacting with CDX2 and acting independently of it, are also likely to be involved. In that context it is interesting to note that a trophoblast-specific transcriptional circuit involving transcription factors ELF5, CDX2 and EOMES has already been described.12 In addition, EGF is a member of a family of seven genes that act through the same EGF receptor. It would be appropriate therefore to examine polymorphisms in other genes in this family to identify possible sites for transcriptional regulation. Work related to the heparinbinding EGF-like growth factor (HBEGF) gene is ongoing in our laboratory.13 In conclusion, our observations support the possible involvement of CDX2 in the cause of pre-eclampsia and low birthweight acting through transcriptional
© 2014 The Authors Journal of Obstetrics and Gynaecology Research © 2014 Japan Society of Obstetrics and Gynecology
1241
T. Chenthuran et al.
regulation of EGF expression, which needs to be confirmed with functional studies.
Acknowledgments This study was funded by a grant from the National Research Council, Sri Lanka (Grant No: 05-15) and research funding from the Human Genetics Unit Development Fund. T.C. held a postgraduate studentship funded by the IRQUE Project, University of Jaffna, Sri Lanka (Grant No: IRQUE/JA/CON/026). We are grateful to Dr Linda Morgan for her helpful comments on the first draft. Further, the contribution made by Professor Fiona Brought Pipkin and Dr Linda Morgan during the establishment of the pre-eclampsia case–control collection and initial work on EGF gene association studies is also acknowledged.
Disclosure The authors declare that they have no conflicts of interest.
References 1. Chappell S, Morgan L. Searching for genetic clues to the causes of pre-eclampsia. Clin Sci (Lond) 2006; 110: 443–458. 2. Dissanayake VH, Giles V, Jayasekara RW et al. A study of three candidate genes for pre-eclampsia in a Sinhalese population from Sri Lanka. J Obstet Gynaecol Res 2009; 35: 234–242. 3. Dissanayake VH, Tower C, Broderick A et al. Polymorphism in the epidermal growth factor gene is associated with birthweight in Sinhalese and white Western Europeans. Mol Hum Reprod 2007; 13: 425–429.
1242
4. Faraj LE, Lonsdale-Eccles E, Dissanayake VH, Tower C, Morgan L. Fetal epidermal growth factor susceptibility haplotype associated with fetal growth restriction (poster presentation). Ann Clin Biochem 2008; 45: 131. 5. Dissanayake VH, Morgan L, Broughton Pipkin F et al. The urine protein heat coagulation test – a useful screening test for proteinuria in pregnancy in developing countries: A method validation study. BJOG 2004; 111: 491–494. 6. Dissanayake VH, Samarasinghe HD, Morgan L, Jayasekara RW, Seneviratne HR, Broughton Pipkin F. Morbidity and mortality associated with pre-eclampsia at two tertiary care hospitals in Sri Lanka. J Obstet Gynaecol Res 2007; 33: 56– 62. 7. Khong TY, De Wolf F, Robertson WB, Brosens I. Inadequate maternal vascular response to placentation in pregnancies complicated by pre-eclampsia and by small-for-gestational age infants. Br J Obstet Gynaecol 1986; 93: 1049–1059. 8. Jin G, Miao R, Deng Y et al. Variant genotypes and haplotypes of the epidermal growth factor gene promoter are associated with a decreased risk of gastric cancer in a high-risk Chinese population. Cancer Sci 2007; 98: 864–868. 9. Bell GI, Fong NM, Stempien MM et al. Human epidermal growth factor precursor: cDNA sequence, expression in vitro and gene organization. Nucleic Acids Res 1986; 14: 8427– 8446. 10. Dudbridge F. Likelihood-based association analysis for nuclear families and unrelated subjects with missing genotype data. Hum Hered 2008; 66: 87–98. 11. Chun SY, Chen F, Washburn JG et al. CDX2 promotes anchorage-independent growth by transcriptional repression of IGFBP-3. Oncogene 2007; 26: 4725–4729. 12. Hemberger M, Udayashankar R, Tesar P, Moore H, Burton GJ. ELF5-enforced transcriptional networks define an epigenetically regulated trophoblast stem cell compartment in the human placenta. Hum Mol Genet 2010; 19: 2456–2467. 13. Harendra GG, Jayasekara RW, Dissanayake VH. Haplotypes of heparin-binding epidermal-growth-factor-like growth factor gene are associated with pre-eclampsia. J Obstet Gynaecol Res 2012; 38: 239–246.
© 2014 The Authors Journal of Obstetrics and Gynaecology Research © 2014 Japan Society of Obstetrics and Gynecology
doi:10.1111/jog.12362
J. Obstet. Gynaecol. Res. Vol. 40, No. 5: 1235–1242, May 2014
Polymorphism in the epidermal growth factor gene is associated with pre-eclampsia and low birthweight Thurayratnam Chenthuran, Gayani Harendra Galhenagey, Rohan W. Jayasekara and Vajira H. W. Dissanayake Human Genetics Unit, Faculty of Medicine, University of Colombo, Colombo, Sri Lanka
Abstract Aim: We have previously reported that polymorphism in the epidermal growth factor (EGF) gene is associated with pre-eclampsia and birthweight based on case–control association studies involving two single nucleotide polymorphisms (SNP). We extended that work to investigate other SNP in the EGF gene for their association with pre-eclampsia and the weight of babies at birth. Material and Methods: A population-based DNA collection was genotyped to determine whether the selected SNP were polymorphic in the study population. In total, 175 women with pre-eclampsia and 171 matched normotensive controls were genotyped for the polymorphic SNP using polymerase chain reaction/restriction fragment length polymorphism and MassARRAY Sequenom iPLEX methodology. Results: The rs3756261A, rs4444903G, rs2237051G haplotype was associated with the highest increased risk of pre-eclampsia (odds ratio: 3.70, 95% confidence interval: 1.38–9.94; P = 0.016). The rs3756261A allele was the one that contributed to this high degree of significance. The same allele was present in the haplotype rs3756261A, rs11568943G, rs2237051G, rs11569017A, rs4698803T (likelihood ratio statistic = 20.4671, d.f. = 3, P-value = 0.0001), which was associated with the lower birthweight. Conclusions: In this study we found further evidence for the association of polymorphism in the EGF gene with pre-eclampsia and the weight of babies at birth and identified rs3756261A>G as the SNP that makes the most significant contribution to this association. Bioinformatic analysis showed that this effect may be mediated by caudal type homeohox-2, a transcriptional repressor expressed in the trophoblast, for which a binding site is created at this polymorphic site when the rs3756261A allele is present. Key words: birthweight, case–control studies, epidermal growth factor, haplotypes, pre-eclampsia.
Introduction Pre-eclampsia, the occurrence of hypertension and proteinuria in pregnancy, accounts for considerable maternal and fetal morbidity and mortality, and is frequently associated with low-birthweight babies. Preeclampsia has been termed the ‘disease of theories’ due to the confusion surrounding its cause, with immune, infective, dietary, and genetic factors being implicated.1 Our group has focused attention on the role of mater-
nal genetic factors. Identifying maternal genetic variations that could be used to detect women destined to develop pre-eclampsia later in their pregnancies, and those whose babies would be of low birthweight, might provide useful predictive markers as well as identify molecular targets for preventive intervention. We previously reported that single nucleotide polymorphisms (SNP) in the maternal EGF gene and the haplotypes defined by them were associated with the development of pre-eclampsia in Sinhalese women2
Received: May 14 2013. Accepted: November 20 2013. Reprint request to: Professor Vajira H. W. Dissanayake, Human Genetics Unit, Faculty of Medicine, University of Colombo, Kynsey Road, Colombo 8, Sri Lanka. Email: [email protected]
© 2014 The Authors Journal of Obstetrics and Gynaecology Research © 2014 Japan Society of Obstetrics and Gynecology
1235
T. Chenthuran et al.
and the weight of babies of women who had normal pregnancies.3 The latter finding was in fact replicated in two white Western European populations in the UK, lending further support that this is a true association. Later work also supported a role for the fetal EGF in determining birthweight.4 In view of the tight linkage disequilibrium3 across the EGF gene, there were two explanations for these findings. First, it was possible that the SNP studied were causative. Second, it was possible that the SNP studied were in fact in linkage disequilibrium with one or more causative SNP in the EGF gene. It was necessary therefore to explore the role of other SNP in the EGF gene that were polymorphic in Sinhalese to examine whether they play any role in the development of pre-eclampsia and determining the weight of babies at birth. The objectives of this investigation therefore were: (i) to identify SNP in the EGF gene, which were polymorphic in a population-based collection of Sinhalese men and women; (ii) to test the association of maternal EGF genotypes and haplotypes with pre-eclampsia in a case–control comparison of Sinhalese women; and (iii) to test the association between maternal EGF genotypes and haplotypes and birthweight in healthy pregnancies in Sinhalese women.
Methods Subjects The samples for the population genetic study on Sinhalese men and women as well as the samples for the case–control study of pre-eclampsia came from two existing collections in the Human Genetics Unit, Faculty of Medicine, University of Colombo, Sri Lanka. These collections have been made for genetic studies according to protocols approved by the Ethics Review Committee (ERC) of the Faculty of Medicine, University of Colombo. All subjects had been recruited for these studies in Colombo, Sri Lanka between August 2001 and January 2003. All subjects had given written informed consent to participate. The same ERC approved the current study. Subjects for population genetic studies had been recruited from among women attending antenatal clinics, staff and students of the University of Colombo, and persons accompanying patients attending general practice clinics in Colombo. Samples were obtained from 80 (50% male) volunteers each from the three main racial groups in Sri Lanka – Sinhalese, Sri Lankan Tamils, and Moors. The mean ages of these three groups of volunteers were 33 years (range 17–59), 28 years (range 18–45), and 27 years
1236
(range 17–45), respectively. The ethnicity of subjects had been established by grandparental ethnicity. Thirty Sinhalese samples from this collection (15 male and 15 female) were randomly selected for the current investigation. The collection for case–control studies comprised Sinhalese women with pre-eclampsia recruited at the time of diagnosis, and controls recruited within 24 h of a normal full-term delivery, from two tertiary care hospitals in Colombo. Pre-eclampsia was defined as hypertension of ≥140/90 mmHg on two occasions 6 h apart, occurring after 20 weeks of gestation in a previously normotensive woman together with proteinuria of ≥1 + on the urine protein heat coagulation test (HCT; equivalent to 500 mg/day)5 not associated with urinary tract infection or ruptured membranes. The use of the HCT as a measure of proteinuria has been validated in these maternity units.6 Exclusion criteria applied were: non-Sinhalese or women of mixed ethnicity; current pregnancy fathered by a non-Sinhalese man; renal disease, chronic hypertension, or persistent proteinuria (defined as ≥1 + on the HCT in the first three urine samples tested in pregnancy with or without urinary tract infection); ischemic heart disease, cerebrovascular accidents, or insulin or non-insulin dependent diabetes mellitus; body mass index (BMI) ≥ 30 kg/m2 based on height and weight measured at the antenatal booking visit, or postpartum in the case of unbooked pregnancies (to minimize phenotypic heterogeneity, as obesity is itself a risk factor for pre-eclampsia); a previous abortion after 12 weeks of gestation (because the uterus mimics a parous uterus due to uterine vascular re-modeling in such cases); and hydatidiform mole, multiple gestations, or gestational diabetes in the current pregnancy. The initial case–control collection had 180 cases and 180 controls that were matched for ethnicity, age and BMI. A detailed discussion of phenotypic features and recruitment of this cohort has already been published.6 Four women with preeclampsia had elevated blood pressure at follow-up at 6 weeks. One woman with pre-eclampsia died. Nine control women had delivered babies who had a corrected birthweight centile of A (5′ UTR) and rs2237051G>A (exon 14). The dbSNP database (http://www.ncbi.nlm.nih.gov/projects/SNP) was searched for SNP that were reported to be polymorphic in Asian populations or were of functional significance. In addition, scientific literature was searched for papers reporting SNP in the EGF gene to be associated with disease phenotypes.8 The SNP
investigated in this study are summarized in Figure 1. All SNP in exons result in missense mutations.
Genotyping methods SNP were genotyped using new PCR/RFLP methods and using MassARRAY Sequenom iPLEX methodology. The PCR primers and restriction enzymes used for the in-house tests are listed in Table 2. PCR batches had sequenced positive and DNA-free negative controls. Genotypes were assigned after the PCR/RFLP assay by examining the restriction pattern following agarose gel electrophoresis and calling the genotype by two independent observers. The PCR and RFLP conditions are available on request. The SNP genotyped by PCR/RFLP were rs28553469G>C, rs35191533T>A,
© 2014 The Authors Journal of Obstetrics and Gynaecology Research © 2014 Japan Society of Obstetrics and Gynecology
1237
T. Chenthuran et al.
Table 2 PCR primers and restriction enzymes used for the PCR/RFLP genotyping assays SNP ID
Forward primer (5′→ 3′)
Reverse primer (5′→ 3′)
Restriction enzyme
rs28553469G>C rs35191533T>A rs11568992C>G rs11569017A>T rs11569046T>C rs4698803A>T rs11569098C>T
GACAGTTGCCTGCATTTCAA TGGAAAATGAAGACAATTTGGA AATTCAAGAATATTTTACTCAAGCCTA TGCAAAAAGAGGCTTGGAAC AAGCGTTTCTATTTGGAGGTT GCTGATGAAGCTCCTCTTCC CTGTGTTGTTGGCTACATCG
TGTGGACAGAACCTCCATCA CTCATTGTCTGGCTCAAGCA ATCACAGACTGCTTGGCATC CCTGGGACCCACTCCACTAT TGTGAATTTGCCCTTTTCTCTT CAAATTCTCAAGCCCAGCAT CACCCAGCCTATTTCACG
MboI NlaIII AluI BtsCI NspI ApaLI MwoI
PCR, polymerase chain reaction; RFLP, restriction fragment length polymorphism.
rs11568992C>G, rs11569017A>T, rs11569046T>C, rs4698803A>T and rs11569098C>T. MassARRAY Sequenom iPLEX methodology involved the following: The DNA samples were quantified using the PicoGreen method and normalized to 2.5 ng/μl. Primers flanking the gene region containing the SNP were designed using MassArray Designer software. PCR amplifications were carried out using the following conditions: 90°C for 15 min, 45 cycles of 94°C for 20 s, 56°C for 30 s, 72°C for 1 min followed by 72°C for 3 min. MassExtend reaction was carried out with iPLEX assay kit. Primer extension conditions were: 94°C for 30 s, 40 cycles (94°C for 5 s, 5 cycles of [52°C for 5 s, 80°C for 5 s]), and 72°C for 3 min. Genotype calling was obtained by loading the products to a MassARRAY Compact System. The SNP genotyped by MassARRAY Sequenom iPLEX methodology were rs3756261A>G, rs11568835G>A, rs11568849A>C and rs11568943G>A.
Statistical analysis The χ2-test or Fisher’s exact test were used to test the genotypes at each polymorphic locus for Hardy– Weinberg equilibrium (HWE) and to compare allele frequency differences between cases and controls. Linear regression analysis was performed to study the association of SNP genotypes with birthweight in healthy pregnancies, with adjustment for potential confounding variables, including maternal weight, gestation at delivery, and fetal sex. The genotype was treated as a quantitative variable coded 0, 1 or 2 to represent the number of variant alleles, consistent with an additive model. The UNPHASED software suite10 was used to estimate haplotype frequencies, and for hypothesis testing for case–control analysis of the association of haplotypes with pre-eclampsia and the weight of babies at birth. Rare haplotypes occurring at
1238
frequencies of less than 0.05 were dropped from hypothesis testing.
Bioinformatic analysis In silico functional analysis of rs3756261A>G was carried out using FastSNP (freely downloadable from http://fastsnp.ibms.sinica.edu.tw/pages/input _CandidateGeneSearch.jsp).
Results Population genetic studies The following six SNP were not polymorphic: rs11568849A>C, rs28553469G>C, rs35191533T>A, rs11568992C>G, rs11569046T>C and rs11569098C>T. These were not taken forward for genotyping in the case–control study. The alleles found in this population for each SNP were A, G, T, C, T, and C, respectively. The allele frequencies of the polymorphic SNP are shown in Table 3; all were in HWE. Case–control studies Genotypes of all cases and controls were in HWE. The results of case–control analysis for the polymorphic SNP in the EGF gene are in Table 4. rs3756261A>G, rs11568943G>A, and rs11569017A>T were associated with pre-eclampsia (P < 0.05). rs3756261A>G showed the strongest individual association with the A allele found more in cases than in controls (P = 0.01). Thereafter, as the objective of this study was to refine the two SNP (rs4444903G>A and rs2237051G>A) haplotypes reported by us previously to be associated with pre-eclampsia by adding additional SNP, case– control haplotype analysis was undertaken constructing haplotypes by adding one new SNP at a time to the two previous SNP (rs4444903G>A and rs2237051G>A). The SNP added were the three SNP that were
© 2014 The Authors Journal of Obstetrics and Gynaecology Research © 2014 Japan Society of Obstetrics and Gynecology
Pre-eclampsia, low birthweight and EGF
Table 3 Genotype and allele frequencies of polymorphic SNP Genotype frequency n (%)
SNP ID rs3756261A>G rs11568835G>A rs4444903G>A† rs11568943G>A rs2237051G>A† rs11569017A>T rs4698803A>T
AA 25 (93%) GG 24 (86%) GG 35% GG 26 (93%) AA 33% AA 28 (97%) TT 23 (82%)
AG 2 (7%) GA 4 (14%) GA 47.5% GA 2 (7%) AG 43% AT 1 (3%) TA 4 (14%)
GG 0 (0%) AA 0 (0%) AA 17.5% AA 0 (0%) GG 24% TT 0 (0%) AA 1 (4%)
Allele frequency n (%) A 52 (96%) G 52 (93%) G 58.8% G 54 (96%) A 54.7% A 57 (98%) T 50 (89%)
G 2 (4%) A 4 (7%) A 42.2% A 2 (4%) G 45.3% T 1 (2%) A 6 (11%)
†Genotyped previously. SNP, single nucleotide polymorphism.
Table 4 Genotyping results of the SNP in the EGF gene in pre-eclampsia cases and normal pregnancy controls Cases – n (%)
SNP ID rs3756261A>G rs11568835G>A rs4444903G>A† rs11568943G>A rs2237051G>A† rs11569017A>T rs4698803A>T
AA 143 (88%) GG 140 (86%) GG 56 (32%) GG 139 (86%) GG 51 (29%) AA 140 (84%) TT 131 (80%)
AG 17 (11%) GA 21 (13%) GA 79 (45%) GA 20 (12%) GA 85 (49%) AT 26 (16%) AT 31 (19%)
Controls – n (%) GG 2 (1%) AA 2 (1%) AA 39 (22%) AA 2 (1%) AA 39 (22%) TT 1 (1%) AA 2 (1%)
AA 116 (75%) GG 136 (87%) GG 56 (33%) GG 115 (75%) GG 41 (24%) AA 118 (72%) TT 130 (79%)
AG 33 (21%) GA 21 (13%) GA 78 (46%) GA 34 (22%) GA 73 (43%) AT 43 (26%) AT 33 (20%)
GG 5 (3%) AA 0 (0%) AA 37 (22%) AA 5 (3%) AA 57 (33%) TT 2 (1%) AA 2 (1%)
χ2 = 9.02, d.f. = 2, P = 0.01 χ2 = 1.95, d.f. = 2, P = 0.38 χ2 = 0.03, d.f. = 2, P = 0.98 χ2 = 7.03, d.f. = 2, P = 0.03 χ2 = 5.33, d.f. = 2, P = 0.07 χ2 = 6.35, d.f. = 2, P = 0.04 χ2 = 0.06, d.f. = 2, P = 0.97
†Genotyped previously. EGF, epidermal growth factor; SNP, single nucleotide polymorphisms.
associated with pre-eclampsia (rs3756261A>G, rs11568943G>A, and rs11569017A>T). Rare haplotypes occurring in a frequency of less than 5% were excluded from the analysis. The most significant association was found when the haplotypes were defined by rs3756261A>G; rs4444903G>A and rs2237051G>A (likelihood ratio χ2 = 22.5139, d.f. = 4, P-value = 0.0002). The detailed haplotype analysis using these three SNP is in Table 5. The rs3756261A, rs4444903G, rs2237051G haplotype appeared to be the one that was associated with increased risk of pre-eclampsia (odds ratio [OR] = 3.70, 95% confidence interval [CI]: 1.38–9.94; P = 0.016).
Quantitative trait studies The results of analysis of the association of the polymorphic SNP in the EGF gene with the weight of
babies at birth is in Table 6. None of the SNP were individually associated with the weight of babies at birth. Thereafter, as the objective of this study was to refine the two SNP haplotypes reported by us previously to be associated with pre-eclampsia by adding additional SNP, quantitative trait haplotype analysis was undertaken constructing haplotypes by adding one new SNP at a time to the two previous SNP (rs4444903G>A and rs2237051G>A). Rare haplotypes occurring in a frequency of less than 5% were excluded from the analysis. These haplotype combinations were not significantly associated with birthweight. Therefore, the association of haplotypes defined by SNP in combination with the SNP that was individually associated with birthweight (i.e. rs2237051G>A) was analyzed. The most significant association was found when
© 2014 The Authors Journal of Obstetrics and Gynaecology Research © 2014 Japan Society of Obstetrics and Gynecology
1239
T. Chenthuran et al.
Table 5 Haplotype analysis results for the association of haplotypes defined by rs3756261A>G; rs4444903G>A and rs2237051G>A with pre-eclampsia rs3756261A>G A A A G A †Others
Haplotypes rs4444903G>A rs2237051G>A
Frequency Cases f Controls f
Odds ratio
95% Confidence interval
Individual haplotype P-value
A G G G A
0.41 0.39 0.10 0.04 0.03 0.02
2.14 1.98 3.70 0.73 1.00
0.92–4.97 0.85–4.60 1.38–9.94 0.26–2.03 1.00–1.00
0.283 0.826 0.016 0.001 0.121
G A G A A
0.37 0.38 0.05 0.11 0.06 0.03
†Includes 3 more haplotypes which had frequencies of less than 0.05. They were dropped from hypothesis testing. Likelihood ratio χ2 = 22.5139 d.f. = 4 global P-value = 0.0002.
Table 6 Mean and SD birthweights of babies of normotensive pregnant women as a function of the genotypes of SNP in the EGF gene SNP ID
Genotype
N
Mean
SD
P
rs3756261A>G
AA AG GG GG GA AA GG GA AA GG GA AA GG GA AA AA AT TT TT TA AA
116 33 5 136 21 0 56 78 37 115 34 5 41 73 57 118 43 2 130 33 2
3.00 3.10 3.01 3.05 2.91
0.42 0.37 0.34 0.42 0.34
0.46
2.95 3.01 3.12 3.01 3.08 3.19 3.13 3.02 2.93 3.00 3.07 2.85 3.00 3.09 3.03
0.38 0.42 0.44 0.42 0.36 0.50 0.41 0.40 0.41 0.43 0.35 0.50 0.41 0.44 0.52
0.21
rs11568835G>A rs4444903G>A† rs11568943G>A rs2237051G>A† rs11569017A>T rs4698803A>T
0.16
0.29 0.03 0.88 0.59
†Genotyped previously. Data were analyzed by linear regression of birthweight on maternal EGF genotype, adjusting for the following confounders: maternal weight at booking; period of gestation, and sex of baby. All women were non-smokers. EGF, epidermal growth factor; SD, standard deviation; SNP, single nucleotide polymorphisms.
the haplotypes were defined by rs3756261A>G; rs11568943G>A; rs2237051G>A; rs11569017A>T; and rs4698803A>T (likelihood ratio statistic = 20.4671, d.f. = 3, P-value = 0.0001). The results are in Table 7.
Discussion The objective of these investigations was to further explore the results of our previous work on the association of polymorphism in the EGF gene with pre-
1240
eclampsia and the weight of babies at birth. In these investigations we found further support for our original finding. In our initial study we reported that the rs4444903G, rs2237051G haplotype was marginally associated with pre-eclampsia. The current investigation has shed more light on that finding. We report here that the above-mentioned haplotype when found in combination with the rs3756261A allele (i.e. the rs3756261A, rs4444903G, rs2237051G) is highly significantly
© 2014 The Authors Journal of Obstetrics and Gynaecology Research © 2014 Japan Society of Obstetrics and Gynecology
Pre-eclampsia, low birthweight and EGF
Table 7 Haplotype analysis results for the association of haplotypes defined by rs3756261A>G, rs11568943G>A, rs2237051G>A, rs11569017A>T, and rs4698803A>T with the weight of babies at birth rs3756261A>G
rs11568943G>A
Haplotypes rs2237051G>A
rs11569017A>T
rs4698803A>T
A A A G
G G G A
A G G A
A A A T
T A T T
f
Additive value†
0.40 0.08 0.31 0.10
0.20 0.76 1.20 1.40
95%CI −0.50 −0.49 0.36 0.38
0.91 2.01 2.03 2.41
†Additive value gives the change in expected trait value due to each haplotype, relative to the reference haplotype. Likelihood ratio statistic = 20.4671, d.f. = 3, P-value = 0.0001. There were 12 other haplotypes (including the reference haplotype A-A-A-T-A), which had frequencies of less than 0.05. They were dropped from hypothesis testing. CI, confidence interval.
Figure 2 Binding of CDX2 (transcriptional repressor) to its binding site created by rs3756261A in the 5′ near gene region of epidermal growth factor (EGF). The ‘G’ allele at the polymorphic site abolishes the binding site.
associated with pre-eclampsia (OR = 3.70, 95%CI: 1.38– 9.94; P = 0.016). In addition we also report the association of haplotypes defined by the polymorphisms that we studied with the weight of babies at birth. The haplotypes defined by rs3756261A>G; rs11568943G>A; rs2237051G>A; rs11569017A>T; and rs4698803A>T were the ones most significantly associated with birthweight. rs3756261A, rs11568943G, rs2237051G, rs11569017A, rs4698803T haplotype was the one that was associated with the lower birthweight. This haplotype captures almost 80% of the haplotypes containing the rs3756261A, rs4444903G, rs2237051G allele combination, which defines the haplotype showing the most significant association with pre-eclampsia. Interestingly the rs3756261G, rs11568943A, rs2237051A, rs11569017T, rs4698803T haplotype, the only haplotype containing the rs3756261G allele was associated with the higher birthweight. It is interesting to speculate on the role of rs3756261A>G. When the A allele is present it creates a transcription factor binding site for caudal type homeobox-2 (CDX2). The G allele abolishes the binding site. CDX2 is a transcriptional repressor.11 We hypothesize as follows: CDX2 acts as a repressor when it binds to the rs3756261A site in the 5′ near gene region
of EGF. The repressor activity of CDX2 results in downregulation of EGF expression and EGF receptor mediated signaling (Fig. 2) that is necessary for trophoblast differentiation and invasion leading to defective placentation seen in women with pre-eclampsia and women who deliver low-birthweight babies. EGF may not be the only gene regulated by CDX2. In addition, other transcription factors may also be involved by their action through their binding sites on EGF and other genes. Other interacting transcription factors, interacting with CDX2 and acting independently of it, are also likely to be involved. In that context it is interesting to note that a trophoblast-specific transcriptional circuit involving transcription factors ELF5, CDX2 and EOMES has already been described.12 In addition, EGF is a member of a family of seven genes that act through the same EGF receptor. It would be appropriate therefore to examine polymorphisms in other genes in this family to identify possible sites for transcriptional regulation. Work related to the heparinbinding EGF-like growth factor (HBEGF) gene is ongoing in our laboratory.13 In conclusion, our observations support the possible involvement of CDX2 in the cause of pre-eclampsia and low birthweight acting through transcriptional
© 2014 The Authors Journal of Obstetrics and Gynaecology Research © 2014 Japan Society of Obstetrics and Gynecology
1241
T. Chenthuran et al.
regulation of EGF expression, which needs to be confirmed with functional studies.
Acknowledgments This study was funded by a grant from the National Research Council, Sri Lanka (Grant No: 05-15) and research funding from the Human Genetics Unit Development Fund. T.C. held a postgraduate studentship funded by the IRQUE Project, University of Jaffna, Sri Lanka (Grant No: IRQUE/JA/CON/026). We are grateful to Dr Linda Morgan for her helpful comments on the first draft. Further, the contribution made by Professor Fiona Brought Pipkin and Dr Linda Morgan during the establishment of the pre-eclampsia case–control collection and initial work on EGF gene association studies is also acknowledged.
Disclosure The authors declare that they have no conflicts of interest.
References 1. Chappell S, Morgan L. Searching for genetic clues to the causes of pre-eclampsia. Clin Sci (Lond) 2006; 110: 443–458. 2. Dissanayake VH, Giles V, Jayasekara RW et al. A study of three candidate genes for pre-eclampsia in a Sinhalese population from Sri Lanka. J Obstet Gynaecol Res 2009; 35: 234–242. 3. Dissanayake VH, Tower C, Broderick A et al. Polymorphism in the epidermal growth factor gene is associated with birthweight in Sinhalese and white Western Europeans. Mol Hum Reprod 2007; 13: 425–429.
1242
4. Faraj LE, Lonsdale-Eccles E, Dissanayake VH, Tower C, Morgan L. Fetal epidermal growth factor susceptibility haplotype associated with fetal growth restriction (poster presentation). Ann Clin Biochem 2008; 45: 131. 5. Dissanayake VH, Morgan L, Broughton Pipkin F et al. The urine protein heat coagulation test – a useful screening test for proteinuria in pregnancy in developing countries: A method validation study. BJOG 2004; 111: 491–494. 6. Dissanayake VH, Samarasinghe HD, Morgan L, Jayasekara RW, Seneviratne HR, Broughton Pipkin F. Morbidity and mortality associated with pre-eclampsia at two tertiary care hospitals in Sri Lanka. J Obstet Gynaecol Res 2007; 33: 56– 62. 7. Khong TY, De Wolf F, Robertson WB, Brosens I. Inadequate maternal vascular response to placentation in pregnancies complicated by pre-eclampsia and by small-for-gestational age infants. Br J Obstet Gynaecol 1986; 93: 1049–1059. 8. Jin G, Miao R, Deng Y et al. Variant genotypes and haplotypes of the epidermal growth factor gene promoter are associated with a decreased risk of gastric cancer in a high-risk Chinese population. Cancer Sci 2007; 98: 864–868. 9. Bell GI, Fong NM, Stempien MM et al. Human epidermal growth factor precursor: cDNA sequence, expression in vitro and gene organization. Nucleic Acids Res 1986; 14: 8427– 8446. 10. Dudbridge F. Likelihood-based association analysis for nuclear families and unrelated subjects with missing genotype data. Hum Hered 2008; 66: 87–98. 11. Chun SY, Chen F, Washburn JG et al. CDX2 promotes anchorage-independent growth by transcriptional repression of IGFBP-3. Oncogene 2007; 26: 4725–4729. 12. Hemberger M, Udayashankar R, Tesar P, Moore H, Burton GJ. ELF5-enforced transcriptional networks define an epigenetically regulated trophoblast stem cell compartment in the human placenta. Hum Mol Genet 2010; 19: 2456–2467. 13. Harendra GG, Jayasekara RW, Dissanayake VH. Haplotypes of heparin-binding epidermal-growth-factor-like growth factor gene are associated with pre-eclampsia. J Obstet Gynaecol Res 2012; 38: 239–246.
© 2014 The Authors Journal of Obstetrics and Gynaecology Research © 2014 Japan Society of Obstetrics and Gynecology
