Molecular and Cellular Probes (1992) 6, 13-19

Polymerase chain reaction with additional primers allows identification of amplified DNA and recognition of specific alleles

Urs Candrian,* Christiane Hofelein and Jurg Luthy Institute of Biochemistry, Laboratory of Food Chemistry, University of Berne, Freiestrasse 3, 3012 Berne, Switzerland (Received 23 August 1991, Accepted 25 September 1991)

The use of additional primers in the standard two primer polymerase chain reaction (PCR) is described . This modification allows detection of a target gene in a single reaction, and identification of the amplification product obtained or recognition of a specific allele . The oligonucleotides used are internal to the original amplification primers and amplification-compatible with one of the original primers. Annealing of an additional primer to the target gene as well as to the primary amplification product will lead to the appearance of an additional smaller amplification fragment upon agarose gel electrophoresis of PCR products . Use of one or more allele-specific oligonucleotides as additional primers, in addition to two gene-specific primers, will allow recognition of different alleles of the target gene in a single PCR without further analysis except gel electrophoresis . The general applicability of the method was determined with several PCR assays for the detection of pathogenic bacteria .

KEYWORDS : Polymerase chain reaction, Listeria monocytogenes, Escherichia coli, enterotoxigenic .

INTRODUCTION The polymerase chain reaction is a powerful diagnostic tool for the DNA analysis of human genetic

samples the extremely high sensitivity of the PCR and the minimal sample clean-up required are important features .

diseases and for the detection and identification of micro-organisms in human infection or in environmental samples such as surface water and food . 1,2 Infectious diseases represent a considerable threat to

However, in these samples a variety of background DNA from different sources must be expected . This raises the possibility of the appearance of artefactual amplification products, which are not specific for the micro-organism detected . Analysis of amplification products by simple and rapid agarose gel electrophoresis for fragment size determination might not be sufficient, and might yield false-positives . Therefore, further identification of amplified fragments by

human health and DNA analytical techniques might offer improved diagnostic procedures . Advantages of the PCR include the possibility of adjusting the specificity of DNA analysis to a group of related micro-organisms or to a single species or even to a specific bacterial or viral strain . Furthermore, DNA analysis allows the specific detection of microbial properties like virulence factors and genes conferring resistance to antibiotics . In case of environmental

restriction endonuclease analysis or hybridization with a specific oligonucleotide is required . An alternative approach is to perform a second

* Author to whom correspondence should be addressed .

0890-8508/92/010013 + 07 $03 . 00/0

13

© 1992 Academic Press Limited

U. Candrian et al.

14

stage of amplification using a second set of primers

standard two-primer PCR method, which involves the

nested within the first . This modification of the PCR

use of only one additional gene- or allele-specific

was originally suggested by Mullis & Faloona 3 to

primer and can be performed in a single amplification

overcome insufficient specificity of the PCR process

reaction .

associated with the use of the Klenow fragment of

Escherichia coli

DNA polymerase I . The introduction

of thermostable Taq polymerase" allowed sufficient

MATERIALS AND METHODS

specificity by increasing the annealing temperature to above 50° C, and nested primer PCR has rarely been since applied . Nevertheless, nested primer PCR with

PCR assays"

labelled primers has been used to identify amplified

Listeria monocytogenes : hlyA-PCR

DNA .' All of these identification methods are time-con-

The oligonucleotides used detect the hlyA gene,

suming and laborious, which is unsuitable for the which encodes the a-haemolysin of L . monocytorequirements of a clinical laboratory as well as for

genes . ` All oligonucleotide sequences are listed in

food analysis . We developed a modification of the

Table 1 . Optimized amplification reactions took place

Table 1 .

Oligonucleotides for standard PCR and for PCR with additional primers

PCR assay

Oligonucleotides, 5'-+3'

PCR fragment

Fragment length

hlyA

L01, CGGAGCTTCCGCAAAAGATG L04, CCTCCACACTCATCCATGTT

L01-L04

234 bp

L02, CATCGACGCCAACCTCGGA

L02-L04

204 by

or L03, CCATCTGTATAAGCTTTTGAAC

L01-L03

207 by

AD03-AD07

131 by

AD08, GCCGCAGGTGTAGTTGCTTG or AD09, CTACACAAGCAACTACACCT

AD03-AD08

69 by

AD09-AD07

87 by

EC03, TCGCCACACGCTGACGCTGACCA EC04, TTACATGACCTCGCTTTACTTCACAGA

EC03-EC04

595 by

EC07, GATTTAAGCCATCTCCTGATGA

EC03-EC07

514 by

LT01, TTACGGCGTTACTATCCTCTCTA LT03,GGTCT000TCAGATATGTGATTC

LT01-LT03

275 by

LT02, CATTTCAGGTCGAAGTCCCG

LT02-LT03

101 by

ECO1, TTITTTCTGTATTITCTTTIICIICTTTIIITCAG EC02, CCAGGATTACAACAIAITTCACAGC

ECO1-EC02

175 by

EC05-EC02

103 by

ECO1-EC06

143 by

internal to the L01-L04 fragment :

iap'

AD03, ACAAGCTGCACCTGTTGCAG AD07,TGACA000TGTGTAGTAGCA internal to the AD03-AD07 fragment :

malB

internal to the EC03-EC04 fragment :

LT]

internal to the LT01-LT03 fragment :

STI

internal to the ECO1-EC02 fragment ; EC05, CATTAGAGACTAAAAAGTGTGAT or' EC06, GCTACTATTCATGCTTTCAGGA

* Oligonucleotides AD03, AD07, AD08, and AD09 were previously described by Datta et al.' ' Oligonucleotides EC05 and EC06 are allele-specific and recognize different alleles of the target gene .

Identification of amplification products

in 100 pl reaction mixtures containing template DNA in 50 mm KCI, 10 mm Tris (pH 8-4),2-0 MM MgCl 2, each

15

listed in Table 1 . Amplification reaction mixtures, reaction temperatures, and reaction times were the same as for h/yA-PCR except that the Mg = ` concentration was 1 . 5 mm .

primer at 0 . 25 pm, each dNTP (dATP, dCTP, TTP, dGTP) at 200 pm, gelatin at 100 pg ml - ', Triton X-100 at 0-1%, and 2 units of Taq DNA polymerase. dNTPs were purchased from Boehringer (Mannheim, Germany) and Taq polymerase from Promega (Madison, WI) . The samples were overlaid with mineral oil (80 pl) and subjected to 30 cycles of amplification using a programmable heating block (Techne PHC-1, Princeton, N)) . Segment temperatures were 94 ° C, 55 ° C and 72 ° C . Reaction times were 0 . 5, 1, and 1 min, respect-

STI-PCR The oligonucleotides used detect the estA gene, which encodes the heat-stable toxin type I (STI) of enterotoxigenic E . coli .'' 1 ' All oligonucleotide sequences are listed in Table 1 . Amplification reaction mixtures, reaction temperatures, and reaction times were the same as for hlyA-PCR with the following exceptions : (i) the annealing temperature was 50 ° C ; Escherichia coli :

ively . After the last cycle all samples were incubated for an additional 5 min at 72°C to ensure that the final extension step was complete .

(ii) the Mg`l concentration was 4-O mm ; (iii) primer concentrations were 0 . 5 mm for standard PCR with ECO1/EC02 and triple primer PCR with ECO1/EC02/ EC06. For amplification reactions with ECO1, EC02, and EC05 optimized concentrations were 0 . 75 µnn, 0 . 25 RM, and 0-05µm, respectively . In PCRs with all four primers, concentrations were 0 . 75 pm (EC01), 0 . 25 pm (EC02), 0 . 025 lam (30 cycles) or 0 . 1 pm (50 cycles) (EC05), and 0 . 5 pm (EC06); (iv) in experiments

monocytogenes .; iap-PCR The oligonucleotides used detect the iap (invasion associated protein) gene, which encodes a major extracellular protein (p60) of L . monocytogenes ." All oligonucleotide sequences are listed in Table 1 . Amplification reaction mixtures, reaction temperaListeria

tures, and reaction times were the same as for h/yAPCR .

with human DNA 50 cycles were performed .

coli : ma/B-PCR The oligonucleotides used detect species-specific se." 11 All oligoquences of the ma/13-operon of E . coli nucleotide sequences are listed in Table 1 . Amplifica-

Synthesis of oligonucleotides

tion reaction mixtures, reaction temperatures, and reaction times were the same as for h1yA-PCR with the following exceptions : (i) the Mg" concentration was 3 . 0 mm ; (ii) the annealing temperatures were 60 ° C, 65 ° C or 70 ° C .

tems, Foster City, CA) using (3-cyanoethyl phosphoramidite chemistry . Desalting was over NAP-25 columns (Pharmacia, Uppsala, Sweden) . Oligonucleotides were not further purified .

Escherichia

Escherichia coli :

Oligonucleotides were synthesized on an Applied Biosystems 381A DNA synthesizer (Applied Biosys-

Target DNAs for enzymatic amplification

LTI-PCR

The oligonucleotides used detect the elt gene, which encodes the heat-labile toxin type I (LTI) of enterotoxigenic E . coli ." All oligonucleotide sequences are Table 2.

The bacterial strains used in this study are listed in Table 2 . Except E . coli strain ATCC 37218 all strains

Bacterial strains used in this study

Bacterial strain with identification number

Gene Sequence Present hlyA

L. L.

iap malB

LTI

STI`

Used for PCR assay hlyA

iap ma/B

LTI

STI

monocytogenes #52 serotype 1/2a monocytogenes #54 serotype 4b

E . coli ATCC E . coli #23 E . coli #30 E . coli

• • • •

37218

#38

' E . coli strains estA3/4.

#38

contains the allele estAl

of

the gene encoding

STI .

+ + + + + + +

+ + + + + +

Strain 923 contains the allele estA 2 and strains is30 the allele

16

U . Candrian et alL

were clinical or environmental isolates . Bacteria were lysed by lysozyme and proteinase K digestion . Ali-

(a )

quots of lysis reactions corresponding to 10 5 bacteria were used for amplifications . Human placental DNA was from Sigma (St. Louis, MO) .

Analysis of amplification products Thirty-five to 50 µl of PCR product was separated by gel electrophoresis through 1 . 5% or 2% agarose . DNA was stained with ethidium bromide and made visible by u .v . transillumination . Gels were documented by polaroid photography .

246125-

W

2 3 4

6 7 8 9

RESULTS The strategy for the rapid identification of an amplification product involved the use of a third oligonucleotide internal to the original amplification primers in the same amplification reaction . Such an oligonucleotide will be amplification-compatible with one of the other primers and yield an additional smaller amplification product specific for the target gene .

246123-

Several PCR assays were used to test the feasibility of this approach. Possible PCR primer combinations and expected fragment sizes are listed in Table 1 for all PCR assays carried out in this study (see Material and Methods for further details) . In Fig . 1(a), lanes 1 and 2, the standard hlyA-PCR involving two primers (LO1 and L04) for the detection of L . monocytogenes is shown . The DNA fragment obtained had a size of 234 bp . PCR with the additional oligonucleotide L02 yielded an additional L02-L04 fragment 204 by long (Fig. 1(a), lanes 4 and 5) and oligonucleotide L03 gave the expected additional 207 by L01-L03 fragment (Fig. 1(a), lanes 7 and 8) . The DNA fragment with standard iap-PCR (primers AD03 and AD07) had a size of 131 by (Fig . 1(b), lanes 1 and 2) . Additional PCR fragments were 69 by (AD08) and 87 by (AD09) long (Fig. 1(b), lanes 4, 5 and 7, 8, respectively) . LTI-PCR applied to detect enterotoxigenic E . coli yielded a 275 by fragment with the amplification primers LT01 and LT03 (Fig . 1(c), lanes 1 and 2) . The additional PCR fragment with LT02 (LT02-LT03) had a size of 101 by (Fig. 1(c), lanes 4 and 5) . Another example is ma1B-PCR which is speciesspecific for E. coli . The standard fragment obtained with primers EC03 and EC04 was 595 by long (Fig . 2, lanes 1 and 2) . The calculated melting temperature of these oligonucleotides is above 70 ° C . This allows the use of annealing temperatures in the PCR process of up to 70°C . By contrast, the melting temperature of the third oligonucleotide EC07 (additional 514 by EC03-EC07 fragment) is around 65 ° C . For this reason,

Fig. 1 . Triple primer PCR assays . (a) h/yA-PCR; lanes 1-3 with primers L01 and L04 ; lanes 4-6 with L01, L02, and L04; lanes 7-9 with L01, L03, and L04 . (b) iap-PCR ; lanes 1-3 with primers AD03 and AD07 ; lanes 4-6 with AD03, AD07, and AD08; lanes 7-9 with AD03, AD07, and AD09 . (c) LTI-PCR; lanes 1-3 with primers LT01 and LT03 ; lanes 4-6 with LT01, LT02, and LT03 . Lanes (a) and (b) : 1, 4, and 7, L. monocytogenes # 52 ; 2, 5, and 8, L . monocytogenes #54; lanes 3, 6, and 9, no DNA (negative controls) . Lanes (c) : 1 and 4, E . coli ATCC 37218 ; 2 and 5, E. coli #23 ; 3 and 6, no DNA (negative controls) . Numbers to the left of each panel are basepairs . Lanes 1-3 (b) : Low molecular weight fragments (' 70 bp) are amplification artefacts caused by excess primers .

17

Identification of amplification products

the adjustment of hybridization stringency for the

A valuable application of the idea of using more

third primer to its target was possible by appropriate

than two primers specific for a single gene in PCR is

selection of the annealing temperature . As shown in

the identification of different alleles of the target gene

Fig . 2, lanes 4 and 5, the additional EC03-EC07 was

in a single reaction . In STI-PCR, the standard primers

obtained in good yield when an annealing tempera-

ECO1 and EC02 amplify a 175 by DNA fragment of the

ture of 60° C was used . Increasing the annealing

estA gene . All known alleles of this gene (estAl,

temperature to 65 ° C significantly reduced the yield of

estA2, estA3/4)" - " may serve as templates for STI-

this fragment (Fig . 2, lanes 7 and 8) . At an annealing

PCR (Fig . 3, lanes 1-3).

temperature of 70°C no additional EC03/EC07 frag-

ferences in the amplified region allowed the definition

ment was obtained at all (lanes 10 and 11) .

of two allele-specific internal oligonucleotides . Oligo-

I

3

4

5

6

7

8

9

However, nucleotide dif-

I0

12

738615-1, 492-

369-

Fig. 2. Triple primer malB-PCR . Adjustment of annealing temperature to high stringency . Primer combinations : lanes 1-3, EC03 and EC04, lanes 4-12 EC03, EC04, and EC07 . Annealing temperatures : lanes 1-6, 60 ° C ; lanes 7-9, 65 ° C ; lanes 10-12, 70 ° C . Lanes : 1, 4, 7, and 10; E . coli ATCC 37218 ; lanes 2, 5, 8, and 11, E,

coli #30 ; lanes 3, 6, 9, and 12, no DNA (negative controls) . Numbers to the left are basepairs . 13

14

15

16

Fig. 3 . Allele-specific STI-PCR . Primer combinations : lanes 1-4, EC01 and EC02 ; lanes 5-8, ECO1, EC02, and EC05 ; lanes 9-12, ECO1, EC02, and EC06 ; lanes 13-16, ECO1, EC02, EC05, and EC06 . Lanes : 1, 5, 9, and 13, E . coli #38 (estAl) ; 2, 6, 10, and 14, E . coli #23 (estA2) ; 3, 7, 11, and 15, E . coli #30 (estA3/4) ; 4, 8, 12, and 16, no DNA (negative controls) . Numbers to the left are basepairs .

18

U. Candrian et al.

nucleotide EC05 is sequence-specific for allele estAl whereas the sequence of oligonucleotide EC06 is complementary to alleles estA2 and estA3/4 . As shown in Fig . 3, STI-PCR with the additional oligonucleotide EC05 yielded an additional 103 by EC05-EC02 fragment with allele estAl (lane 5) but not with allele estA2 (lane 6) or estA3/4 (lane 7) . In contrast, STI-PCR with EC06 gave an additional 143 by ECO1-EC06 fragment with alleles estA2 (Fig . 3, lane 10) and estA3/ 4 (lane 11) but not with allele estAl (lane 9) . Use of all

DISCUSSION The results of this study indicate that the use of additional primers in PCR is a practical approach simplifying analysis of PCR products and reducing the time required for analysis . In contrast to multiplex PCR, in which multiple primer pairs are used for the detection of several different target genes in a single

four primers together allowed distinction between alleles in a single amplification reaction (Fig . 3, lanes 13-15) . The following is an example of the use of the described approach in the recognition of artefactual amplification products . With the primers EC01 and EC02 (STI-PCR for enterotoxigenic E . coli) human DNA yields a band of about 175 by (not shown) . This

reaction, the use of three or more primers specific for the same target gene allows the detection of a target gene and its identification by the generation of a second band of specific size . In addition, use of a third allele-specific primer makes it possible to recognize not only a specific gene, but also a single allele . Sufficient hybridization stringency can be achieved by choosing an internal primer with a lower melting temperature than the standard PCR primers . The fact that the third primer can be added to the reaction

amplification artefact, which has the potential of producing false-positives in STI-PCR, could easily be recognized by PCR with the additional primers EC05 and EC06 . As shown in Fig. 4, lanes 1-3, human DNA does not yield the additional fragments specific for allele estAl (lane 5) or alleles estA2 and estA3/4 (lane 4) .

mixture in the same concentration as the original two primers, for which the concentration usually has been optimized, underlines the general applicability of the method . However, this is not the case for STIPCR . When all four primers were used a careful optimization of primer concentrations was necessary to obtain DNA fragments from all possible primer

2

4

6

492369-

246- 175 143 125- 103

Recognition of a 175 by artefactual STI-PCR fragment obtained with human DNA . Primer combination : ECO1, EC02, EC05, and EC06 . Lanes: 1, 10 µg human DNA ; 2, 1 µg human DNA; 3, 0 . 1 µg human DNA ; 4, E . coli #23 (estA2) ; 5, E . coli #38 (estA1) ; 6, no DNA (negative controls). Numbers to the left and right are basepairs . Fig. 4.

Identification of amplification products combinations . This is possibly due to primer-primer interactions caused by the high inosine content of ECO1, that allows complementary primer alignment . The generation of a primer-primer artefact becomes predominant in negative control samples without target DNA (Fig . 4, lane 6) . Application of the described approach to the analysis of pathogenic bacteria in food samples may substantially shorten the time required compared to conventional hybridization and detection . This is especially important in the case of perishable foods, which cannot be stored for very long . Rapid DNA analysis methods might also be helpful in food industry where testing of raw materials is necessary before processing . Currently, several 'DNA analysis tests for pathogenic micro-organisms are available for the clinical laboratory .' These tests rely on conventional hybridization protocols without in vitro DNA amplification and their widespread use is hampered by extensive sample handling, which requires qualified technicians . PCR protocols not only reduce overall analysis time but also the time required to handle individual samples . In addition, the described modification simplifies post-PCR analysis and reduces need for qualified analysts . Other fields where described modification of PCR may be helpful epidemiological studies (allele-specific PCR tests),

the the are the

identification of different bacterial species in a single amplification reaction 16 and the determination of point mutations (in conjunction with ARMS-PCR, see reference 17) .

ACKNOWLEDGEMENTS We thank M . Allmann and P . Burkhalter for the critical reading of this manuscript .

REFERENCES 1 . Landegren, U ., Kaiser, R ., Caskey, C . T. & Hood, L . (1988) . DNA diagnostics-Molecular techniques and automation . Science 242, 229-37 . 2 . Mifflin, T. E . (1989) . Use and application of nucleic acid probes in the clinical laboratory . Clinical Chemistry 35, 1819-25 . 3 . Mullis, K . B . & Faloona, F . A. (1987) . Specific synthesis of DNA in vitro via a polymerase catalyzed chain reaction . Methods in Enzymology 155, 335-50 . 4 . Saiki, R . K ., Gelfand, D . H ., Stoffel, S . et al. (1988). Primerdirected enzymatic amplification of DNA with a thermostable DNA polymerase. Science 239, 487-91 .

19

5 . Dahlen, P ., litia, A ., Mukkala, V .-M ., Hurskainen, P . & Kwiatkowski, M . (1991) . The use of europium (Eu'') labelled primers in PCR amplification of specific target DNA. Molecular and Cellular Probes 5, 143-9 . 6 . Mengaud, J ., Vicente, M .-F., Chenevert, J. et al. (1988) . Expression in Escherichia coli and sequence analysis of the listeriolysin 0 determinant of Listeria monocytogenes . Infection and Immunity 56, 766-72 . 7 . Furrer, B., Candrian, U ., Hofelein, Ch . & Luthy, J . (1991) . Detection and identification of Listeria monocytogenes in cooked sausage products and milk by in vitro amplification of haemolysin gene fragments . journal of Applied Bacteriology 70, 372-9 . 8 . Datta, A . R ., Wentz, B . A ., Shook, D . & Trucksess, M . W . (1988) . Synthetic oligodeoxyribonucleotide probes for detection of Listeria monocytogenes . Applied and Environmental Microbiology 54, 2933-7 . 9 . Kohler, S ., Leimeister-Wachter, M ., Chakraborty, T ., Lottspeich, F . & Goebel, W . (1990) . The gene coding for protein p60 of Listeria monocytogenes and its use as a specific probe for Listeria monocytogenes . Infection and Immunity 58, 1943-50 . 10 . Dahl, M. K ., Francoz, E ., Saurin, W ., Boos, W ., Manson, M . D . & Hofnung, M . (1989) . Comparison of sequences from the malB regions of Salmonella typhimurium and Enterobacter aerogenes with Escherichia coli K12 : A potential new regulatory site in the interoperonic region . Molecular and General Genetics 218, 199-207 . 11 . Candrian, U ., Furrer, B ., Hofelein, Ch ., Meyer, R ., Jermini, M . & Luthy, J . (1991) . Detection of Escherichia coli and identification of enterotoxigenic strains by primerdirected amplification of specific DNA sequences . International Journal of Food Microbiology 12, 339-52 . 12 . Furrer, B ., Candrian, U . & Luthy, J . (1990) . Detection and identification of E . coli producing heat-labile enterotoxin type I by enzymatic amplification of a specific DNA fragment . Letters in Applied Microbiology 10, 314. 13 . So, M . & McCarthy, B . J . (1980) . Nucleotide sequence of the bacterial transposon Tn1681 encoding a heatstable (ST)toxin and its identification in enterotoxigenic Escherichia coli strains . Proceedings of the National Academy of Sciences, USA 77, 4011-5 . 14 . Guzman-Verduzco, L .-M . & Kupersztoch, Y . M . (1989) . Rectification of two Escherichia coli heat-stable enterotoxin allele sequences and lack of biological effect of changing the carboxy-terminal tyrosine to histidine . Infection and immunity 57, 645-8 . 15 . Candrian, U ., Furrer, B ., Hofelein, Ch . & Luthy, J . (1991) . Use of inosine-containing oligonucleotide primers for enzymatic amplification of different alleles of the gene coding for heat-stable toxin type I of enterotoxigenic E . coli . Applied and Environmental Microbiology 57, 95561 . 16 . Border, P . M ., Howard, J . J ., Plastow, G . S . & Siggens, K . W . (1990) . Detection of Listeria species and Listeria monocytogenes using polymerase chain reaction . Letters in Applied Microbiology 11, 158-62 . 17 . Newton, C . R ., Graham, A ., Heptinstall, L . E . et al . (1989) . Analysis of any point mutation in DNA . The amplification refractory mutation system (ARMS) . Nucleic Acids Research 17, 2503-16 .