Journal of Virological Methods, 40 (1992) 307-322 0 1992 Elsevier Science Publishers B.V. / All rights reserved / 0166-0934/92/$05.00

VIRMET

307

01421

Polymerase chain reaction for differentiation between pathogenic and non-pathogenic serotype 1 Marek’s disease viruses (MDV) and vaccine viruses of MDV-serotypes 2 and 3 Yechiel Beckera, Yael Ashera, Eynath Tabora, Irit Davidsonb, Mertyn Malkinsonb and Yoram Weismanb “Department of Molecular Virology, Faculty of Medicine. Hebrew University of Jerusalem, Jerusalem (Israel) and bDepartment of Poultry Diseases, Kimron Veterinary Institute, Beit Dagan (Israel)

(Accepted

13 July 1992)

Summary

A polymerase chain reaction (PCR) test based on primers flanking the 132 bp tandem repeat in pathogenic MDV-1 DNA was developed. These primers amplify a dimer or a trimer 132 bp repeat in pathogenic MDV-1 DNA from blood and organs of commercial chickens with Marek’s disease (MD) symptoms. Using the same primers in a radioactive PCR test, it was possible to distinguish between vvMDV-1 and the non-pathogenic MDV-1 CVI-988 vaccine in which the 132 bp repeats in the DNA were increased up to 9 repeats. The MDV- 1 specific primers did not amplify MDV-2 (SB 1) and MDV-3 (HVT) DNA. Primers prepared according to the nucleotide sequence of MDV-1 antigen A gene amplified MDV-1 DNA only. Specific primers prepared according to the nucleotide sequence of MDV-3 (HVT) antigen A gene amplified MDV-3 DNA but not MDV-1 nor MDV-2 DNA. The results of the present study show that the PCR tests can be used for the early identification of vvMDV-1 DNA in pathological samples from diseased commercial chickens and to distinguish between the vvMDV-1 and the three types of virus vaccines used to immunize chickens. The tests are accurate and can be performed in the presence of vaccine virus DNA in the sample. MDV-1;

Marek’s

disease;

Pathogenicity

Correspondence to: Y. Becker, Department University of Jerusalem, Jerusalem, Israel.

gene;

of Molecular

132 bp repeat; Virology,

Faculty

MDV-2; of Medicine,

MDV-3 Hebrew

308

(HVT);

Antigen

A gene; Polymerase

chain reaction

(PCR)

Introduction Oncogenic Marek’s disease virus, the causative agent of T cell lymphomas in chickens, is an alphaherpesvirus which contains within the repeat sequences of the UL a gene which is considered to be involved in lymphomagenesis. Bradley et al. (1989) reported that the lymphomagenesis gene is characterized by the presence of tandem arranged direct repeats, each of 132 bp (Hirai et al., 1981; Fukuchi et al., 1985). The mRNA from the lymphomagenesis gene is spliced and gives rise to a family of several mRNAs. Cui et al. (1991) identified the gene for the phosphoprotein pp38 with the MDV-1 BamHI-H DNA fragment and indicated that this viral protein is the only presently known antigen to be consistently associated with the transformed state and may play a significant role in MDV transformation. Thus, the amplification of the 132 bp repeats in non-pathogenic MDV- 1 viruses might lead to a change in the expression of the pp38 gene and/or genes for additional virus genes involved in transformation. Three types of viruses have been developed as vaccine strains to protect chickens from Marek’s disease: (a) serial passages of pathogenic MDV-1 isolates in CEF in vitro which lead to attenuated non-pathogenic MDV-1 vaccine viruses (Witter, 1987). Maotani et al. (1986) reported on the amplification of the tandem direct repeats in MDV-1 DNA in an apathogenic MDV-1 as the result of the serial in vitro passages; in addition Rispens (1972) reported on the isolation of a naturally occurring apathogenic MDV-1 isolate; (b) avian herpesvirus (designated MDV serotype 2 (MDV-2) (Schat et al., 1978) and (c) herpesvirus of turkeys (HVT) (designated MDV serotype 3 (MDV-3) (Okazaki et al., 1970). The three non-pathogenic viruses are used as live virus vaccines for the immunization of commercial chicken flocks against infection with the pathogenic MDV-1. Nevertheless, despite the mostly effective vaccination, commercial flocks often develop Marek’s disease, sometimes accompanied by marked economic losses. Viruses of all three serotypes are used as vaccines for the protection of chickens against infection with oncogenic MDV-1 viruses widely differing in pathogenicity. These three viruses may be distinguished following propagation in cultured chick or duck embryo libroblasts by immunofluorescence using serotype-specific monoclonal antibodies (Lee et al., 1983). It was reported that nucleotide sequences in BarnHI-D and BarnHI-H fragments of the viral genome were altered after in vitro passage of vvMDV-1 isolates and it was suggested that these genomic changes in the BumHI-D and H DNA sequences were associated with attenuation of viral lymphomagenesis (Hirai et al., 1981; Fukuchi et al., 1985; Silva and Witter, 1985; Silva and Barnett, 1991). Maotani et al. (1986) reported that pathogenic MDV-1 DNA contains three units of a

309

tandem direct repeat, each with 132 base pairs (bp) in the terminal and internal repeats of the unique L fragment of MDV-1 DNA, while the presence of two units of tandem direct repeat in MDV-1 DNA fragment BarnHI-H was reported by Bradley et al. (1989). However, Kanamori et al. (1986) reported on the presence of two or three tandem direct repeats in oncogenic MDV-1, and on two tandem repeats in MDV-1 DNA present in transformed MD cell lines. The availability of the polymerase chain reaction (PCR) technique for the amplification of segments within the viral genome for which the nucleotide sequences are known (Saiki et al., 1988) led us to develop a PCR test for the identification of pathogenic and non-pathogenic MDV-1 and to distinguish them from MDV-2 and from MDV-3 (HVT) viruses. To differentiate pathogenic from non-pathogenic MDV-1 isolates, we selected nucleotide sequences flanking the 132 bp repeats in the BarnHI-H and BarnHI-D fragments of the viral genome. To identify all three serotype viruses, we also developed a second PCR test based on unique sequences in the antigen A gene of serotypes 1 and 3 (Manabe et al., 1988). The present study provides PCR tests to identify pathogenic MDV-1 isolates in clinical material from outbreaks of Marek’s disease (MD) in flocks of commercial chickens and cell culturepassaged pathogenic and non-pathogenic MDV serotype 1 strains. The MDV- 1 viruses were also differentiated from MDV serotype 3 (HVT) (Okazaki et al., 1970) and MDV serotype 2 (SBl) viruses using a PCR test based on antigen A nucleotide sequences.

Materials and Methods Very virulent (vv)MDV-1

field isolates

The following MDV-1 isolates were used: B was isolated from 4-month-old egg type pullets. BA was isolated from a 3-month-old meat type breeder flock. SB was isolated from 3.5-month-old broiler breeders (Arbor Acres). N was isolated from a 7-month-old egg type breeder flock. Y was isolated from a 6month-old egg type breeder flock. Sh was isolated from a 4-month-old broiler breeder (Arbor Acres). A was isolated from 6-week-old broilers. M was isolated from 6-week-old broilers. These viruses were isolated from blood which was inoculated into duck embryo fibroblast cultures (DEF) and propagated in DEF or specific pathogen-free (SPF) chick embryo fibroblasts (CEF) cell cultures. Vaccine viruses MDV Serotype 1 (CVI-988; Rispens et al., 1972); MDV Serotype 2 SB-1 (Schat et al., 1978); MDV Serotype 3 HVT (Okazaki et al., 1970). DNA preparations of these viruses were obtained from the commercial vaccine vials.

310

Collection of blood and internal organs from commercial chickens Commercial chickens showing MD symptoms were bied and then killed by cervical dislocation and internal organs showing tumors were dissected and kept at -20°C. Extraction

of DNA from infected tissues and cell cultures

Total cell DNA was extracted from organs of MD chickens, from infected CEF and vaccine ampules by overnight incubation in 1% SDS and 500 ,@ml Proteinase K, at room temperature. The DNA was extracted by phenolchloroform as described for large DNA preparation (Sambrook et al., 1989) Cloned MD V-DNA The BarnHI-H and BarnHI-D fragments from MDV-1 GA were a gift from Dr. M. Nonoyama (Institute of Biomedicine in Florida, USA) PCR detection of the 132 bp nucleotide repeat sequence Total DNA preparations from MDV-1, MDV-2 or MDV-3~HVT)-infected CEF or organs from naturally infected chickens were used as templates for PCR amplification. As a positive control recombinant plasmids containing the BarnHI-D and H fragments of MDV were used. Primers were selected from the nucleotide sequence flanking the 132 bp repeat sequence located within the BarnHI-H fragment (Bradley et al., 1989). The direct primer: 5’ TACTTCCTATATAGATTGAGACGT (24 mer) The reverse primer: 5’ GAGATCCTCGTAAGGTGTAATATA (24 mer) The direct primer is located 65 bp 5’ to the tandem 132 bp repeat. The reverse primer is 10.5 bp downstream of the 132 bp repeat. Altogether the expected amplified DNA band size in the case of a double 132 repeat is 434 bp. DNA (500 ng) was mixed with 50 PM of each of dNTPs and 20 PM of each of the primers in a final volume of 45 ,r.d.The mixture was overlaid with mineral oil (Sigma) and heated to 98°C for 10 min in a MJ Research Programmable Thermal Controller. The reaction was cooled to 55°C for 10 min. During this time 5 ,LL~ of PCR buffer x 10 (500 mM KCl, 100 mM Tris-HCl (pH 9 at 25°C) 15 mM MgC12, 1% Triton X-100) and 2.5 units of Taq polymerase (Promega) were added. In some cases 0.5 ,Li of [a-32p]dCTP (NEN) was added to each reaction mixture. The PCR reaction was carried out as follows: 35 cycles of 94°C for 30 s, 55°C for 30 s and 72°C for 60 s. A negative control was included in each PCR experiment from which DNA was omitted. The PCR products were run on a 1.3% agarose gel and on a 6% polyacrylamide gel in Tris Borate/EDTA buffer. The polyacrylamide gels were stained with ethidium bromide to identify the bands and their size, dried at

311

80°C on filter paper and subjected PCR differential detection of MDV-I primers

to autoradiography. and HVT

(MDV-3)

using antigen A gene

Primers were selected from unique and homologous parts of the antigen A genomic sequences of pathogenic MDV-1 or vaccine virus MDV-3 (HVT) (Manabe et al., 1988). The direct primer common to both MDV-1 and MDV-3 (HVT) antigen A gene: 5’ ATACCACGCCAACGAAAAGAATGT (24 mer).

The reverse primer for both MDV-1 and MDV-3 (HVT) antigen A gene: 5’ CTATAGTACATATTGCATACCCAT (24 mer). The expected band size for the PCR product is 686 bp. The direct primer for MDV-3 (HVT) antigen A gene (unique for HVT): 5’ GTTCTACCGGACTGCCGCTCGA (21 mer).

The unique reverse primer for MDV-3 (HVT) antigen A gene: 5’ ACATTCTTTTCGTTGGCGTGGTAT (24 mer). The expected band size for the PCR product is 436 bp. The direct primer for MDV-1 antigen A gene: (unique for MDV-1) GAGGTACCTCATGGACGTTCCACA (24 mer). The reverse primer for unique MDV-1 antigen A gene:

ACATTCTTTTCGTTGGCGTGGTAT

5’

5’

(24 mer).

The expected band size for the PCR product is 314 bp. PCR was performed as described above. The PCR product was electrophoresed on a 1.3% agarose gel with ethidium bromide to detect the amplified DNA.

Results Detection of MDV-I isolates

tandem direct repeat of 132 bp in DNA of VVMDV-I Israeli

Fig. 1 presents the PCR-amplified DNA from seven pathogenic MDV-1 (MDV- 1) isolates obtained in Israel from infected chicken flocks from different parts of the country. The amplified DNA fragments were detected by staining with ethidium bromide. In five of the MDV-1 isolates (Fig. 1, lanes l-5) one DNA fragment was amplified. This fragment corresponded to an amplification of two tandem repeats of 132 bp yielding a DNA band of 453 bp (264 bp plus 189 bp flanking the tandem repeats). However, in two of the isolates (Y and M) (Fig. 1, lanes 6 and 7) the amplified fragment corresponds to three tandem direct repeats (132 bp x 3). The five isolates with the two 132 bp repeats were from commercial flocks affected with numerous lymphomas in the internal organs or from experimentally infected SPF chickens. The pathogenicity of the two MDV-1 isolates which contained three tandem repeats in the viral DNA

312

1%34567691011

5

2

Fig. 1.PCR amplification of the tandem 132 bp repeats in MDV-I DNA of pathogenic isolates passaged in vitro in comparison with the repeats in cloned BumHI-H and BumHI-D DNA fragments of pathogenic MDV-l(G) and non-pathogenic MDV-1 vaccine (Rispens). The left-hand side of the figure denotes the number of base pairs determined according to a m.w. marker. The right-hand side of the figure indicates the number of the 132 bp in the amplified DNA. Lane 1: MDV-1 isolate B; lane 2: MDV-1 isolate SB; lane 3: MDV-1 isolate NS; lane 4: MDV-1 isolate Sh; lane 5: MDV-1 isolate A; lane 6: MDV-1 isolate Y; lane 7: MDV-I isolate M; lane 8: DNA Mol. Weight marker M VI (Boehringer); lane 9: cloned EarnHI-D DNA fragment; lane 10: cloned BumHI-H DNA fragment; lane 11. MDV-I (CVI-988) vaccine DNA (Rispens).

was not different from pathogenic MDV-1 with two 132 bp repeats since they also caused marked growth retardation and lymphomas in the infected chickens. To obtain further information on the amplification of the 132 bp tandem repeats in vvMDV-1 DNA, the PCR-amplified DNA was labeled during the reactions with a radioactive nucleoside triphosphate (Fig. 2). It was found that in the five MDV-1 isolates (Fig. 2, lanes l-5) a dimer tandem 132 bp repeat was amplified, while in the other two pathogenic MDV-1 isolates (Y and M) (Fig. 2, lanes 6 and 7) a trimer 132 bp repeat was amplified. A dimer 132 bp repeat, as well as a monomeric band of one 132 bp (Fig. 2, lanes 6 and 7) were also noted in the pathogenic MDV-1 isolates Y and M. These monomeric and dimeric 132 bp repeats of DNA bands were revealed only in the radioactive PCR test. These results indicate that different MDV-1 isolates can differ in the content of the 132 bp repeat sequences as reported by Kanamori et al. (1986). Since the 132 bp repeats are situated in the terminal repeat of the L segment (TRL) and in the internal repeat of the L segment (IRL) of the MDV genome, the arrangement of the 132 bp repeats in the cloned BumHI-H (IRL) and BumHI-D (TRL) DNA fragments was studied. The plasmids containing the

313

Fig. 2. Radioactive PCR to detect amplified 132 bp tandem repeats in the DNA of CEF infected with MDV-I field isolates cloned BarnHI-D and BarnHI-H DNA fragments and an apathogenic MDV-1 CVI988 vaccine (R&pens) strain. The PCRs described in Fig. 1 were carried out with a radioactive nucleotide triphosphate. The gel described in Fig. 1 was dried and exposed to X-ray film. Lanes as in Fig. 1.

cloned BarnHI-D DNA fragment (Figs. 1 and 2, lanes 9) and BarnHI-H (Figs. 1 and 2, lanes 10) DNA fragments were used in the PCR test. It was found that the cloned BamHI-D (TRL) DNA contained a tandem repeat of the 132 bp sequence (Fig. 1, lane 9). A similar result was obtained when the radioactive PCR test was performed (Fig. 2, lane 9). However, the major amplified DNA band from the cloned BumHI-H DNA fragment had five repeats of the 132 bp sequence and gave an amplified band of 1033 bp (Fig. 1, lane 10 and Fig. 2, lane 10). Moreover, the amplification of monomeric, dimeric, trimeric and tetrameric bands of 132 bp repeats were also noted in the radioactive PCR test (Fig. 2, lane IO). The monomeric 132 bp ampli~ed band contained more radioactivity than the tetrameric band. Contrary to the BamHI-D DNA, the amplified DNA fragment was a dimer tandem 132 bp repeat only (Fig. 2, lane 9). The reason for the difference in the number of the repeats in the BumHI-H and BarnHI-D DNA fragments of the genomic MDV-1 (GA) DNA library is not yet known. It cannot be ruled out that one of the primers is capable of annealing to more than one site on the DNA template.

314

Amplification of the tandem repeat sequence in the DNA MD V-l vaccine virus (CVI-988 Rispens)

qf an upathogenic

Amplification of the repeat sequence in the naturally occurring apathogenic serotype MDV-1 vaccine virus (CVI-988 Rispens vaccine) gave a faintly positive result of DNA amplification which was hardly seen upon staining with ethidium bromide (Fig. 1, lane 11). The radioactive PCR (Fig. 2, lane 11) which was carried out with CVI-988 DNA revealed that the number of tandem repeats was markedly extended and amplified (Fig. 2, lane 11). Although the dimer 132 bp repeat was the most prominently labeled DNA band, monomer, dimer, trimer, tetramer, pentamer, and hexamer 132 bp repeats were detectable as amplified and radioactively-labeled DNA bands (Fig. 2, lane 11). Additional faint bands containing seven, eight and nine multimers were also observed. This observation was reproduced in additional PCR tests with the CVI-988 Rispens virus from commercial vaccine vials. Another vaccine virus, Md11/75c, developed by Witter (1992), was studied by PCR. The amplified pattern of the 132 bp was identical to that of CVI-988 Rispens vaccine virus (Becker et al., submitted for publication). Thus, the radioactive PCR may be used to distinguish between pathogenic and non-pathogenic MDV-1 viruses using the change in the number of 132 bp repeats in the apathogenic virus to differentiate it from the vvMDV-1 isolates which have two or three 132 bp repeats. PCR analysis of the 132 bp repeats of VVMDV-1 in DNA preparations clinical material obtained from commercial chickens with MD symptoms

from

Samples of organs removed from commercial chickens with MD symptoms were obtained at necropsy and the DNA was extracted and tested by the radioactive PCR to amplify the 132 bp repeat sequence. It was found that the radioactive PCR test amplified a dimer tandem 132 bp repeat nucleotide sequence similar to that in DNA from the tumor-bearing organs (spleen and liver, Fig. 3A, lanes l-3) and from a VVMDV-1-B isolate passaged in CEF (Fig. 3A, lane 5). A similar dimer of 132 bp repeat sequence was amplified in DNA from CEF infected with heparinized blood from one of the diseased chickens (Fig. 3A, lane 4). A dimeric tandem repeat sequence was found by ethidium bromide staining of amplified DNA (not shown). In contrast, in the nonpathogenic MDV-1 CVI-988 Rispens vaccine amplified 132 bp repeat sequences containing more than nine 132 bp repeats were detected (Fig. 3A, lane 6). To identify further the DNA present in MD commercial chickens with MD symptoms radioactive PCR was carried out on CEF infected with blood of the MDV-Y isolate (Fig. 3B, lane 1). An amplified DNA band containing a trimer 132 bp repeat was detectable. A similar amplified DNA band was obtained in the PCR test with DNA from the kidney of a diseased commercial chicken (Fig. 3B, lane 2) and with DNA from leukocytes from an affected commercial chicken from flock Y (Fig. 3B, lane 3). A faint band of amplified trimer 132 bp

315

A

1234

5

6

B

123456

Fig. 3. PCR analysis of the 132 bp repeats in MDV-1 DNA extracted from organs of chickens with Marek’s disease compared to pathogenic and non-pathogenic MDV- 1. (A) Lanes 1 and 2: spleen from two diseased chickens (NS MDV isolate); lane 3: Liver with tumors (NS); lane 4: CEF infected with blood of one of the above chickens; lane 5: MDV-1 B (passage 10 in CEF); lane 6: non-pathogenic MDV-I vaccine CVI-988 (Rispens). (B) Lane 1: organs obtained from individual MD affected chickens from one flock (Y). CEF fibroblasts infected with blood from a diseased chicken; lane 2: kidney from a diseased chicken; lane 3: blood leukocytes from an infected chicken from flock Y; lane 4: ovary from a diseased chicken from flock MDV-Y; lane 5: blood from a healthy SPF chicken; lane 6: MDV-I (B) field isolate (10 passages in vitro). The numbers to the right of each panel represent dimer and trimer repeats.

sequence was detected in the DNA obtained from the ovary of a diseased chicken from flock MDV-Y (Fig. 3B, lane 4). This was similar to the dimer DNA band amplified from CEF infected with MDV-l(B) (Fig. 3B, lane 6). DNA extracted from whole blood of a healthy SPF chicken was negative in the radioactive DNA test (Fig. 3B, lane 5) while MDV-l(B)-isolate gave an amplified dimer 132 bp band (Fig. 3B, lane 6). Specificity of the radioactive PCR for the 132 bp repeat sequence in dl~~e~entiating between pathogenic ML) V-1, the MD V-l vaccine st$a~n ~ispens and MD V serotypes 2 and 3 To determine the usefulness of the nucleotide primers flanking the tandem 132 bp repeat present in pathogenic MDV-1, the radioactive PCR test was performed with DNA preparations from CEF infected with the vaccine viruses MDV-Z-SBI and MDV-3 HVT. DNA was extracted from CEF infected with MDV-l(B), Rispens vaccine, and three commercial vaccine vials of HVT and

316

Fig. 4. Radioactive PCR to detect the 132 bp repeats in pathogenic MDV-I and vaccine (SBI) and MDV-3 (HVT). To determine the speciticity of the primers which amplify the MDV-I, a radioactive PCR was performed on DNAs from CEF infected with MDV-I MDV-I vaccine (Rispens) {lane 2), 3 vials of commercial HVT vaccine (lanes 3-5), 3 vials commercial vaccine (lanes 6-8) and a DNA preparation of uninfected CEF prepared embryos (lane 9).

strains of MDV-2 132 bp repeats in B isolate (lane I), of MDV-2 (SB-1) from SPF chick

three vaccine vials of SBl. The radioactive PCR test was performed and the results are shown in Fig. 4. In MDV-1 (B) a 132 bp tandem repeat DNA band was ampli~ed (Fig. 4, lane 1). In the non-pathogenic MDV-1 Rispens vaccine bands of amplified 132 bp repeats up to a hexameric repeat were detected (Fig. 4, lane 2). The primers did not amplify any DNA in the HVT DNA (Fig. 4, lanes 3-5) or in SBl DNA (Fig. 4, lanes 6-8). DNA from uninfected CEF (SPF embryos) was negative (Fig. 4, lane 9). This result indicates that the radioactive PCR test amplified the 132 bp repeat sequence present in pathogenic MDV-1 and in the non-pathogenic MDV-1 Rispens viruses. Such 132 bp repeats might not be present in the MDV-2 and MDV-3 DNA genomes, or alternatively, the MDV-1 nucleotide sequences used as primers in the PCR test are not present in MDV-2 and MDV-3 DNAs.

317

A

1 2 3 4 5 6 7 8 9 10 11 12

13 14

436

B

1 2 3 4 5 6 7 8 9 10 1112 13 14

Fig. 5. PCR test with primers from antigen A sequences specific for MDV-1 or HVT virus DNA which allow the specific detection of MDV-I or MDV-3. Two sets of primers were prepared according to nucleotide sequences of antigen A of MDV-1 and MDV-3 (HVT) selecting sequences that differ in the two viruses. The PCR products were electrophoresed in agarose gels and stained with ethidium bromide. (A) Primers specific for antigen A of MDV-3 (HVT). (B) Primers specific for antigen A of MDV-1. Lane 1: MDV-1B; lane 2: MDV-1 isolate 2; lane 3: MDV-1 N; lane 4: spleen from a diseased chicken (N); lane 5: liver from a diseased chicken (N); lane 6: non-pathogenic MDV-I (Rispens); lanes 7-9: 3 vials of MDV-3 (HVT) vaccine; lanes l&12: 3 vials of MDV-2 (SBl) vaccine; lane 13: mol. weight marker.

A PCR to differentiate between pathogenic and non-pathogenic MDV-1 viruses and the vaccine viruses of serotypes 2 and 3 using speclyic nucleotide primers from the nucleotide sequence of glycoprotein A genes of MDV-1 and MDV-3 (HVT) Use of nucleotide primers from the nucleotide sequence of MDV-1 antigen A gene with little or no homology to the nucleotide sequence of antigen A gene of between MDV-3 (HVT) (Manabe et al., 1988) enabled the differentiation pathogenic and non-pathogenic MDV-1 serotype and the vaccine viruses of MDV serotype 2 (SBl) and serotype 3 (HVT).

318

HVT-specific antigen A gene primers did not detect MDV-1 DNA (Fig. 5A, lanes l-5) or MDV-1 vaccine virus (Fig. 5A, lane 6) but did allow the amplification of a 436 bp DNA fragment from MDV-3 (HVT) DNA (Fig. 5A, lanes 7-9). No DNA was amplified from MDV-2 (SB-1) DNA (Fig. 5A, lanes 10-12). These results indicate that the MDV-2 antigen A gene has no homology with the nucleotide sequences selected as specific primers of MDV- 1 and MDV3 antigen A genes. The nucleotide primers are therefore specific for the detection of MDV-3-HVT DNA. When the MDV-1 specific primers were used (see Materials and Methods) the antigen A gene fragment of pathogenic MDV-1 strains (Fig. 5B, lanes l-5) was amplified and a DNA fragment of 314 bp was detected. A similar DNA fragment was amplified with non-pathogenic MDV-1 (Rispens vaccine) DNA (Fig. 5B, lane 6). These primers did not permit amplification of MDV-3 (HVT) DNA sequences (Fig. 5B, lanes 7-9) or of MDV serotype 2 (SBl) DNA (Fig. 5A, lanes 10-12). Detection of MDV-1 and MDV-3 (HVT) contain a mixture of both viral DNAs

DNAs

in DNA preparations

that

To determine the usefulness of the MDV-l- and MDV-3-specific nucleotide primers for the detection of MDV-1 and MDV-3, mixtures of MDV-1 and MDV-3 DNAs were prepared and the PCR was done simultaneously with the

(434 bp> HVT (3 14 bp) MDV

Fig. 6. PCR analysis of mixtures of pathogenic MDV-I and MDV-3 (HVT) DNAs (in vitro) using two sets of specific antigen A primers in the same reaction. DNA extracts from CEF infected with MDV-1 (B) or with MDV-3 (HVT) were mixed at different ratios and antigen A sequences were amplified using two pairs of primers (in MDV-3 [HVT] 436 bp sequence and MDV-1 [B] 314 bp sequence). The amplified DNAs were electrophoresed in agarose gel stained with ethidium bromide. Lanes 1 and 9: molecular weight marker; lanes 2: MDV-1 DNA; lane 3: MDV-l(B) + HVT DNAs 1:l; lane 4: MDV-1 DNA + HVT DNA 1:lO; lane 5: MDV-1 DNA + HVT DNA 1:lOO; lane 6: HVT DNA; lane 7: HVT DNA + MDV-1 DNA 1:lO; lane 8: HVT DNA + MDV-1 DNA 1:lOO.

319

Fig. 7. Detection of antigen A nucleotide sequence in MDV-I and MDV-3 DNAs using primers common to antigen A of the two viruses but not to MDV-2 (SB-I). Primers were selected according to nucleotide sequences in antigen A which are shared by MDV-1 and MDV-3 (HVT). The PCR using the common primers amplified a 686 bp sequence. The amplified DNAs were electrophoresed in an agarose gel and stained with ethidium bromide. Lanes 1-3: MDV-3 (HVT) vaccine vials; lanes 4-6: MDV-2(SB-I) vaccine vials; lane 7: MDV-1 (2); lane 8: MDV-1 (A); lane 9: MDV-I (B); lane 10: mol. weight marker; lane 11:no DNA in PCR reaction.

two pairs of MDV-1 and MDV-3 antigen A primers. The results in Fig. 6 show that MDV-1 primers amplified a 314 bp DNA fragment (Fig. 6, lane 2) and that the MDV-3 (HVT) primers amplified a DNA fragment of 436 bp (Fig. 6, lane 6). When the MDV-1 and MDV-3 DNA preparations were mixed both the 436 bp and 314 bp ampli~ed DNA bands were seen (Fig. 6, lanes 3-5 and lane 7). At a dilution of 1:lOO a faint band of HVT DNA was amplified in the presence of MDV-1 DNA (Fig. 6, lane 5) whereas at the same dilution MDV-1 DNA was not detected in the presence of HVT DNA (Fig. 6, lane 8). This result indicates that detection of MDV-1 DNA in DNA from organs of chickens immunized with MDV-3 (HVT) vaccine is possible. In addition to the specific primers for the detection of MDV-I and MDV-3 DNAs, additional primers were prepared according to nucleotide sequences in antigen A genes of MDV- 1 and MDV-3 that are identical. It can be seen in Fig. 7 that the common antigen A primers detected MDV-3 (HVT) DNA (Fig. 7, lanes l-3) and DNA from MDV-1 pathogenic isolates (Fig. 7, lanes 7-9) by amplifying a 686 bp DNA band. These primers did not amplify MDV-2 DNA (Fig. 7, lanes 4-6). The MDV-1 and MDV-3 antigen A gene common nucleotide primers can be used to distinguish MDV-1 and MDV-3 DNAs from MDV-2 DNA.

320

Discussion In de present study, a diagnostic PCR technique that allows detection of pathogenic MDV-1 in clinical specimens from infected commercial chickens is described. The use of primers from nucleotide sequences 5’ and 3’ to the 132 bp tandem direct repeat in MDV-1 DNA allowed the identification of pathogenic MDV-1 viruses containing two or three 132 bp repeats and the differentiation of the pathogenic MDV-1 from the non-pathogenic vaccine viruses that displayed tandem 132 bp repeats ranging from 4, 6 or more 132 bp repeats. The PCR which is based on nucleotide sequences flanking the 132 bp tandem repeat sequence reported by Bradely et al. (1989) makes it possible to distinguish between the pathogenic MDV-1 viruses in tissues of infected commercial chickens previously immunized with the vaccine virus CVI-988 Rispens. In the wild type MDV-1 isolates two or three 132 bp repeats were found, while in the CVI-988 Rispens vaccine virus multiple 132 bp repeats were detected. All the commercial flocks which developed symptoms of Marek’s disease were initially immunized with MDV-3-HVT vaccine or with MDV-I CVI-988 Rispens vaccine. The multiple radioactive bands which are noted in Fig. 3A (lanes l-3 and 5) are not identical in size with the multiple bands in CVI-988 Rispens vaccine DNA. The reason for the synthesis of these bands needs to be studied. It should be noted that PCR amplification of pathogenic MDV-1 DNA from the blood of infected chickens gave a marked band of two 132 bp repeat and a faint band of about nine 132 bp repeats (Fig. 3A, lane 4). Multiple 132 bp repeats resembling those amplified in the MDV-1 CVI-988 Rispens vaccine virus DNA were detected in the MDV-1 vaccine virus Mdl 11 75c developed by Witter (1992) after passaging the pathogenic virus in cell cultures (Becker et al., sent for publication). The PCR allows the detection of pathogenic MDV-1 viruses in DNA from clinical materials including organs or blood of diseased chickens and does not require in vitro isolation of the virus in chick or duck tibroblasts cultures. However, this PCR does require the amplification of viral DNA in the presence of a radioactively labeled nucleoside triphosphate. A non-radioactive PCR which differentiates between pathogenic and non-pathogenic MDV- 1 viruses based on the amplification of the tandem direct repeat was reported by Silva (1992). Three types of vaccine viruses were developed for the immunization of commercial chickens against infection with the wild type pathogenic MDV-1 viruses: (a) serotype 1 MDV consists of (1) CVI-988 Rispens vaccine virus which is a naturally occurring non-pathogenic MDV-1 and (2) Mdl l/7% and its derivative Mdl1/75c/R2 which was passaged 100 times in cell culture and was also back-passaged in chickens (Witter, 1992). (b) MDC serotype SBI (Schat and Calnek, 1978) and (c) MDV serotype-3-HVT, a herpesvirus of turkeys (Biggs et al., 1970). The above PCR does not recognize serotypes 2 and 3 of MDV which lack the 132 bp tandem repeats and the sequences flanking them in pathogenic or non-pathogenic MDV-1 DNA. Therefore, a non-

321

radioactive PCR to differentiate MDV-1, MDV-2 and MDV-3 (HVT) was developed. This PCR, which does not require a radioactive nucleoside triphosphate, is based on primers derived from antigen A gene that have no homology and are therefore specific for MDV-1 virus (pathogenic and nonpathogenic) or for HVT (MDV-3). A set of primers was prepared from antigen A nucleotide sequences identical in MDV-1 and MDV-3 antigen A gene. These nucleotides did not hybridize to MDV-2 (SBl) DNA in the PCR. As shown above, the presence of MDV-1 DNA can be differentiated from that of MDV-3 (HVT) vaccine virus. It was of interest that MDV serotype 2 (SBl) DNA did not react with the antigen A primers which differentiate between MDV-1 and MDV-3 DNAs. When nucleotide sequences of serotype 2 (SBl) DNA are available, a PCR test to identify this virus will be possible. These results indicate that if MDV-2 (SBl) virus has a gene functionally resembling antigen A gene of MDV-1 and MDV-3 its organization differs markedly. The present PCR technique provides an accurate and rapid method to diagnose specifically MDV- 1 infection in commercial chickens even if they were vaccinated with one or a combination of the three currently available vaccines.

Acknowledgements The study was supported by Grant I-1266-87 from the USA-Israel Agricultural Research and Development Fund (BARD) and by a grant from the Foundation for Molecular Virology and Cell Biology, Phoenix, Arizona. The authors are indebted to Prof. M. Nonoyama, Department of Virology and Molecular Genetics, Showa University Research Institute for Biomedicine in Florida, (10900 Roosevelt Blvd, North St. Petersburg, FL 33702, USA) for providing the cloned MDV-1 DNA library. The authors wish to thank Drs. R.L. Witter and R.F. Silva for providing us with the manuscript on the PCR. References Biggs, P.M., Payne, L.N., Mime, B.S., Churchill, A.E., Chubb, R.C., Powell, D.G. and Harris, A.H. (1970) Field trials with an attenuated cell associated vaccine for Marek’s Disease. Vet. Rec. 87, 704709. Bradley, G., Hayashi, M., Lanez, G., Tanaka, A. and Nonoyama, M. (1989) Structure of the Marek’s disease virus BumHI-H gene family: genes of putative importance for tumor induction. J. Virol. 63, 25342542. Davidson, I., Weisman, Y., Orgad, U., Jacobson, B., Perl, S., Strenger, C., Bedsor, Y. and Malkinson, M. (1988) Pathogenicity studies of Marek’s disease virus isolates in Israel. Is. J. Vet. Sci. 44, 2233232. Cui, Z., Lee, L.F., Liu, J-L. and Kung, H-J. (1991) Structural analysis and transcriptional mapping of the Marek’s disease virus gene encoding pp38, an antigen associated with transformed cells. J. Viral. 65, 6509-6515. Fukuchi, K., Tanaka, A., Schierman, L.W., Witter, R.L. and Nonoyama, M. (1985) The structure of Marek disease virus DNA: the presence of unique expansion in non-pathogenic viral DNA. Proc. Natl. Acad. Sci. USA 82, 751-754.

322 Hirai, K., Ikuta, K. and Kato, S. (1981) Structural changes of the DNA of Marek’s disease virus during serial passage in cultured cells. Virology 115, 3855389. Kanamori, A., Nakajima, K., Hanta, K., Keda, S., Kato, S. and Hirai, K. (1986) Copy number of tandem direct repeats within the inverted repeats of Marek’s disease virus DNA. Biken J. 29, 8389. Lee, L.F., Liu, X. and Witter, R.L. (1983) Monoclonal antibodies with specificity for three different serotypes of Marek’s disease viruses in chickens. J. Immunol. 130, 1003-1006. Manabe, S., Ishikawa, T., Tanaka, N., Fuke, I., Takashima, H., One, K., Takamizawa, A., Yoshida, I., Konobe, T., Takaku, K., Ikuta, K., Kato, S., Kunita, N. and Fukai, K. (1988) Cloning of the genes coding for gA of Marek’s disease virus and herpesvirus of turkeys. In: S. Kato, T. Horiuchi, T. Mikami and K. Hirai (Eds), Advances in Marek’s Disease Research, published by the Japanese Association of Marek’s Disease, pp. 107-l 13. Maotani, K., Kanamori, A., Ikuta, K., Ueda, S., Kato, S. and Hirai K. (1986) Amplification of a tandem direct repeat within inverted repeats of Marek’s disease virus DNA during serial in vitro passage. J. Virol. 58, 6577660. Okazaki, W., Purchase, W.G. and Burmester, B.R. (1970) Protection against Marek’s disease by vaccination with a herpesvirus of turkeys (HVT). Avian Dis. 14, 413429. Rispens, B., Van Vloten, H., Masterbroek, N. and Schat, K.A. (1972) Control of Marek’s disease in the Netherlands. II. Field trials on vaccination with an avirulent strain (CVI-988) of Marek’s disease. Avian Dis. 16, 1088125. Ross, L.Y.N. and Milne, B.S. (1988) Manipulation of the genomes of MDV and HVT. In: S. Kato, T. Horiuchi, T. Mikami and K. Hirai, (Eds), Advances in Marek’s disease Research, Published by the Japanese Association of Marek’s Disease, pp. 4349. Saiki, R.K., Gelfand, P.H., Stoffel, S., Schard, S.J., Higuchi, Horn G.T., Mullis, K.B. and Erlich, A.A. (1988) Primer-directed enzymatic amplification of DNA with a thermostable DNA polymerase. Science 239, 487491. Sambrook, J., Fritsch, E.F. and Maniatis, T. (1989) Molecular Cloning: A Laboratory Manual, Second Edition, Part 3. Cold Spring Harbor Laboratory Press. Schat, K.A. and Calnek, B.W. (1978) Characterization of an apparently non-oncogenic MDV, JNCI 60, 1975. Schat, K.A., Calnek, B.W., Fabricant, J. and Graham, D.L. (1985) Pathogenesis of infection with attenuated Marek’s disease virus strains. Avian Pathol. 14, 1277146. Silva, R.F. Differentiation of pathogenic and non-pathogenic serotype 1 Marek’s disease viruses (MDVs) by the polymerase chain reaction amplification of the tandem direct repeats within the MDV genome. Avian Diseases, in press. Silva, R.F. and Barrett, J.C. (1991) Restriction endonuclease analysis of Marek’s Disease virus DNA: differentiation of viral strains and determination of passage history. Avian Diseases 35, 4877495. Silva, R.F. and Witter, R.L. (1985) Genomic expansion of Marek’s disease virus DNA is associated with serial in vitro passage. J. Virol. 54, 690-696. Witter, R.L. (1987) New serotype 2 and attenuated serotype 1 Marek’s disease vaccine viruses: comparative efficacy. Avian Dis. 31, 752-765. Witter, R.L. (1992) Attenuated revertant serotype 1 Marek’s disease viruses: safety and protective efficacy. Avian Disease, in press.