Biochem. J. (2014) 460, 187–198 (Printed in Great Britain)

187

doi:10.1042/BJ20140268

*Bacterial Foodborne Pathogens and Mycology Research Unit, National Center for Agriculture Utilization Research, Peoria, IL 61604, U.S.A. †Renewable Product Technology Research Unit, National Center for Agriculture Utilization Research, Peoria, IL 61604, U.S.A.

Cmps (chitinase-modifying proteins) are fungal proteases that truncate plant class IV chitinases by cleaving near their Ntermini. We previously described Fv-cmp, a fungalysin protease that cleaves a conserved glycine–cysteine bond within the hevein domain. In the present paper we describe a new type of cmp, polyglycine hydrolases, as proteases that selectively cleave glycine–glycine peptide bonds within the polyglycine linker of plant class IV chitinases. Polyglycine hydrolases were purified from Cochliobolus carbonum (syn. Bipolaris zeicola; Bz-cmp) and Epicoccum sorghi (syn. Phoma sorghina; Es-cmp) and were shown to cleave three different maize class IV chitinase substrates. The proteolytic cleavage sites were assessed by SDS/PAGE and MALDI–TOF-MS and indicated the cleavage of multiple peptide bonds within the polyglycine linker regions. Site-directed mutagenesis was used to produce mutants of maize ChitB chitinase in which two serine residues in its linker were

systematically modified to glycine. Serine to glycine changes in the ChitB linker resulted in higher susceptibility to truncation by Bz-cmp and altered substrate specificity for Bz-cmp and Es-cmp, such that different glycine–glycine peptide bonds were cleaved. Removal of the hevein domain led to loss of Es-cmp activity, indicating that interactions outside of the active site are important for recognition. Our findings demonstrate that plant class IV chitinases with polyglycine linkers are targeted for truncation by selective polyglycine hydrolases that are secreted by plant pathogenic fungi. This novel proteolysis of polyglycine motifs is previously unreported, but the specificity is similar to that of bacterial lysostaphin proteases, which cleave pentaglycine crosslinks from peptidoglycan.

INTRODUCTION

truncated by secreted proteases from fungal pathogens called cmps (chitinase-modifying proteins). Cmps are proteases, secreted by fungi, which truncate plant class IV chitinases by cleaving their N-termini [8,9]. The most well characterized cmp is Fv-cmp, a fungalysin protease secreted by the maize endophyte and pathogen Fusarium verticillioides. Fv-cmp cleaves both ChitA and ChitB at a specific conserved glycine–cysteine bond in the chitin-binding domain [9]. This target site is conserved among plant class IV defence chitinases and Fv-cmp can cleave dicot chitinases, indicating that fungalysins may contribute to diverse plant diseases [10]. In the present paper we report the identification and characterization of two new cmp proteases, Bz-cmp and Escmp. Both are active on plant class IV chitinases, specifically cleaving the glycine–glycine bonds within the interdomain linker region. Bz-cmp is secreted by the maize pathogen Cochliobolus carbonum (syn. Bipolaris zeicola) [11], and is selectively active on the maize ChitA. It has poor proteolytic activity on ChitB, and was unable to truncate four chitinase substrates from Arabidopsis thaliana (L.) Heynh [10]. SDS/PAGE and MALDI–TOF-MSbased assays were used to demonstrate that Bz-cmp is a selective polyglycine hydrolase that initially cleaves ChitA substrates predominantly between Gly4 –Gly5 and Gly7 –Gly8 . Moreover, two consecutive serine residues within the ChitB linker region are sufficient to attenuate the activity of Bz-cmp. Hence the proteolysis of ChitB requires longer incubation times, with the cleavage occurring at Gly3 –Gly4 .

Maize (Zea mays L.) ChitA is a chitinase that is abundant in healthy seeds [1]. Chitinases (EC 3.2.1.14) are enzymes that degrade chitin, a linear polymer of the hexose sugar Nacetyl-D-glucosamine. As pathogenic fungal cell walls contain chitin, plant chitinases are significant in mediating plant–fungal interactions. Plant chitinases might function to directly inhibit fungal growth [1,2] or they might release chitin fragments from fungal cell walls, fragments that bind to chitin receptors in the plant cell wall [3]. Plants therefore produce several different types of chitinases. These chitinases have been grouped into seven classes [4]. ChitA is a plant class IV chitinase that is composed of a small N-terminal domain (∼4 kDa), that resembles the chitin-binding peptide hevein [5] and a larger chitinase domain (∼24 kDa) that belongs to glycoside hydrolase family 19 [6]. These domains are separated by a linker region that has speciesspecific composition. In ChitA, the linker contains either 11 or 14 consecutive glycine residues, depending on the alloform [7]. This type of extended polyglycine linker is somewhat unique among plant class IV chitinases, occurring only in chitinases from grasses (Poaceae). A ChitA homologue in rice (Oryza sativa L.) and wild rice [Oryza grandiglumis (Doll) Prodoehl] has an even longer linker with 19 consecutive glycine residues (GenBank® accession ACJ24349). Maize seeds also secrete abundant amounts of ChitB, an isoenzyme of ChitA [1]. The linker domain of ChitB is also glycine-rich, but it is shorter and contains two consecutive serine residues. Both ChitA and ChitB have been shown to be

Key words: cleavage-site specificity, exosite interaction, host–pathogen interaction, plant defence, protease, proteinase.

Abbreviations: cmp, chitinase-modifying protein; ConA, concanavalin A; SecPE, secreted protein extract. 1 To whom correspondence should be addressed (email [email protected]).  c The Authors Journal compilation  c 2014 Biochemical Society

Biochemical Journal

Todd A. NAUMANN*1 , Donald T. WICKLOW* and Neil P. J. PRICE†

www.biochemj.org

Polyglycine hydrolases secreted by Pleosporineae fungi that target the linker region of plant class IV chitinases

188

T. A. Naumann, D. T. Wicklow and N. P. J. Price

The second polyglycine hydrolase, Es-cmp, is produced by the sorghum pathogen Epicoccum sorghi (syn. Phoma sorghina). In contrast with Bz-cmp, this protease readily cleaves both ChitA and ChitB linkers, but at alternative cleavage sites to the Bzcmp activity. In addition, by systematic replacement of the two serine residues within the ChitB linker by glycine, we are able to produce modified ChitB-type chitinases which are altered in their proteolytic cleavage by Bz-cmp and Es-cmp. Hence the specificity towards certain glycine–glycine peptide bonds in the chitinase linker region by Bz-cmp and Es-cmp polyglycine hydrolases is determined, in part, by the selective placement of serine residues, and this may arise by natural variation within the ChitB-type chitinases. We also provide experimental evidence that recognition of ChitA by polyglycine hydrolases is only partially due to active-site interactions and that the hevein domain of ChitA is recognized through exosite interactions. We further tested the cmp activity of secreted fungal proteases from several important species of Cochliobolus known to cause serious diseases of cereals while also including additional pathogens of cereals and grasses representing other families in the Pleosporineae. EXPERIMENTAL Partial purification of Bz-cmp

Bz-cmp was partially purified from solid-substrate cultures of C. carbonum NRRL 47238. A total of 20 Erlenmeyer flasks (500 ml) were filled with 50 g of maize seed and 50 ml of water and soaked overnight. Flasks were then autoclaved [15 psi. (1 psi = 6.9 kPa); 30 min] and cooled to room temperature (25 ◦ C). A suspension of conidia and hyphal cells from a potato dextrose agar slant culture was used to inoculate the flasks. Cultures were grown for 14 days at 25 ◦ C. Secreted proteins were extracted from cultures without lysis of fungal hyphae. To each flask, 100 ml of extraction buffer [10 mM sodium acetate (pH 5.2), 0.2 mM PMSF, 1 mM EDTA and 2 mM ascorbic acid] was added. Cultures were mixed with buffer and incubated for 30 min at 4 ◦ C. The solution of secreted proteins was separated from solid material by squeezing through miracloth (Millipore). Remaining insoluble material was removed by centrifugation (22 500 g for 10 min at 4 ◦ C) followed by filtration through Whatman 1 paper followed by a disposable Stericup filter with a 0.45-μM HV Durapore membrane (Millipore). Proteins were ethanol precipitated from the filtered extract. Ethanol was added to 30 % (v/v) and incubated for 30 min at 25 ◦ C. Insoluble material was removed from the solution by centrifugation (22 500 g at 4 ◦ C for 10 min) and discarded. Bz-cmp was then precipitated by the addition of ice-cold ( − 20 ◦ C) ethanol until 50 % (v/v) dilution. The solution was then incubated for 30 minutes at − 20 ◦ C and Bz-cmp was pelleted by centrifugation (22 500 g at 4 ◦ C for 10 min). Proteins were resuspended in 100 ml of ion-exchange binding buffer [50 mM sodium acetate (pH 4.7) and 100 mM NaCl]. This material was fractionated by mixed-mode cation-exchange chromatography (HiScreen Capto MMC; GE Healthcare). Ten identical chromatography runs were used to process the material. In each, 10 ml of protein solution was loaded on to the column. The column was washed with 10 ml of binding buffer, and the bound proteins were eluted with a 25 ml linear gradient towards 100 % ion-exchange elution buffer [100 mM Mes (pH 6.0) and 1 M NaCl]. Between each run, the column was cleaned with 10 ml of 1 M NaOH and re-equilibrated with binding buffer. Elution fractions were tested for activity by cmp assay. On the basis of these results, a total of 30 ml of eluted proteins were combined for lectin-affinity chromatography.  c The Authors Journal compilation  c 2014 Biochemical Society

Bz-cmp was concentrated and further purified by binding to a lectin affinity column [HiTrap ConA (concanavalin A) 4B; 1 ml; GE Healthcare]. Eluted proteins from ion exchange were loaded on to the column and the column was washed with lectin-affinity buffer [20 mM Tris/HCl (pH 7.5), 500 mM NaCl, 1 mM CaCl2 and 1 mM MnCl2 ] to remove the unbound proteins. Bz-cmp was eluted by the addition of lectin-affinity buffer containing 100 mM mannose; 2 ml of eluted protein was collected. Eluted proteins were precipitated by addition of ice-cold acetone (1.5 volumes), followed by a 30 min incubation at − 20 ◦ C and centrifugation (22 500 g at 4 ◦ C for 10 min). Precipitated proteins were air-dried and resuspended in 2 ml of 20 mM Bis-Tris (pH 6.8). A 200 μl aliquot of a 25 % slurry of source Q resin (GE Healthcare) was added; after 5 min the sample was centrifuged (10 000 g at 4 ◦ C for 1 min) to pellet the resin and the unbound proteins were removed. Resin was washed twice with 10 ml of buffer. Bz-cmp was eluted from the resin by the addition of 2 ml of sodium acetate buffer (pH 5.2). Source Q resin was pelleted by centrifugation (10 000 g at 4 ◦ C for 1 min) and the eluted proteins were removed and combined with 200 μl of a 25 % slurry of source S resin (GE Healthcare); after 5 min the sample was centrifuged (10 000 g at 4 ◦ C for 1 min) to pellet the resin and the unbound proteins were removed. Resin was washed twice with 10 ml of buffer. Bz-cmp was eluted from the resin by the addition of 200 μl of sodium acetate buffer (pH 5.2) containing 500 mM NaCl. Source S resin was pelleted by centrifugation (10 000 g at 4 ◦ C for 1 min) and the eluted protein was retained for in vitro study.

Purification of Es-cmp

Es-cmp was purified from solid-substrate cultures of E. sorghi NRRL 54204. Inoculation and growth of cultures was as described for the isolation of Bz-cmp. Secreted proteins were extracted from each of the ten cultures by adding ion-exchange binding buffer (100 ml per culture). Cultures were mixed with buffer and incubated for 30 min at 4 ◦ C. Secreted proteins were separated from solid material as described above for Bz-cmp. The SecPE (secreted protein extract) was loaded on to a Capto MMC XK 26/20 column, washed with two column volumes of ion-exchange binding buffer and eluted with a 250 ml linear gradient, ending with 100 % ion-exchange elution buffer. These assays showed that Es-cmp eluted in three 10 ml fractions. These fractions were combined and used for lectin-affinity chromatography. Proteins were bound to a HiTrap ConA (1 ml) column, and the column was washed with lectin-affinity buffer (4 ◦ C). The column was then filled with lectin-affinity buffer containing 0.5 M 500 mM methyl α-D-mannopyranoside. The column was removed from the chromatography system and incubated for 2 h at 25 ◦ C. After incubation, proteins were eluted by applying 1.5 ml of elution buffer (25 ◦ C) with a syringe. Es-cmp was then precipitated by the addition of an equal volume of ice-cold acetone, incubation at − 20 ◦ C for 30 min and centrifugation (22 500 g at 4 ◦ C for 10 min). Precipitated proteins were resuspended in 100 μl of gel-filtration buffer [20 mM Tris/HCl (pH 7.5) and 500 mM NaCl] and injected into a gel-filtration column (Superdex 200 10/300 GL; GE Healthcare). Fractions of 1 ml were collected and tested for cmp activity. The two fractions with the most activity were combined, and Es-cmp was precipitated by the addition of an equal volume of ice-cold acetone, incubation at − 20 ◦ C for 30 min and centrifugation (22 500 g at 4 ◦ C for 10 min). The precipitated protein was resuspended in 150 μl of gel-filtration buffer. Measurement of protein concentration by the Bradford assay indicated a final protease concentration of 0.4 mg

Polyglycine hydrolases Table 1

189

Oligonucleotide sequences used in the present study for ChitB mutagenesis cloning

EcoRI and NheI sequences are indicated in bold. Name

Sequence (5 →3 )

Description

ChitB_Fwd S71G_Rev S72G_Rev S71G/S72G_Rev

GGATGAATTCCAGAACTGCGGCTGCCAGCCAAAC GACGACGCTAGCCACGTTCGCACCACCGCCGCCACTGCCGCCGCCGCCGC GACGACGCTAGCCACGTTCGCACCACCGCCGCCACCGCTGCCGCCGCCGC GACGACGCTAGCCACGTTCGCACCACCGCCGCCACCGCCGCCGCCGCCGC

Forward oligonucleotide with EcoRI site in tail Mutagenic reverse oligonucleotide with NheI site in tail Mutagenic reverse oligonucleotide with NheI site in tail Mutagenic reverse oligonucleotide with NheI site in tail

protein/ml. The reactions shown in Figure 2 therefore contain 20 ng (1:20 dilution; middle panel) and 2 ng (1:200 dilution; bottom panel) protease respectively. Site-directed mutagenesis of the ChitB-expressing plasmid

Three plasmids, each encoding expression of ChitB with a different linker mutation [ChitB(SS/GS), ChitB(SS/SG) and ChitB(SS/GG)], were constructed by site-directed mutagenesis of the ChitB expression plasmid pTAN143 [9]. Mutagenesis was simplified because a NheI restriction site exists near the linkerencoding region of the plasmid. Changes were incorporated into synthesized oligonucleotides (Table 1). Oligonucleotides were used to PCR amplify a fragment of the ChitB-encoding gene. The PCR products and pTAN143 were digested with the restriction endonucleases EcoRI and NheI. The digested PCR products were ligated into the pTAN143 vector fragment and transformed into Escherichia coli DH5α cells. Plasmids were purified from isolated colonies and the correct plasmids were identified by DNA sequencing. Each plasmid was linearized and electroporated into competent Pichia pastoris X-33. Isolates expressing each of the three ChitB mutants were isolated by plating transformed cells on selection plates [1 % yeast extract, 2 % peptone, 2 % glucose, 1 M sorbitol, 2 % agar and 100 μg of ZeocinTM (Invitrogen)].

chitinase (20 μg) in 10 μl of 10 mM sodium acetate buffer (pH 5.2) for 16 h at 30 ◦ C. Es-cmp (20 ng) was then added; this is the same amount used in reactions with purified protein shown in Figure 2 (1:20 dilution; middle panel, right-hand lane). After 1 or 24 h of incubation, reaction products were analysed by MALDI– TOF-MS. MALDI–TOF-MS

MALDI–TOF mass spectra were recorded on a Bruker Daltonic Microflex LRF instrument operating in the reflectron mode. The system utilizes a pulsed nitrogen laser, emitting at 337 nm. Typically, 1000–2000 shots were acquired at 60 Hz frequency and 78 % laser power, with the laser attenuator offset at 16 % for the 30 % range. The matrix was saturated with 2,5-DHB (2,5dihydrobenzoic acid) in acetonitrile, and was pre-mixed with the peptide samples (0.5 mg/ml) before spotting on to a standard 96position stainless steel target. Ion source 1 was set to 19.0 kV and source 2 to 15.9 kV (83.7 % of ion source 1), with lens and reflector voltages of 9.79 and 19.99 kV respectively. During the acquisition matrix, ion suppression was used up to 1000 Da. External calibration used Bruker Peptide Calibration Standard II mono with insulin. The MS data were processed off-line using the Flex Analysis 3.0 software package (Bruker Daltonics). The peptide accurate masses were calculated using IsoPro 3.1.

Expression and purification of recombinant plant chitinases

Recombinant maize chitinases [ChitA-B73, ChitA-LH82, ChitB, ChitB(SS/GS), ChitB-(SS/SG) and ChitB-(SS/GG)] were expressed in heterologous P. pastoris and purified as previously described for recombinant ChitA [8]. Recombinant A. thaliana chitinase AtchitIV3 was purified by chitin affinity as described in [10].

Fungal cultures and preparation of SecPEs

Cmp assays

RESULTS

Assay mixtures consisted of 20 μg of recombinant chitinase (70 μM) in 10 μl of 10 mM sodium acetate buffer (pH 5.2). To test protease activity during purification, samples were diluted from 20-fold to 250-fold in sodium acetate buffer; 1 μl was added per reaction. For testing the SecPEs, 1 μl of 1 mg of protein/ml was added to each reaction. All reactions were incubated at 30 ◦ C for 1 h. Reactions were terminated by adding SDS/PAGE loading dye and boiling for 1 min. Proteins were separated at 200 V for 1 h in 12 % polyacrylamide gels using a Criterion Cell (Bio-Rad Laboratories). Proteins were stained with Oriole fluorescent stain and visualized with a GelDoc EZ imager (Bio-Rad Laboratories).

Partial purification of Bz-cmp

Fv-cmp pre-incubation assay

Fv-cmp was purified as described previously [9]. Truncated ChitA was produced by incubating Fv-cmp (20 ng) with recombinant

Fungal isolates (Box 1) were grown as solid-substrate cultures for 14 days at 25 ◦ C. Inoculation of cultures and extraction of secreted proteins were performed as previously described for Fusarium isolates [9].

Secreted proteins were extracted from solid substrate cultures of C. carbonum and were concentrated by ethanol precipitation. An initial chromatography step, mixed-mode cation exchange, allowed for the initial capture and elution of Bz-cmp. Eluted proteins were then subjected to ConA lectin-affinity chromatography (Figure 1A). This step takes advantage of the fact that Bz-cmp is a glycoprotein to capture and concentrate the protease. Bz-cmp was bound to the column and eluted by the addition of buffer with competing carbohydrate. The eluted proteins had high Bz-cmp activity and were visualized as a mixture of three major and seven faint bands on SDS/PAGE (Figure 1A, lane E). Bz-cmp was further purified by in-solution binding to and elution from anion-exchange and cation-exchange resins (Figure 1B). In the anion-exchange step, the activity was equally  c The Authors Journal compilation  c 2014 Biochemical Society

190

T. A. Naumann, D. T. Wicklow and N. P. J. Price

Box 1 Isolates of Pleosporineae included in the present study ATCC, American Type Culture Collection, Fairfax, VA, U.S.A.; CBS, Centraalbureau voor Schimmelcultures, Utrecht, The Netherlands; NRRL, ARS Culture Collection, Peoria, IL, U.S.A. Pleosporaceae Alternaria alternata (Fr.) Keissl. (anamorphic Lewia ) NRRL 6410 Zea mays ; NC, U.S.A. GQ221851 Bipolaris sacchari (E.J. Butler) Shoemaker (anamorphic Cochliobolus ) NRRL 5241 Saccharum officinarum ; U.S.A. ( = CBS 325.64) Cochliobolus carbonum R.R. Nelson (syn. Bipolaris zeicola ) NRRL 5229 Zea mays; U.S.A. ( = CBS 317.64) KF573411 NRRL 5230 Zea mays; U.S.A. ( = CBS 316.64) NRRL 47238 Zea mays ; IL, U.S.A. FJ213843 Cochliobolus heterostrophus (Drechsler) Drechsler (syn. Bipolaris maydis ) NRRL 5294 Zea mays ; IL, U.S.A. ( = A-18150) KF573412 Cochliobolus lunatus R.R. Nelson & F.A. Haasis (syn. Curvularia lunata ) NRRL 6409 Zea mays ; NC, U.S.A. GQ221854 Cochliobolus miyabeanus (S. Ito & Kurib.) Drechsler ex Dastur (syn. Bipolaris oryzae ) NRRL 5232 Oryza sativa ; U.S.A. ( = CBS 309.64) Cochliobolus sativus (S. Ito & Kurib.) Drechsler ex Dastur (syn. Bipolaris sorokiniana ) NRRL 5238 Hordeum vulgare ; U.S.A. ( = CBS 312.64) NRRL 62613 Secale cerealis ; IL, U.S.A. KF512821 Cochliobolus spicifer R.R. Nelson (syn. Bipolaris spicifer ) NRRL 47508 Sorghum vulgare ; AZ, U.S.A. GU183125 Pyrenophora seminiperda (Brittleb. & D.B. Adam) Shoemaker (syn. Drechslera campanulata ) NRRL 54032 Bromus tectorum ; Goreme, Turkey KF573413 Phaeosphaeriaceae Parastagonospora nodorum (Berk.) Quaedvlieg, Verkley & Crous (syn. Phaeosphaeria nodorum ) NRRL 62560 Gramineae; IL, U.S.A. KF512822 Setophoma terrestris (H.N. Hansen) Gruyter, Aveskamp & Verkley NRRL 54670 Gramineae; IL, U.S.A. KF512828 Didymellaceae Ascochyta hordei var. hordei Hara NRRL 54518 Bouteloua gracilis ; TX, U.S.A. HQ882800 Epicoccum nigrum Link NRRL 54809 Sorghum bicolor ; KS, U.S.A. KF512824 Epicoccum sorghi (Sacc.) Aveskamp, Gruyter & Verkley (syn. Phoma sorghina ) NRRL 54204 Sorghum bicolor ; U.S.A., Moyer & Son, Inc. HM047194 NRRL 54205 Sorghum bicolor ; U.S.A., Moyer & Son, Inc. HM047195 NRRL 54808 Sorghum bicolor ; KS, U.S.A. KF512823 Peyronellaea glomerata (Corda) Goid. ex Togliani NRRL 54807 Sorghum bicolor ; KS, U.S.A. KF512825 Peyronellaea pinodella (L.K. Jones) Aveskamp, Gruyter & Verkley NRRL62789 Zea mays ; IL, U.S.A. KF562067 Peyronellaea zeae-maydis (Mukunya & Boothr.) Aveskamp, Gruyter & Verkley NRRL62786 Zea mays ; IL, U.S.A. KF512826

distributed between flow-through and eluted samples, whereas the majority of proteins in the sample were in the flow-through (Figure 1B, anion). In the cation-exchange step, activity was concentrated in the elution. The solution contained four faint bands and was retained for biochemical analysis of Bz-cmp activity (Figure 1B, cation E).

Purification of Es-cmp

Es-cmp was purified from solid-substrate cultures of E. sorghi by a four-step process. The protein content and amount of protease activity, at two different dilutions, is shown for each step of purification (Figure 2). Initially, secreted proteins were extracted (Figure 2, SPE) and then loaded on to a mixed-mode cationexchange column. Bound proteins were eluted by applying a linear gradient that increased the pH and salt concentration. Activity assays of elution fractions showed that Es-cmp eluted in three consecutive 10-ml fractions. These fractions were then combined (Figure 2, MMC). Es-cmp was further concentrated and purified by binding to a lectin-affinity column containing covalently bound ConA. The column was washed and the  c The Authors Journal compilation  c 2014 Biochemical Society

bound proteins were eluted by the addition of buffer with competing carbohydrate (Figure 2, conA). Eluted proteins were concentrated by acetone precipitation and purified by gel-filtration chromatography. The elution fraction from gel filtration with the most activity was re-concentrated by acetone precipitation (Figure 2, gelF). SDS/PAGE analysis of this solution showed that it contained a single protein with an apparent molecular mass of 83 kDa (Figure 2, Es-cmp arrow). The total protease concentration of the purified Es-cmp protein was measured as 0.4 mg of protein per ml of solution. Heat denaturation of these samples followed by enzymatic removal of asparagine-linked glycosylation converted this 83 kDa band into an apoprotein with apparent mass of 68 kDa (not shown). Cleavage site specificity of polyglycine hydrolases

The cleavage site specificity of Bz-cmp and Es-cmp was determined by MALDI–TOF-MS analysis of the peptide products. Bz-cmp was incubated with either ChitA-B73, ChitA-LH82 or ChitB and the product peptides were detected by MS analysis (Figure 3A). When ChitA-B73 was the substrate, a series of nine ions were detected, indicating that the protease can cleave nine different peptide bonds within the polyglycine linker sequence (Figure 3A, top panel). The major ion indicates preferred cleavage after Gly4 . When Bz-cmp was incubated with ChitA-LH82, which has a polyglycine linker with three fewer glycine residues, three fewer ion peaks were detected (Figure 3A, middle panel). The major ion indicated preferred cleavage after Gly7 . When Bzcmp was incubated with ChitB, which has a shorter polyglycine linker sequence that is interrupted by a pair of consecutive serine residues, the protease predominantly cleaved the peptide bond after the Gly3 , with minor products arising from cleavage after Gly4 (Figure 3A, bottom panel). This change in the specificity of cleavage site was accompanied by slower kinetics; the incubation time was increased from 1 to 18 h to allow accumulation of product peptides. This analysis demonstrates that Bz-cmp targets the polyglycine linker of ChitA and ChitB while revealing that it does not cleave a specific bond, but cleaves one of a series of glycine–glycine peptide bonds. To determine whether Es-cmp is a homologue of Bz-cmp that targets the polyglycine linker, and, if so, to compare their cleavage site preference, the same series of experiments was performed with Es-cmp from E. sorghi. When incubated with ChitA-B73 (Figure 3B, top panel) four major ion peaks were observed, indicating preferred cleavage after Gly3 , Gly6 , Gly7 and Gly8 with only minor ions to indicate cleavage after Gly4 or Gly5 . When incubated with ChitA-LH82 three major ions were observed, indicating cleavage after Gly3 , Gly4 , Gly5 with cleavage after the Gly6 producing a comparatively smaller ion signal. When incubated with ChitB, Es-cmp cleaved the same two bonds as Bzcmp after Gly3 and Gly4 , but preferentially cleaved ChitB after Gly1 , a cleavage event that was not prominent in the Bz-cmp reaction products. The results demonstrated that Es-cmp is also a polyglycine hydrolase and that it is a protein homologue of Bzcmp. The six obtained datasets are summarized in Figure 4(C). Activity and specificity of polyglycine hydrolases with ChitB linker mutants

One of the differences in the polyglycine linkers of ChitA alloforms, which are susceptible to truncation by Bz-cmp, and ChitB, which is resistant, is that the ChitB polyglycine linker sequence is interrupted by two consecutive serine residues. In order to determine if these serine residues are responsible for the

Polyglycine hydrolases

Figure 1

191

Partial purification of polyglycine hydrolase Bz-cmp from the maize fungal pathogen Bipolaris zeicola

(A) Partially purified (PP) proteins were loaded on to a ConA lectin-affinity column and the flow-through (FT) and eluted (E) proteins were collected. Upper panel: SDS/PAGE analysis of partially purified, flow-through and eluted protein. Lower panel: proteolytic activity of each fraction on ChitA protein resulting in the truncated ChitA cleavage product. (B) Anion- and cation-exchange chromatographies of the lectin affinity eluent. Upper panel: SDS/PAGE analysis. Lower panel: proteolytic activities on ChitA.

resistance of ChitB to Bz-cmp-catalysed truncation, three ChitB mutants with serine to glycine mutations in their linker sequences were used in cmp assays. Two of the mutants, ChitB(SS/GS) and ChitB(SS/SG), have either the first or second serine residue replaced by glycine. The third is a double mutant with both serine residues replaced by glycine, ChitB(SS/GG). This linker has ten consecutive glycine residues and more closely resembles that of ChitA. ChitB, the three ChitB linker mutants and ChitA-LH82 were used as substrates in cmp reactions with Bz-cmp or Es-cmp followed by SDS/PAGE analysis (Figure 4A). In control reactions without added protease, substrate chitinases were visualized as bands of approximately 28 kDa (Figure 4A, right-hand panel). Incubation of Bz-cmp with either ChitA-LH82 or ChitB(SS/GG) resulted in conversion of substrate chitinases into truncated products with observed molecular mass of approximately 22 kDa (Figure 4A, left-hand panel). Incubation of Bz-cmp with either ChitB(SS/GS) or ChitB(SS/SG) resulted in formation of fewer products, as indicated by decreased intensity of the product bands and increased intensity of the substrate bands. Incubation of Bzcmp with ChitB did not lead to the formation of truncated chitinase as indicated by lack of product band. These reactions suggest that the serine residues in the linker are responsible for the resistance of ChitB to degradation by Bz-cmp. In the Es-cmp reactions, product bands were readily formed for all five substrates (Figure 4A, middle panel). The cleavage site preference of the Bz-cmp and Es-cmp enzymes towards the wild-type and mutant ChitB substrates [ChitB, ChitB(SS/GS), ChitB(SS/SG) and ChitB(SS/GG)] was also assessed by MALDI–TOF-MS (Fig. 4B), using the same conditions as described for the cleavage of wild-type ChitA and

ChitB (Figures 3A and 3B). Molecular ions ([M + Na] + ) were observed in the 3800–4600 Da mass range due to the peptides released by Bz-cmp or Es-cmp protease activities. The low activity of Bz-cmp on ChitB, as seen following SDS/PAGE (Figure 4A), was confirmed by the low intensity of the MALDI–TOF-MS ions for the peptides arising from ChitB. The most significant cleavage occurred after Gly3 giving rise to the ion at m/z 4112, with more minor cleavage after Gly1 and Gly4 (Figure 4B, a). For the modified ChitB(SS/GS) the polyglycine hydrolase cleavage specificity is altered so that hydrolysis no longer occurs after Gly3 , but is now more prevalent after Gly1 and Gly4 (m/z 4000 and 4169 respectively; Figure 4B, b). Similarly, the modified ChitB(SS/SG) chitinase, with the second serine mutated to glycine, was also hydrolysed differently by Bz-cmp. The predominant cleavage occurred after Gly3 (m/z 4112), similar to the wild-type ChitB, but with a second ion at m/z 4313, indicating cleavage occurring after Gly6 , on the C-terminal side of the serine residue (Figure 4B, c). When both internal serine residues were mutated to glycine [ChitB(SS/GG)] the major Bz-cmp cleavage occurs at Gly4 (Figure 4B, d), with a more minor cleavage at Gly3 , similar to the activity seen on the ChitA-LH82. The Es-cmp polyglycine hydrolase was generally more active with ChitB than the Bz-cmp enzyme. Hence more activity was observed for Es-cmp on the wild-type ChitB substrate by SDS/PAGE (Figure 4A), and more intense MS ions were also observed for the released peptides (Figure 4B, e). The specificity of Es-cmp also differs from that of Bz-cmp, so that the predominant cleavage is now at Gly1 as well as Gly3 , with a more minor cleavage again observed at Gly4 . On the modified chitinase ChitB(SS/GS) the cleavage is no longer seen at Gly3 , but the preferred cleavage site is now after Gly4 (m/z  c The Authors Journal compilation  c 2014 Biochemical Society

192

T. A. Naumann, D. T. Wicklow and N. P. J. Price

have both quantitative and qualitative hydrolytic activities on the polyglycine region of the plant class IV chitinases from maize that is at least partly determined by the placement of serine residues within the polyglycine backbone. The difference may also underlie the substrate specificities of the fungal polyglycine hydrolases observed within the natural variation of the native ChitA and ChitB substrates. Activity of Es-cmp on fungalysin-cleaved ChitA

Figure 2 Purification of polyglycine hydrolase Es-cmp from the sorghum fungal pathogen E. sorghi The protein content of the initial SecPEs (SPE) and proteins present after mixed-mode cation-exchange chromatography (MMC), ConA affinity chromatography (conA) and gel filtration (gelF) were compared by SDS/PAGE (top panel). A single band was associated with Es-cmp activity (arrow). Each protein solution was diluted either 1:20 (middle panel) or 1:200 (bottom panel) and added to the cmp reactions. SDS/PAGE analysis of the reaction products allowed direct comparison of polyglycine hydrolase activity at each stage of purification. Bradford assays measured a final concentration of 0.4 mg of protein/ml in the final sample (gelF).

4170; Figure 4B, f). This Gly3 -to-Gly4 specificity shift is seen for both Es-cmp and Bz-cmp activities on ChitB(SS/GS). The substrate specificity of Es-cmp on ChitB(SS/SG) and the doublesubstituted ChitB(SS/GG) was more complex (Figure 4B, g and h). ChitB(SS/SG) was cleaved after Gly1 , Gly3 and Gly6 as was seen with Bz-cmp. An additional ion was also apparent at m/z 4200. This ion was not observed for the Bz-cmp-treated ChitB(SS/SG) but is a dominant ion following the cleavage by Es-cmp. In addition, the Es-cmp cleaves the ChitB(SS/SG) after Gly1 , whereas this was not seen for the Bz-cmp enzyme. Hence the Bz-cmp and Es-cmp polyglycine hydrolase activities  c The Authors Journal compilation  c 2014 Biochemical Society

The above experiments demonstrate that polyglycine hydrolases cleave peptide bonds in the polyglycine linker region of ChitA and ChitB. They further show that serine residues imbedded within the linker can inhibit peptide bond cleavage and change peptide bond selection, but these experiments do not indicate how polyglycine hydrolases recognize their substrates. In order to determine if the N-terminal 29 amino acids are involved in substrate recognition, we pre-incubated ChitA-LH82 with Fv-cmp, a protease from F. verticillioides that cleaves a conserved glycine–cysteine bond in the ChitA hevein domain (Figure 5A), before the addition of Escmp. During both steps the protease activity was monitored by peptide production as assessed by MALDI–TOF-MS (Figure 5B). The 29 residue peptide derived from cleavage of the ChitA by fungalysin Fv-cmp at the Gly29 –Cys30 site is evident from the [M + H] + molecular ion at m/z 3157 (Figure 5B, b). These data also show that the six cysteine residues in the peptide region are all involved in intrapeptide disulfide bonds. The new N-terminally truncated ChitA produced by the removal of this 29 residue peptide was treated further with the Es-cmp glycine hydrolase, either for 1 or 24 h (Figure 5B, c and d respectively). If the Escmp is active on this truncated ChitA at the same sites within the polyglycine region the expectation would be for the formation of three peptides, each containing the original Cys30 at the N-termini, and a C-terminal glycine residue (Figure 5A). However, although the Fv-cmp cleavage m/z 3157 ion is still in evidence from the m/z 3157 ion in Figure 5(B) (c and d), in the lower mass range (m/z 900–1300), there is no evidence for the formation of the three smaller Es-cmpderived peptides, CQSGPCRSGGGGG, CQSGPCRSGGGG and CQSGPCRSGGG (expected [M + Na] + , m/z 1006.38, m/z 1063.40 and m/z 1120.42). This is evident even after an extended treatment of the truncated ChitA with the Es-cmp for 24 h (Figure 5B, d). This indicates that the Es-cmp does not recognize the truncated ChitA as a substrate, and supports the hypothesis that the 29 residue N-terminal region of the ChitA is necessary for effective binding of Es-cmp, perhaps by optimally positioning the Es-cmp protease for cleavage within the polyglycine region. Polyglycine hydrolases from related Pleosporineae pathogens

SecPEs from Pleosporineae fungi (Box 1) were tested for polyglycine hydrolase activity. To detect this activity, each SecPE was incubated with four different recombinant plant chitinase substrates followed by SDS/PAGE analysis of reaction products (Figure 6). Control reactions were conducted by incubating each of the four chitinase substrates alone or with addition of partially purified Bz-cmp (Figure 6A). In these assays, Bz-cmp readily truncated both ChitA alloforms, while having little activity on ChitB or AtchitIV3, a plant class IV chitinase that does not have a glycine-rich linker (Figure 6B). In comparison, SecPEs from C. carbonum isolates had a similar protease activity. The preference towards ChitA is somewhat reduced, but still evident, indicating that Bz-cmp is the predominant cmp in the mixture of secreted proteins (Figure 5C). SecPEs from the maize pathogen

Polyglycine hydrolases

Figure 3

193

MALDI–TOF-MS analysis of N-terminal peptide products

Three maize class IV chitinases (ChitA-B73, ChitA-LH82 and ChitB) were incubated with Bz-cmp or Es-cmp. The cleaved N-terminal peptides ([M + H] + ions) were detected by MALDI–TOF-MS. Peptide masses indicated the position of cleavage within the polyglycine linker region of the chitinases. (A) Bz-cmp reactions. (B) Es-cmp reactions. (C) Deduced cleavage sites within the polyglycine linker regions. The cleavage sites for Bz-cmp and Es-cmp are shown in black and grey respectively.  c The Authors Journal compilation  c 2014 Biochemical Society

194

Figure 4

T. A. Naumann, D. T. Wicklow and N. P. J. Price

Proteolytic cleavage of ChitA, ChitB and serine to glycine-modified ChitB mutants

Heterologous strains were created to express three ChitB mutants, with either one or both linker serine residues mutated to glycine [ChitB(SS/GS), ChitB(SS/SG) and ChitB(SS/GG)]. The modified ChitBs were purified and used in cmp assays. (A) SDS/PAGE analysis. ChitB, ChitA-LH82 and the modified ChitBs with Bz-cmp (left-hand lanes) or Es-cmp (middle lanes). Chitinases incubated without addition of fungal protease were included as a control (right-hand lanes). (B) MALDI–TOF-MS analysis of the N-terminal peptides released by either the Bz-cmp (a–d) or Es-cmp (e–h) activities. The deduced cleavage sites in the polyglycine linker regions are shown as insets, with the position of the serine to glycine exchanges shown in grey. Unassigned peaks are indicated by asterisks.

Cochliobolus heterostrophus [12, 13] and Cochliobolus sativus, a pathogen with a broader host range that infects plants throughout the Poaceae [14] exhibited similar activity patterns. Preferred cleavage of ChitA alloforms was also observed for SecPEs from the wheat pathogen Parastagonospora nodorum [15], the general grass (Poeaceae) pathogen Ascochyta hordei [16], and the broad host range pathogens Epicoccum nigrum [17] and Peyronellaea glomerata [18]. As observed in cmp reactions with Es-cmp, SecPEs from three isolates of E. sorghi truncated both alloforms of ChitA and ChitB, while not truncating AtchitIV3 (Figure 5C, bottom panels). These were the only SecPEs that generated this product pattern.  c The Authors Journal compilation  c 2014 Biochemical Society

This suggests that most polyglycine hydrolases are blocked from truncating ChitB due to the inserted serine residues. Other tested SecPEs either contained cmps that truncated AtchitIV3, indicating the presence of another type of cmp, or did not have cmp activity.

DISCUSSION

In the present paper we describe a unique protease activity, fungal polyglycine hydrolases. These proteases were found to be secreted by members of the fungal subclass Pleosporineae, a division of Pleosporales that consists of plant pathogenic species.

Polyglycine hydrolases

Figure 5

195

The N-terminus of maize ChitA is required for substrate recognition by the Es-cmp glycine hydrolase

(A) Schematic diagram of the N-terminal cleavage of ChitA by Fv-cmp at Gly29 –Cys30 to generate a 22 kDa truncated chitinase domain. The data show that predicted cleavages in the polyglycine region by subsequent treatment of the truncated ChitA with Es-cmp do not occur. (B) MALDI–TOF-MS analysis of the peptides generated by the fungal proteolytic treatment. a, protease-free control; b, Fv-cmp treatment of ChitA, cleaving 29 residues from the N-terminus (calculated [M + H] + = 3156.11); c and d, subsequent treatment of the truncated ChitA with the Es-cmp glycine hydrolase after 60 min and 24 h respectively. Note that no smaller peptides are observed in the low mass region; e, treatment of full-length ChitA by Es-cmp generating three peptides (m /z 4143.72, 4200.70 and 4257.94) from specific cleavages in the polyglycine region. Note that the mass differences of 57 Da correspond to a single glycine residue. A smaller ion at m /z 4314.05 corresponds to the peptide formed by low-level cleavage after the sixth glycine residue (calculated [M + H] + = m /z 4314.54). Smaller unassigned ions are observed 200 Da larger, and are designated by an asterisk. The predicted peptides ending in C-terminal glycine residues, arising from cleavage of the truncated ChitA by Es-cmp are not observed. This indicates that the 29 residue N-terminus of full-length ChitA is at least partially required for substrate recognition by Es-cmp.

Polyglycine hydrolases were shown to target the polyglycine interdomain region of plant class IV chitinases believed to be involved in plant defence. Bz-cmp and Es-cmp each cleaved multiple glycine–glycine bonds within the ChitA linker, with the selection of peptide bonds for cleavage dependent on the length of

the polyglycine sequence. ChitB, an isoenzyme of ChitA with a glycine-rich linker in which serine residues interrupt the otherwise polyglycine sequence, is resistant to this activity as a direct result of the serine residue. In contrast with results obtained with purified Bz-cmp and SecPEs from related fungal species, Es-cmp from the  c The Authors Journal compilation  c 2014 Biochemical Society

196

Figure 6

T. A. Naumann, D. T. Wicklow and N. P. J. Price

Polyglycine hydrolase activity of other Pleosporineae pathogens

(A) Activity of partially purified Bz-cmp on four plant class IV chitinases (SDS/PAGE; left-hand panel). Incubation with Bz-cmp leads to truncation of ChitA-B73 and ChitA-LH82 alloforms, whereas ChitB is resistant to degradation and AtchitIV3 is not truncated (SDS/PAGE; right-hand panel). (B) Sequence alignment of substrate chitinases. The ChitA-B73 sequence is shown in the top row and was used as the reference sequence for the alignment; the ChitA-LH82, ChitB and AtchitIV3 sequences are shown below. The Bz-cmp cleavage sites are indicated by the arrows. (C) Activity of secreted protein extracts from various fungal isolates. Secreted proteins were incubated with each of the four substrate chitinases. SDS/PAGE cmp results are shown for fungi that were identified as secreting Bz-cmp-like polyglycine hydrolases (upper three rows) and Es-cmp-like polyglycine hydrolases (bottom row).

sorghum pathogen E. sorghi readily truncates ChitB, suggesting that this polyglycine hydrolase may have evolved to counteract this resistance. As a secreted protein, ChitA is present in the apoplastic space during kernel growth and development. Within the apoplast, it is exposed to an arsenal of secreted fungal proteins. We initially observed truncation of ChitA by Bz-cmp by analysing proteins from kernels rotted by C. carbonum [11]. How do Bzcmp and Es-cmp recognize the chitinase target proteins within a complex mixture of fungal and plant proteins and how do they selectively cleave peptide bonds in their polyglycine linkers? One  c The Authors Journal compilation  c 2014 Biochemical Society

type of protease selectivity that could contribute to this selectivity is cleavage site specificity, interactions between protease and substrate that occur between the protease active site and near the substrate cleavage site [19–21]. As polyglycine is an unusual sequence motif, polyglycine hydrolases could specifically cleave linker sequences by having a narrow active site that occludes residues with side chains. In one possible model, the active site would selectively bind six consecutive glycine residues and hydrolyse the middle peptide bond. This model is supported by data obtained from reactions of Bz-cmp with both ChitA alloforms (Figure 3A). When incubated with ChitA-B73, which has 14

Polyglycine hydrolases

consecutive glycine residues, Bz-cmp cleaved all nine possible peptide bonds predicted by this model. When incubated with ChitA-LH82, which has 11 consecutive glycine residues, Bzcmp cleaved all six possible peptide bonds. This model could also explain the low activity of Bz-cmp on ChitB, as the linker of this chitinase does not have more than four consecutive glycine residues. Noticeably, however, the activity of Bz-cmp on ChitB(SS/GG), which has ten consecutive glycine residues, did not result in cleavage after Gly3 through Gly7 . Instead, the protease cleaved the same peptide bonds after Gly3 , and Gly4 -as observed with ChitB (Figure 4B, d). Moreover, analysis of Escmp reactions does not support this model. In terms of cleavage site selectivity, analysis of the 12 unique reactions only predicts absolutely that the amino acid on the amino side of the scissile bond must be a glycine, and that the amino acid on the carboxy side is usually a glycine. Selectivity, therefore, must be partially due to other factors. A second type of protease selectivity is contributed by exosite interactions, interactions between protease and substrate that occur outside of the protease active site and substrate cleavage site [22–25]. Evidence that polyglycine hydrolases use exosite interactions to recognize the N-terminal hevein domain of ChitA is shown in Figure 5. When the N-terminal 29 residues of ChitA were removed by pre-incubation with Fv-cmp, Es-cmp did not cleave the polyglycine linker. The truncated ChitA substrate, which has eight amino acids preceding the polyglycine domain, was insufficient for substrate recognition. Taken together, this result and the analysis of reaction products suggest that fungal polyglycine hydrolases recognize the N-terminal hevein domain of ChitA (Figure 5) followed by selective cleavage of glycine– glycine bonds in the linker (Figures 3 and 4), although limited cleavage of glycine–serine bonds was observed with the ChitB substrate (Figures 3 and 4B, a and e). Polyglycine is a relatively unusual structural feature of natural proteins, and little is known about proteases that target these structural motifs. Known examples are lysostaphintype peptidases that target the pentaglycine cross-links in peptidoglycan cell walls of certain Gram-positive bacteria. These proteases are composed of catalytic (M23 endopeptidase) and targeting (SH3b) domains. Both the catalytic [26] and targeting domains [27] have been shown to specifically recognize the pentaglycine sequence. Lysostaphins are toxic to bacteria with pentaglycine cross-links, and bacteria that produce these proteases also express resistance proteins that replace specific glycine residues in their own peptidoglycan with serine [28,29]. The existence of these resistance genes makes the use of lysostaphins as antibiotics less attractive as there are no known lysostaphins that can cleave the serine-modified pentaglycines. Although fungal polyglycine hydrolases are expected to be unrelated to lysostaphins, fungi do not have M23 peptidases or SH3 domaincontaining proteins, the common incorporation of serine residues to inhibit both proteases suggests that there may be biochemical similarities in their mechanisms. Future comparison of Bz-cmp, whose activity is blocked by serine residues in the target site, with Es-cmp, which is able to cleave polyglycines with incorporated serine residues, could guide the rational engineering of plant class IV chitinases for increasing fungal resistance of crop plants and guide the design of lysostaphins that cleave serine-substituted pentaglycines. Most plant pathogens in the Pleosporales order of Ascomycota belong to one of four families comprising the suborder Pleosporineae, namely Didymellaceae, Leptosphaeriaceae, Phaeosphaeriaceae and Pleosporaceae [18,30,31]. Species of Cochliobolus and its asexual forms in Bipolaris and Curvularia (Pleosporaceae) are primarily mild pathogens

197

of grasses, a few having caused major disease epidemics of important food crops such as rice, wheat and maize [12,32,33]. The present study demonstrates that both C. carbonum (Pleosporales) and E. sorghi (Didymellaceae) secrete polyglycine hydrolases that specifically cleave polyglycine-containing plant class IV chitinases. At the same time, fungalysin cmp activity, which targets a conserved region within the hevein domain, was previously reported for Alternaria brassicae and A. brassicicola representing the Pleosporaceae, whereas an unknown cmp activity was observed from SecPEs of Leptosphaeria maculans (Leptosphaeriaceae) [34]. Further study of the cmps secreted by pathogens in the Pleosporineae is needed, but it is clear that these pathogens can secrete at least two distinct types of proteases, fungalysins and polyglycine hydrolases, that have separately evolved to attack plant class IV chitinases. AUTHOR CONTRIBUTION Todd Naumann, Donald Wicklow and Neil Price conceived and designed the research, carried out the experiments, and wrote the paper.

ACKNOWLEDGEMENTS We thank Kurt Sollenberger, Jacob Brown and Trina Hartman for technical assistance.

FUNDING This research received no specific grant from any funding agency in the public, commercial or not-for-profit sectors.

REFERENCES 1 Huynh, Q. K., Hironaka, C. M., Levine, E. B., Smith, C. E., Bormeyer, J. R. and Shah, D. M. (1992) Antifungal proteins from plants: purification, molecular cloning, and antifungal properties of chitinases from maize seed. J. Biol. Chem. 267, 6635–6640 PubMed 2 Schlumbaum, A., Mauch, F., Vogeli, U. and Boller, T. (1986) Plant chitinases are potent inhibitors of fungal growth. Nature 324, 365–367 CrossRef 3 Kaku, H., Nishizawa, Y., Ishii-Minami, N., Akimoto-Tomiyama, C., Dohmae, N., Takio, K., Minami, E. and Shibuya, N. (2006) Plant cells recognize chitin fragments for defense signaling through a plasma membrane receptor. Proc. Natl. Acad. Sci. U.S.A. 103, 11086–11091 CrossRef PubMed 4 Meins, F. Jr., Fritig, B., Linthorst, H. J. M., Mikkelsen, J. D., Neuhaus, J. M. and Ryals, J. (1994) Plant chitinase genes. Plant Mol. Biol. Rep. 12, S22–S28 CrossRef 5 Archer, B. L. (1960) The proteins of Hevea brasiliensis latex. 4. Isolation and characterization of crystalline hevein. Biochem. J. 75, 236–240 PubMed 6 Cantarel, B. I., Coutinho, P. M., Rancurel, C., Bernard, T., Lombard, B. and Henrissat, B. (2009) The Carbohydrate-Active EnZymes database (CAZy): an expert resource for glycogenomics. Nucleic Acids Res. 37, D233–D238 CrossRef PubMed 7 Naumann, T. A. and Wicklow, D. T. (2010) Allozyme-specific modification of a maize seed chitinase by a protein secreted by the fungal pathogen Stenocarpella maydis . Phytopathology 100, 645–654 CrossRef PubMed 8 Naumann, T. A. (2010) Modification of recombinant maize ChitA chitinase by fungal chitinase-modifying proteins. Mol. Plant Pathol. 12, 365–372 CrossRef PubMed 9 Naumann, T. A., Wicklow, D. T. and Price, N. P. J. (2011) Identification of a Chitinase-modifying protein from Fusarium verticillioides : truncation of a host resistance protein by a fungalysin metalloprotease. J. Biol. Chem. 286, 35358–35366 CrossRef PubMed 10 Naumann, T. A. and Price, N. P. J. (2012) Truncation of class IV chitinases from Arabidopsis by secreted fungal proteases. Mol. Plant Pathol. 13, 1135–1139 CrossRef PubMed 11 Naumann, T. A., Wicklow, D. T. and Kendra, D. F. (2009) Maize seed chitinase is modified by a protein secreted by Bipolaris zeicola . Physiol. Mol. Plant Pathol. 74, 134–141 CrossRef 12 Condon, B. J., Leng, Y., Wu, D., Bushley, K. E., Ohm, R. A., Otillar, R., Martin, J., Schackwitz, W., Grimwood, J., MohdZainudin, N. et al. (2013) Comparative genome structure, secondary metabolite, and effector coding capacity across Cochliobolus pathogens. PLoS Genet. 9, e1003233 CrossRef PubMed  c The Authors Journal compilation  c 2014 Biochemical Society

198

T. A. Naumann, D. T. Wicklow and N. P. J. Price

13 Ellis, M. B. and Holliday, P. (1971) IMI Descriptions of Fungi and Bacteria, pp. Sheet 301, CAB International, Wallingford 14 Sivanesan, A. and Holliday, P. (1981) C.M.I. Descriptions of Pathogenic Fungi and Bacteria, pp. 701–710, CAB International, Wallingford 15 Bissett, J. (1982) Stagonospora nodorum . Fungi Canadenses 240, 1–2 16 Punithalingam, E. (1979) Graminicolous Ascochyta species. Mycol. Pap. 142, 1–214 17 Borema, G. H., De Gruyter, J., Noordeloos, M. E. and Hamers, M. E. C. (2004) Phoma Identification Manual: Differentiation of Specific and Infra-Specific Taxa in Culture, CAB International, Wallingford CrossRef 18 Aveskamp, M. M., deGruyter, J., Woudenberg, J. H. C., Verkley, G. J. M. and Crous, P. W. (2010) Highlights of the Didymellaceae : a polyphasic approach to characterize Phoma and related pleosporalean genera. Stud. Mycol. 65, 1–60 CrossRef PubMed 19 Thornberry, N. A., Rano, T. A., Peterson, E. P., Rasper, D. M., Timkey, T., Garcia-Calvo, M., Houtzager, V. M., Nordstrom, P. A., Roy, S., Vaillancourt, J. P. et al. (1997) A combinatorial approach defines specificities of members of the caspase family and Granzyme B: functional relationships established for key mediators of apoptosis. J. Biol. Chem. 272, 17907–17911 CrossRef PubMed 20 Stennicke, H. R., Renatus, M., Meldal, M. and Salvesen, G. S. (2000) Internally quenched fluorescent peptide substrates disclose the subsite preferences of human caspases 1, 3, 6, 7 and 8. Biochem. J. 350, 563–568 CrossRef PubMed 21 Diamond, S. L. (2007) Methods for mapping protease specificity. Curr. Opin. Chem. Biol. 11, 46–51 CrossRef PubMed 22 Krishnaswamy, S. (2004) Exosite-driven substrate specificity and function in coagulation. J. Thromb. Haemost. 3, 54–67 CrossRef 23 Chandrashekhara, M., Yang, L. and Rezaie, A. R. (2012) Identification of exosite residues of factor Xa involved in recognition of PAR-2 on endothelial cells. Biochemistry 51, 2551–2557 CrossRef PubMed 24 Kidmose, R. T., Laursen, N. S., Dobo, J., Kjaer, T. R., Sirothkina, S., Yatime, L., Sottrup-Jensen, L., Thiel, S., Gal, P. and Andersen, G. R. (2012) Structural basis for activation of the complement system by component C4 cleavage. Proc. Natl. Acad. Sci. U.S.A. 109, 15425–15430 CrossRef PubMed Received 25 February 2014; accepted 17 March 2014 Published as BJ Immediate Publication 17 March 2014, doi:10.1042/BJ20140268

 c The Authors Journal compilation  c 2014 Biochemical Society

25 Sidhu, P. S., Aziz, M. H. A., Sarkar, A., Mehta, A. Y., Zhou, Q. and Desai, U. R. (2013) Designing allosteric regulators of thrombin. Exosite 2 features multiple subsites that can be targeted by sulfated small molecules for inducing inhibition. J. Med. Chem. 56, 5059–5070 CrossRef PubMed 26 Firczuk, M., Mucha, A. and Bochtler, M. (2005) Crystal structures of active LytM. J. Mol. Biol. 354, 578–590 CrossRef PubMed 27 Lu, J. Z., Fujiwara, T., Komatsuzawa, H., Sugai, M. and Sakon, J. (2006) Cell wall-targeting domain of glycylglycine endopeptidase distinguishes among peptidoglycan cross-bridges. J. Biol. Chem. 281, 549–558 CrossRef PubMed 28 Ehlert, K., Tschierske, M., Mori, C., Schroder, W. and Berger-Bachi, B. (2000) Site-specific serine incorporation by Lif and Epr into positions 3 and 5 of the staphylococcal peptidoglycan interpeptide bride. J. Bacteriol. 182, 2635–2638 CrossRef PubMed 29 Bardelang, P., Vankemmelbeke, M., Zhang, Y., Jarvis, H., Antoniadou, E., Rochette, S., Thomas, N. R., Penfold, C. N. and James, R. (2009) Design of a polypeptide FRET substrate that facilitates study of the antimicrobial protease lysostaphin. Biochem. J. 418, 615–624 CrossRef PubMed 30 Zhang, Y., Schloch, C. L., Fournier, J., Crous, P. W., de Gruyter, J., Woudenberg, J. H. C., Hirayama, K., Tanaka, K., Pointing, S. B., Spatafora, J. W. and Hyde, K. D. (2009) Muti-locus phylogeny of Pleosporales: a taxonomic, ecological and evolutionary re-evaluation. Stud. Mycol. 64, 85–102 CrossRef PubMed 31 deGruyter, J., Woudenberg, J. H. C., Aveskamp, M. M., Verkley, G. J. M., Groenewald, J. Z. and Crous, P. W. (2013) Redisposition of phoma-like anamorphs in Pleosporales. Stud. Mycol. 75, 1–36 CrossRef PubMed 32 Berbee, M. L., Pirseyedi, M. and Hubbard, S. (1999) Cochliobolus phylogenetics and the origin of known, highly virulent pathogens, inferred from ITS and glyceraldehydes-3-phosphate dehydrogenase gene sequences. Mycologia 91, 964–977 CrossRef 33 Manamgoda, D. S., Cai, L., Bahkali, A. H., Chukeatirote, E. and Hyde, K. D. (2011) Cochliobolus : an overview and current status of species. Fungal Divers. 51, 3–42 CrossRef 34 Naumann, T. A. and Wicklow, D. T. (2013) Chitinase modifying proteins from phyllogenetically distinct lineages of Brassica pathogens. Physiol. Mol. Plant Pathol. 82, 1–9 CrossRef