ARTICLE IN PRESS American Journal of Infection Control ■■ (2015) ■■–■■

Contents lists available at ScienceDirect

American Journal of Infection Control

American Journal of Infection Control

j o u r n a l h o m e p a g e : w w w. a j i c j o u r n a l . o r g

Major articles

Pneumocystis pneumonia outbreak among renal transplant recipients at a North American transplant center: Risk factors and implications for infection control Sunita Mulpuru MD, MSc a,b,c,*, Greg Knoll MD, MSc a,c,d, Colleen Weir RN a, Marc Desjardins MD a,e, Daniel Johnson a, Ivan Gorn a, Todd Fairhead MD a,d, Janice Bissonnette RN a, Natalie Bruce RN a, Baldwin Toye MD a,e, Kathryn Suh MD a,f, Virginia Roth MD a,f a

The Ottawa Hospital, Ottawa, Ontario, Canada Division of Respirology, Department of Medicine, University of Ottawa, Ottawa, Ontario, Canada c Clinical Epidemiology Program, Ottawa Hospital Research Institute, Ottawa, Ontario, Canada d Division of Nephrology, Kidney Research Centre, Department of Medicine, University of Ottawa, Ottawa, Ontario, Canada e Department of Pathology and Laboratory Medicine, University of Ottawa, Ottawa, Ontario, Canada f Division of Infectious Diseases, Department of Medicine, University of Ottawa, Ottawa, Ontario, Canada b

Key Words: Infection control Fungal Pneumonia Solid Organ Transplant

Background: Pneumocystis pneumonia is a severe opportunistic fungal infection. Outbreaks among renal transplant recipients have been reported in Europe and Japan, but never in North America. Methods: We conducted a retrospective case–control study among adult renal transplant recipients at a Canadian center, using a 3:1 matching scheme. Ten cases and 30 controls were matched based on initial transplantation date, and all patients received prophylaxis with trimethoprim-sulfamethoxazole for 1 year posttransplantation. Results: The median time between transplantation and infection was 10.2 years, and all patients survived. Compared with controls, case patients had statistically lower estimated glomerular filtration rate (29.3 mL/min vs 66.3 mL/min; P = .028) and lymphopenia (0.51 × 109/L vs 1.25 × 109/L; P = .002). Transmission mapping revealed significant overlap in the clinic and laboratory visits among case vs control patients (P = .0002). One hundred percent of patients (4 out of 4) successfully genotyped had the same strain of Pneumocystis jirovecii. Conclusions: Our study demonstrated an outbreak of pneumocystis more than 10 years following initial transplantation, despite using recommended initial prophylaxis. We identified low estimated glomerular filtration rate and lymphopenia as risk factors for infection. Overlapping ambulatory care visits were identified as important potential sources of infection transmission, suggesting that institutions should re-evaluate policy and infrastructure strategies to interrupt transmission of respiratory pathogens. © 2015 Association for Professionals in Infection Control and Epidemiology, Inc. Published by Elsevier Inc. All rights reserved.

Pneumocystis pneumonia (PCP) is an opportunistic fungal infection affecting patients with impaired immune function. It is caused by the organism Pneumocystis jirovecii. Solid organ transplant recipients have increased susceptibility to PCP infection during the first year after transplant, and experience significant conse-

* Address correspondence to Sunita Mulpuru, MD, MSc, FRCPC, The Ottawa Hospital, General Campus Box 211, 501 Smyth Rd, Ottawa, Ontario, Canada K1H 8L6. E-mail address: [email protected] (S. Mulpuru). SM was supported by a Department of Medicine, University of Ottawa research fellowship while completing this study. Conflicts of Interest: None to report.

quences, including severe pneumonia, respiratory failure, increased graft loss, and death.1-4 Antimicrobial prophylaxis reduces the incidence of PCP infection, and is generally the standard of care in most solid organ transplant recipients during the immediate posttransplant period.5,6 Despite recommended prophylaxis strategies, PCP infection outbreaks have been reported to occur many years from the initial transplant date, when prophylaxis would not routinely be used.7,8 This suggests that other patient- and system-level risk factors contribute to infection risk. Observational data suggest that human-to-human transmission of PCP is a factor involved in outbreaks in the renal transplant

0196-6553/© 2015 Association for Professionals in Infection Control and Epidemiology, Inc. Published by Elsevier Inc. All rights reserved. http://dx.doi.org/10.1016/j.ajic.2015.11.012

ARTICLE IN PRESS 2

S. Mulpuru et al. / American Journal of Infection Control ■■ (2015) ■■–■■

population.1,8-14 Transplant patients are often admitted to a common unit, followed in a centralized clinic, and await appointments and laboratory tests together in enclosed waiting rooms. Close contact between symptomatic and nonsymptomatic transplant patients occurs in these settings, creating potential for infection transmission. The precise mode of PCP transmission is not known. Classically, P jirovecii organisms were thought to colonize individuals, remain dormant, and cause pneumonia in the setting of subsequent immune system suppression.10,15,16 However, additional research has demonstrated that P jirovecii DNA can be identified in air samples from rooms of PCP-infected patients, suggesting that re-exposure to the organism via airborne transmission could occur from the environment to a susceptible host.15 Several reports of PCP outbreak clusters and genotyping among renal transplant patients have also supported the concept of human-to-human infection transmission.9,10,12,13,17 Lastly, PCP has also been isolated in respiratory tracts of asymptomatic healthy individuals, suggesting that an asymptomatic human reservoir could infect a susceptible host in the right setting.18,19 Although PCP outbreaks have been reported in Europe, Japan, Australia, and India, outbreaks at North American renal transplant centers have not been reported in the literature. Differing approaches to care delivery, clinic environments, prophylaxis duration, infection control standards, and clinical follow-up may have an influence on PCP acquisition in North American transplant recipients compared with other regions of the world. In this study, we describe the characteristics and outcomes of the first reported PCP outbreak in a North American renal transplant center. We investigate possible risk factors, including evidence for human-tohuman PCP transmission, and describe the infection control policy interventions that occurred after the outbreak.

Outcomes assessed included the timing of onset of respiratory symptoms, intensive care unit admission, death, and length of hospital stay. Cases and controls were compared by demographic characteristics, comorbidities, laboratory values, previous hospitalizations, previous antibiotic use, and use of immunosuppressant medications.

METHODS

Laboratory diagnosis and molecular typing of PCP

Study setting

BAL samples from patients with suspected PCP infection were tested using the Monofluo Pneumocystis jiroveci IFA Test Kit (BioRad, Redmond, Wash) according to manufacturer’s instructions. Indirect fluorescent antibody-positive PCP samples from renal transplant patients and a cohort of unrelated PCP patients were typed based on nucleotide sequence variations of the internal transcribed spacer regions 1 (ITS1) and 2 (ITS2) according to a modification of the method of Lee et al.20 Genomic DNA was extracted from BAL samples using QIAamp DNA Blood Mini Kit (Qiagen, Valencia, Calif). Primers for amplification of the ITS1 and ITS2 regions were designed based on the Gen Bank sequence (http://www.ncbi.nlm.nih.gov) (National Center for Biotechnology Information accession No. CAKM01000285) to amplify a 779 bp region encompassing both the ITS1 and ITS2 sequences (ITS-F: GATTATGTCCCTGCCCTTTG; ITS-R: CGCTTCACTCGCCGTTACT). The primers amplified a region approximately 100 bp upstream of ITS1 and approximately 100 bp downstream of ITS2. The reaction mixture contained genomic DNA (2 uL), TaqSelect2X Econo Green polymerase (12.5 uL), Taq (Quiagen) polymerase (2 uL), primers (10 uM) (EcoTaq Plus Green 2X Master Mix; Lucigen, Cat#300331, Middleton, WI), and water, to a final volume of 25 uL. The polymerase chain reaction (PCR) cycling conditions consisted of an initial stage at 95°C for 2 minutes, 10 cycles of touch-down PCR (denature, 94°C for 15 seconds; annealing, 67°C-62°C for 5 seconds; and extension, 68°C for 1 minute), followed by 40 cycles of standard PCR (94°C for 15 seconds, 62°C for 5 seconds, and 68°C for 1 minute). The PCR product was separated by electrophoresis in a 2% agarose gel. Bands of the expected size were excised and DNA eluted using QIAquick Gel Extraction Kit (Qiagen). Sequencing was performed by the StemCore Laboratories at the Ottawa Hospital Research Institute (Ottawa, Ontario, Canada). Sequences were aligned and compared using the National Center

Between October 2011 and November 2012, 10 cases of laboratory-confirmed PCP occurred at The Ottawa Hospital (TOH). TOH is a 1,000-bed adult tertiary care academic hospital with an adult renal transplantation program. All patients are admitted to the same in-patient ward immediately following renal transplantation, and are subsequently followed at a single, outpatient, multidisciplinary clinic staffed by nephrologists, nurses, a dietitian, a social worker, and a pharmacist. The clinic is located at a campus with an independent laboratory and radiology department. The program currently follows approximately 930 patients and completes 75 transplants per year. Our center routinely gives PCP prophylaxis for 1 year after transplantation. Since the renal transplant program’s inception more than 15 years ago, there had been no reported cases of PCP until this outbreak. Case control study We conducted a retrospective case–control study with adult patients (older than age 18 years) who underwent initial renal transplantation from living or deceased donors between 1998 and 2010. All PCP cases were initially transplanted during this time frame. Cases were defined as adult renal transplant patients diagnosed with PCP based on direct fluorescent antibody testing from a bronchoalveolar lavage (BAL) specimen between October 2011 and November 2012. Control patients who received a renal transplant between 1998 and 2010 were randomly selected using the renal transplant clinic database. Patients were excluded from the control group if they died or were no longer followed by the renal transplant clinic at TOH. Three control patients were selected for every case (3:1 matching scheme).

Observational study A review of patient flow and ambulatory care processes was conducted in the in-patient unit, renal transplant clinic, and phlebotomy laboratory to identify possible opportunities for infection transmission. We developed a temporal epidemiologic map of patient health care encounters by identifying the time and date of all inpatient, clinic, and outpatient laboratory visits between October 2011 and November 2012. Among PCP infection cases, we determined the dates and times of overlapping health care encounters, noting whether patients were symptomatic or asymptomatic at the time. We defined overlapping visits as encounters within 1 hour of each other. In the control group, we compared health care encounters with PCP cases. An infection control or transplant nurse also interviewed cases to identify possible common social encounters outside the hospital setting. Microbiology review Records from the microbiology laboratory between 2008 and 2012 were reviewed to identify the number of PCP infections per year. The TOH lab processes respiratory samples for PCP collected at the hospital, as well as samples from select hospitals in the region.

ARTICLE IN PRESS S. Mulpuru et al. / American Journal of Infection Control ■■ (2015) ■■–■■

for Biotechnology Information database (http://www.ncbi.nlm .nih.gov) and nucleotide mismatches were verified by manually reading the electropherogram to identify nucleotide miscalls. For each sample, the ITS PCR was performed in duplicate and each PCR product was sequenced a total of 4 times to ensure reproducibility of sequencing. The sequences were typed according to the scoring system developed by Lee et al.20 Patients in the case group with the same PCP strain were referenced with the clinic and laboratory visits to determine if overlapping visits with other patients occurred.

Data collection and data sources Study variables and outcomes for case and control patients were identified by chart review using the renal transplant clinic chart and TOH’s electronic medical record system. Data were extracted by 2 independent investigators using a standardized chart abstraction extraction form. All variables were identified and defined a priori. Data for cases were collected during the outbreak period and at the time of PCP infection. For controls, a contemporary time frame of November 2011-November 2012 was chosen for data collection. Laboratory and clinic visit data were obtained using TOH’s patient booking information system.

Statistical analysis We used the 1-way analysis of variance test to compare continuous variables in case and control groups, and χ2 tests to compare categorical variables. We did not conduct any multivariate regression analysis due to small sample sizes, which limited statistical power.

Outbreak control measures Screening for febrile respiratory illness in renal transplant patients presenting to the outpatient clinic or laboratory was enhanced. Patients were instructed to wear a mask if they had respiratory symptoms. In November 2012, PCP prophylaxis was recommended to all 740 renal transplant patients, regardless of the number of years since their renal transplant.

3

RESULTS Description of PCP case patients Ten cases of PCP in renal transplant recipients were identified between November 2011 and October 2012 (Fig 1). All case patients presented with dyspnea, whereas cough and fever occurred in 78% (7 out of 9 patients) and 80% (8 out of 10 patients), respectively. In 1 patient, we were unable to identify if fever or cough occurred. The median time between renal transplantation and PCP infection was 3,723.5 days (10.2 years), with a range of 561-5,064 days. The median number of days between symptom onset and PCP diagnosis was 34 days (4.9 weeks), with a range of 6-89 days (1-13 weeks). Median length of stay in hospital was 11 days. One half of case patients (5 out of 10) required admission to the intensive care unit, but all patients survived to discharge from hospital. Ninety percent of patients were treated with trimethoprimsulfamethoxazole, whereas the remaining 1 case patient was treated with pentamidine.

Comparison of cases and controls: Risk factors for PCP infection Table 1 describes the study variables in the case and control groups. There were no significant differences in mean patient age among cases and controls. A higher proportion of the case patients had a deceased donor, but this was not statistically significant compared with the control group (P = .25). The proportion of case patients with a laboratory visit within 1 hour of another case was significantly greater compared with the control group (60% vs 13.3%; P = .003). The proportion of patients with a clinic visit within 1 hour of a PCP case patient was also greater in the case group; however, this was not statistically significant when compared with the control group (30% case group vs 10% control group; P = .13). No statistical differences between cases and control groups were noted with respect to comorbidities, including diabetes, or infection with HIV, cytomegalovirus, hepatitis B, or hepatitis C. The estimated glomerular filtration rate (eGFR) at the time of PCP infection was significantly lower in the case group (P = .03). In the control group, eGFR was measured at a reference point of November 2011. The eGFR at PCP symptom onset and 1 month before symptom onset was also lower in case patients but did not reach

Fig 1. Identification of Pneumocystis pneumonia infection in adult renal transplant recipients between November 2011 and 2012.

ARTICLE IN PRESS S. Mulpuru et al. / American Journal of Infection Control ■■ (2015) ■■–■■

4

Table 1 Baseline characteristics and risk factors for Pneumocystis pneumonia (PCP) infection among adult renal transplant recipients, November 2011-October 2012 Variable

Cases (n = 10)

Controls (n = 30)

P value

Age, y Women Deceased donor Laboratory visit within 1 h of PCP case Clinic visit within 1 h of PCP case Clinic and laboratory visits within 1 h of PCP case* Previous hospitalization 6 mo before PCP† History of transplant rejection 1 y before PCP† HIV infection Cytomegalovirus infection 1 y before PCP† Hepatitis B infection Hepatitis C infection Diabetes eGFR time of infection, mL/min‡ Lymphocyte count at time of PCP infection (×109/L)‡ Lymphocyte count 1 mo before symptom onset of PCP infection (×109/L)§

56.00 ± 8.34 3 (30.0) 8 (80.0) 6 (60.0) 3 (30.0) 9 (90) 1 (10.0) 0 (0.0) 0 (0.0) 1 (10.0) 0 (0.0) 1 (10.0) 5 (50.0) 29.34 ± 10.76 0.51 ± 0.30 1.02 ± 0.54

57.60 ± 11.57 13 (43.3) 18 (60.0) 4 (13.3) 4 (13.3) 7 (23.3)* 7 (23.3) 1 (3.3) 0 (0.0) 0 (0.0) 1 (3.3) 0 (0.0) 9 (30.0) 66.28 ± 47.81 1.25 ± 0.66 1.23 ± 0.64

.69 .456 .251 .003 .23 .0002 .361 .559 n/a .079 .559 .079 .251 .028 .002 .39

NOTE. Values are presented as mean ± standard deviation or n (%). eGFR, estimated glomerular filtration rate; n/a, not available. *There was 1 clinic visit and lab visit, on the same day, between a control and a case patient. †A reference time point between November 2011 and November 2012 was selected for the control group. ‡ A reference time point of November 2011 was selected for the control group. §A reference time point of April 2012 was selected for the control group.

Table 2 Antibiotic and immunosuppressant agent use among cases with Pneumocystis pneumonia (PCP) infection and matched controls Medication Antibiotic use 3 mo before PCP infection Trimethoprim-sulfamethoxazole use 3 mo before PCP infection Prednisone Tacrolimus Sirolimus Cyclosporine Mycophenolic acid Mycophenolate mofetil Azathioprine

Cases (n = 10)

Controls (n = 30)

P value*

3 (30.0) 0 (0.0) 10 (100) 4 (40.0) 1 (10.0) 5 (50.0) 3 (30.0) 7 (70.0) 0 (0.0)

13 (43.3) 4 (13.3) 29 (96.7) 18 (60.0) 4 (13.3) 9 (30.0) 5 (16.7) 22 (73.3) 1 (3.3)

.456 .224 .559 .271 .783 .251 .361 .838 .559

NOTE. Values are presented as n (%). *Determined using a χ2 test.

statistical significance (P = .05 and P = .07, respectively). Lymphocyte counts at the time of PCP infection were also significantly lower in case patients, compared with the control group (P = .002). However, lymphocyte counts 1 month before PCP infection were not significantly different compared with the control group (P = .39). Table 2 describes the use of antibiotic and immunosuppression medications among case and control groups. All patients were receiving a baseline dose of prednisone in addition to 1 or more immunosuppressant medications. There were no statistical differences between cases and controls with respect to individual medication use. No patients in the study were being actively treated for rejection at the time of the outbreak. Observational study In the clinic, examining rooms were private and restricted to 1 patient at a time. The waiting area was a common area with close seating that was shared with other nontransplant nephrology patients. The phlebotomy was performed in a common laboratory with a common waiting room. Both clinic and laboratory waiting rooms were confined spaces, typically full of patients, with chairs in close proximity to each other. Potential transmission between PCP case patients Of the 10 PCP case patients, 9 cases could be linked by health care contact to another symptomatic case patient in the laborato-

ry or clinic setting. One pair of case patients met on 2 occasions, once in the laboratory and once in the clinic, on 2 different dates. In the control group, 1 patient overlapped in both the clinic and laboratory on the same date with a case patient. There were 7 out of 62 laboratory visits (11%) where patients who eventually developed PCP overlapped within 1 hour of each other. Overlapping clinic visits occurred less frequently (3 out of 150; 2%). No common social encounters outside of the hospital were identified. Microbiology review Figure 2 demonstrates the number of PCP isolates by year processed at TOH. The number of cases between 2008 and 2012 showed a gradual increase, with a clear surge in 2012, at the time of the outbreak among the renal transplant population. ITS genotypes A total of 7 samples from the case group and 9 samples from unrelated patients with PCP were available for typing of the ITS1 and ITS2 region. Of the 7 renal transplant patients with PCP, the genotype could not be determined for 3 patients because of evidence of coinfection or ITS gene polymorphism. For the remaining 4 out of 4 cases successfully genotyped, the ITS1 and ITS2 genotype was identified as Eb and the sequence homology of the ITS PCR product between the renal transplant patients was >99.5% with an average of 3 nucleic acid base differences between ITS sequences. The

ARTICLE IN PRESS S. Mulpuru et al. / American Journal of Infection Control ■■ (2015) ■■–■■

Fig 2. Number of positive Pneumocystis pneumonia samples identified at The Ottawa Hospital between 2008 and 2012.

genotype of 6 of the 9 unrelated patients with PCP was identified as Eg for 3 patients, Ee for 2 patients, and Eb for 1 patient. There was 99% or less homology with an average of 12 nucleic acid base differences between the ITS sequences of the renal transplant patients compared with the unrelated control patients. The genotype for 3 of the unrelated PCP patients could not be determined either because of coinfection or ITS sequence polymorphism. When results of molecular typing were cross-referenced to overlapping clinic and laboratory visits, there was no evidence of clinic visits on the same day between the patients typed as Eb. However, there were 2 patients with PCP (patient 4 and patient 10) who had laboratory visits on the same day, within 3 hours of each other. Patient 4 was symptomatic, whereas patient 10 was not on May 30, 2012, when the overlapping laboratory visit occurred. PCP was diagnosed in both patients eventually, on June 26, 2012 (patient 4), and October 26, 2012 (patient 10), respectively. Both patients were identified as type Eb. Outbreak control measures Based on our findings of significant overlapping laboratory visits between infected patients, the implication for human-to-human transmission of PCP prompted an institutional infection control response. PCP prophylaxis was initiated for all renal transplant patients, and febrile respiratory illness screening in the outpatient transplant clinic and laboratory were enhanced. Staff instructed all patients with a cough to wear a mask for the duration of their visit. Renovations of the laboratory were undertaken to ensure adequate spatial separation of transplant patients, and patient flow processes were updated to decrease patient contact. Prophylaxis was continued for >1 year after the onset of the last case, and until the above control measures were fully implemented. As of September 2015, there have been no further documented cases of PCP in the TOH renal transplant population. DISCUSSION To our knowledge, this is the first description of a PCP outbreak among renal transplant recipients at a North American tertiary care centre. In this outbreak, PCP infection occurred >10 years following initial transplantation, which is believed to be beyond the highest risk period when routine prophylaxis would not be prescribed. Risk factors associated with PCP infection included low eGFR

5

and lymphopenia, consistent with findings of previous studies.7,21,22 Further, we demonstrated a significant increase in overlap of ambulatory care visits among case patients, especially in the laboratory, suggesting that human-to-human transmission or environment– human transmission could facilitate infection outbreaks in the ambulatory care setting. Several other studies have also examined risk factors for PCP infection in renal transplant recipients, and lymphopenia has emerged as a common risk factor.21,23,24 To determine whether lymphopenia is a product of PCP infection itself, Iiart et al23 conducted an analysis of lymphocyte counts over time in solid organ transplant patients. They found that lymphocyte counts do not differ between infection cases and controls until 50 days before infection, after which time the lymphocyte count in PCP case patients drops dramatically.23 Struijk et al21 also identified lymphopenia before PCP infection as a chronic risk factor, and performed lymphocyte subset analysis. They found a significant reduction in CD4+ cells in cases versus controls, but there was no difference in quantities of Th1 (T helper cells), Th2, and Th17 cells.21 In a study of early onset PCP after transplantation (mean, 5.6 months; range, 2.4-146 months), Brunot et al24 also demonstrated CD4+ lymphopenia in PCP cases versus controls, at 3 months after transplantation, hypothesizing this was related to thymoglobulin induction therapy. Although we did not find any significant differences between case and control patients with respect to individual immunosuppressive therapies, other studies have identified individual agents and combination regimens as risk factors for PCP infection.21,22,25,26 Mycophenolate mofetil as a single agent was found to be a risk factor for PCP infection 22 or in combination with prednisone and tacrolimus.25,26 Use of calcineurin inhibitors, azathioprine, antilymphocyte globulin, and rituximab were not identified as risk factors in a study by Eitner et al,22 who examined 60 PCP case patients compared with 60 control patients across 6 transplant centers in Germany. With regard to induction immunosuppressive agents, study results have been mixed. Struijk et al21 did not find any differences between use of antilymphocyte polyclonal or monoclonal antibodies among PCP case and control patients, whereas Brunot et al24 hypothesized that low-dose thymoglobulin induction led to CD4+ lymphopenia and subsequent PCP infection. In addition to patient-specific risk factors, human-to-human transmission of PCP infection is also thought to contribute to infectious outbreaks, and has been well described.8-12,17 Our study highlights the importance of investigating all potential health care contacts where transmission could have occurred, including laboratory settings (phlebotomy) and ambulatory clinics. PCP outbreaks in the renal transplant population have been recognized during the past 10 years, but the precise mode of transmission is not confirmed. In our study, the epidemiologic link with a symptomatic patient in a confined space suggests droplet or contact transmission. Environment sampling was not done because the significance and infective potential of a positive sample is unclear.8,10,11,17 Transmission from an asymptomatic carrier remains an intriguing possibility, and a risk that is difficult to mitigate.1,27 In 1 outbreak, asymptomatic carriage was found in 2 renal transplant recipients, representing