archives of oral biology 59 (2014) 1146–1154
Available online at www.sciencedirect.com
ScienceDirect journal homepage: http://www.elsevier.com/locate/aob
Platelet-rich plasma enhanced umbilical cord mesenchymal stem cells-based bone tissue regeneration Yong Wen a,b, Weiting Gu c, Jun Cui d, Meijiao Yu a,b, Yunpeng Zhang a,b, Cuizhu Tang a,b, Pishan Yang a,b,*, Xin Xu a,b,* a
School of Stomatology, Shandong University, Jinan, PR China Shandong Provincial Key Laboratory of Oral Biomedicine, Jinan, PR China c Qilu Hospital, Shandong University, Jinan, PR China d Jinan Stomatologic Hospital, Jinan, PR China b
article info
abstract
Article history:
Objectives: To evaluate the effects of platelet-rich plasma (PRP) on the proliferation and
Accepted 3 July 2014
differentiation of umbilical cord mesenchymal stem cells (UC-MSCs) and explore the
Keywords:
in vivo.
Umbilical cord mesenchymal stem
Methods: The proliferation potential of UC-MSCs was evaluated by 3-(4,5-dimethylthiazol-2-
cells (UC-MSCs)
yl)-2,5-diphenyltetrazolium bromide (MTT) assay. The pluripotent differentiation capacity
possibility that PRP combined with UC-MSCs may be useful for bone tissue regeneration
Platelet-rich plasma (PRP)
and alkaline phosphatase (ALP) expression were further determined by ALP staining. The
Bone regeneration
expression of osteoblast-associated genes was evaluated by real-time PCR. In addition, rat
Tissue engineering
critical-sized calvarial defects were examined to evaluate bone regeneration in vivo. Results: PRP enhanced UC-MSC proliferation, and 10% PRP caused the strongest ALP and Alizarin red staining. At 7 days, the expression levels of ALP, Collagen 1 (COL-1) and Runtrelated transcription factor 2 (RUNX2) in the PRP group were higher than those in the FBS group. Newly regenerated bone was observed in the defect areas, and PRP combined with UC-MSCs can accelerate bone regeneration at an early stage. Conclusions: Our current data suggest that UC-MSCs may be utilized in alternative stem cellbased approaches for the reconstruction and regeneration of bone defects, and PRP combined with UC-MSCs can enhance bone regeneration in vivo. # 2014 Elsevier Ltd. All rights reserved.
1.
Introduction
Bone tissue engineering can reduce the expense and risks of using autografts or allografts and can also generate new bone
tissue with good biological function and mechanical qualities.1,2 The concept of bone tissue engineering is based on three elements: scaffolds, cells and growth factors.3,4 Mesenchymal stem cells (MSCs) are an attractive cell source for tissueengineered bone and stem cell-based bone regeneration and
* Corresponding authors at: School of Stomatology, Shandong University, No. 44-1, Wenhua Xi Road, Jinan, Shandong 250012, PR China. Tel.: +86 531 88382923; fax: +86 531 88382923. E-mail addresses: [email protected] (Y. Wen), [email protected] (P. Yang), [email protected] (X. Xu). http://dx.doi.org/10.1016/j.archoralbio.2014.07.001 0003–9969/# 2014 Elsevier Ltd. All rights reserved.
archives of oral biology 59 (2014) 1146–1154
have already been used in clinical trials.5 Bone mesenchymal stem cells (BMSCs) have been successfully used to repair damaged skeletal tissue or large bone defects6–9; however, their differentiation potential and number in the marrow decreases significantly with ageing.10 Moreover, the harvesting procedure is painful and invasive, which may lead to complications and morbidity.11 Because of the disadvantages associated with BMSCs, it is necessary to find new alternative sources of MSCs that function as well as BMSCs but overcome these limitations.12 Recently, we isolated MSCs from various tissues, including adipose tissue,13 umbilical cord tissue,12 skeletal muscle,14 amniotic fluid15 and umbilical cord blood.16 Among these sources, human umbilical cord tissue is routinely discarded as clinical waste, which makes it an ideal candidate cell source for bone tissue engineering. Moreover, the number of fibroblast colony-forming units is significantly higher in human umbilical cord mesenchymal stem cells (hUC-MSCs), and these cells have a faster proliferation rate in monolayer culture.17,18 Therefore, we hypothesize that umbilical cord tissue may provide a large number of cells in short time period to meet the needs of bone tissue engineering. Platelets were thought to be rich sources of growth factors, including platelet-derived growth factor (PDGF), vascular endothelial growth factor, and transforming growth factor-b (TGF-b).19,20 TGF-b and PDGF-AB are typically present in the highest amounts, promoting the healing of soft tissue and bone through stimulation of collagen production to improve wound strength and the initiation of callus formation.21,22 Platelet rich plasma (PRP) has been applied to promote bone healing and was developed as a novel material for bone regeneration. Transplantation of BMSCs and PRP shortened the treatment period and reduced the associated complications.23 Autologous platelet-rich plasma has been shown to be safe, reproducible, and effective in mimicking the natural process of bone and wound healing.24 In this study, we examined the effects of PRP on proliferation and compared the osteogenic differentiation capacity of UC-MSCs treated with PRP compared to foetal bovine serum (FBS). Furthermore, we applied PRP combined with UC-MSCs in a rat model of critical-sized calvarial defects to evaluate their effects on bone regeneration in vivo.
2.2.
1147
Flow cytometric analysis
Approximately 5 105 cells were incubated with specific phycoerythrin (PE)- or fluorescein isothiocyanate (FITC)-conjugated mouse monoclonal antibodies against human CD29, CD105 (Biolegend), CD34, CD44 (eBioscience), and CD90 (R&D Systems). Flow cytometry data were analyzed using CellQuest (BD Biosciences) analysis software.
2.3.
Osteogenic differentiation
UC-MSCs were incubated in 6-well plates (8 103 cells/cm2) overnight and exposed to osteogenic induction medium supplemented with a-MEM containing 10% FBS (Hyclone), 0.1 mM dexamethasone (Sigma), 10 mM b-glycerophosphate (AlfaAesar), 50 mM ascorbate-2-phosphate (Sinopharm Chemical Reagent Co.) and 100 U/ml penicillin/streptomycin (Sigma). The medium was changed every 3–4 days. After 3 weeks later, mineralization was detected by Alizarin red.
2.4.
Adipogenic differentiation
UC-MSCs were incubated in 6-well plates (8 103 cells/cm2) in a-MEM growth medium, allowed to adhere overnight, and replaced with adipogenic induction medium supplemented with a-MEM, containing 10% FBS, 1 mM dexamethasone (Sigma), 200 mM indomethacin (Sigma), 10 mM insulin (Sigma), 0.5 mM isobutyl-methylxanthine (IBMX, Sigma) and 100 U/ml penicillin/streptomycin (Sigma). After 2 weeks, Oil Red O staining was used to detect the formation of oil droplets.
2.5.
Preparation of activated platelet-rich plasma
2.
Materials and methods
Two whole blood samples were derived from a healthy volunteer. PRP was prepared by a traditional two-step centrifugation procedure.26 Briefly, whole blood was initially centrifuged at 220 g for 15 min. The superstratum of yellow plasma was removed to another tube and subsequently centrifuged at 220 g for 15 min. After centrifugation, the platelets accumulated at the bottom, with the platelet-poor plasma (PPP) accumulating on top. To separate PRP from PPP, the PPP was drawn off. The platelets were activated by thrombin activators, and the mixture was allowed to undergo maximal clot retraction at 4 8C overnight prior to centrifugation at 3000 g for 10 min. The superstratum (rich in growth factors released from PRP) was collected and stored at 70 8C.
2.1.
Isolation and characterization of UC-MSCs
2.6.
UC-MSCs were isolated in a manner similar to that described by others.25 Briefly, the arteries and vein were removed from umbilical cord fragments, washed and incubated in 1% type I collagenase (Sigma) for 20 min at 37 8C. A cell pellet was obtained by centrifugation (300 g) for 5 min, and 1 106 UC-MSCs were collected and plated in a 100 mm Petri dish. UC-MSCs were cultured in complete a-MEM (Gibco) containing 10% FBS (Hyclone), 100 U/ml penicillin and 100 mg/ml streptomycin (Sigma) in a tissue culture dish at 37 8C with 5% CO2. The medium was changed every 2–3 days.
UC-MSC proliferation in 2D culture
Cell proliferation analysis was performed using the MTT assay. UC-MSCs were seeded in 96-well plates, and the optical density (OD) of the plates was determined with a microplate reader (Bio-Rad Model 550, Hercules, CA, USA) at a wavelength of 490 nm.
2.7.
Alkaline phosphatase activity of UC-MSCs
UC-MSCs seeded in 24-well plates were induced in osteogenic induction medium. The level of ALP activity was determined on day 7 by absorbance measurements at 405 nm using
1148
archives of oral biology 59 (2014) 1146–1154
p-nitrophenyl phosphate (pNPP). The total protein content was determined with the BCA method using aliquots of the same samples with the PIERCE protein assay kit (Rockford, IL, USA); the samples were read at 562 nm. The ALP levels were normalized to the total protein contents.
2.8.
ALP staining
UC-MSCs were incubated in 6-well plates (8 103 cells/cm2) overnight and exposed to osteogenic induction medium supplemented with a-MEM containing 0.1 mM dexamethasone (Sigma), 10 mM b-glycerophosphate (AlfaAesar), 50 mM ascorbate-2-phosphate (Sinopharm Chemical Reagent Co.) and 100 U/ml penicillin/streptomycin (Sigma). 10% PRP, 5% PRP and 10% FBS (Hyclone) were added to different group. The medium was changed every 3–4 days. After 10 days, the in vitro mineralization was assayed by ALP staining with an alkaline phosphatase measurement kit (Sigma).
2.9.
Alizarin red staining
UC-MSCs were incubated in 12-well plates (4 103 cells/cm2) overnight and exposed to osteogenic induction medium supplemented with a-MEM containing 0.1 mM dexamethasone (Sigma), 10 mM b-glycerophosphate (AlfaAesar), 50 mM ascorbate-2-phosphate (Sinopharm Chemical Reagent Co.) and 100 U/ml penicillin/streptomycin (Sigma). 10% PRP, 5% PRP and 10% FBS (Hyclone) were added to different group. After 3 weeks later, mineralization was detected by Alizarin red. The cultures were washed three times with PBS (pH 7.4) and subsequently stained with 0.5% Alizarin red S in H2O (pH 4.0) for 1 h at room temperature. After staining, the cultures were washed three times with H2O followed by 70% ethanol.
2.10.
Total RNA isolation and quantitative PCR
Total RNA was extracted at 7 days using TRIzol reagent (Invitrogen, CA). A total of 1.0 mg of RNA (in a 20 ml reaction volume) was reverse transcribed using M-MLV reverse transcriptase (TAKARA) and oligo-dT (TAKARA) primers to synthesize first-strand cDNA. RT-PCR reactions were then performed as follows: one cycle of 95 8C for 5 min, followed by 40 cycles of 95 8C for 30 s, 58 8C for 30 s and 72 8C for 30 s, with a final 7-min extension at 72 8C. Real-time PCR was carried out in a Biorad IQ5 amplification system, and changes in gene expression were calculated using the delta-delta CT method. The primers were synthesized by Invitrogen, and their sequences are shown in Table 1; GAPDH was used as an internal control.
2.11.
Critical-sized calvarial defect model
Sprague-Dawley rats (SD rats, 8 weeks old, 180–200 g, male; Laboratory Animal Centre, Shandong University) were used for these experiments. The Institutional Animal Care and Use Committee at Shandong University in Jinan, China approved all of the animal experimental procedures. The critical-sized calvarial defects were induced according to previously described methods.27,28 The rats were anesthetized and swabbed with ethanol. We first prepared a 5-mmdiameter ring with the use of orthodontic ligation wire and used this model to measure and ensure identical defect size, then used dental bur in a slow speed under saline solution irrigation, and finally used periodontal probe to remove bone chip. Two 5.0-mm-diameter defects were created in parietal bone of the skull. Then we prepared collagen gel matrix (Cellmatrix type I-A, Nitta Gelatin Inc.). Mix the following solutions and keep on ice until use: A, Cellmatrix I-A; B, 10 X a-MEM; C, sterile reconstitution buffer (2.2 g NaHCO3 in 100 ml of 0.05 N NaOH and 200 mM HEPES). Mix icecold A, B, and C at a ratio 8:1:1. The order of mixing is very important. After mixing A and B well, add C and mix well again. Then 5 105 cells were suspended in 100 ml collagen solution. This mixture is called the reconstituted collagen solution. Do not make bubbles through the procedure. Then keep the reconstituted collagen solution on ice (4 8C) to prevent gel formation. Then reconstituted collagen solution and collagen gel matrix were filled in the defect, the wounds were closed with 5-0 sutures.
2.12. X-ray detection and grey scale analysis of cranial samples SD rats were anesthetized and fixed with 4% paraformaldehyde by systemic circulation fixation for half an hour and the samples were radiographed with a digital radiographic apparatus (GE Senograph 2000D) under the following conditions: 25 kV, 50 mAs and a distance of 50 cm. Grey scales of the defect regions were then analyzed with specific software (SIEMENS Sidexis).
2.13.
Histomorphometric analysis
The samples were fixed overnight in 4% PFA at 4 8C. To obtain sections, the samples were dehydrated, embedded in paraffin wax, and serially sectioned at 7 mm. Histological sections were stained with haematoxylin and eosin (H&E) to evaluate osteogenesis in the defect regions. The results were visualized by microscopy.
Table 1 – Primers used for real-time PCR. Gene ALP COL I OPN Runx2 GAPDH
Forward primer 50 –30
Reverse primer 50 –30
CCCACAATGTGGACTACCT TCCAACGAGATCGAGATCC TTCCAAGTAAGTCCAACGAAAG CGGAGTGGACGAGGCAAGAG GAGTCAACGGATTTGGTCGT
GAAGCCTTTGGGGTTCTTC AAGCCGAATTCCTGGTCT GTGACCAGTTCATCAGATTCAT TGAGGAATGCGCCCTAAATC TTGATTTTGGAGGGATCTCG
archives of oral biology 59 (2014) 1146–1154
2.14.
Statistical analysis
The data were analyzed using SAS. The statistical analysis was performed by one-way ANOVA. Multiple comparisons were carried out using the Fisher LSD test. Statistical significance was accepted when P values were 0.05), Fig. 4.
3.5.
Fig. 2 – Proliferation of UC-MSCs in 2 D culture. MTT was used to evaluate the proliferation ability of UC-MSCs, and the absorbance of each group was compared at days 3 of the exponential growth phase. Data showed that 10% PRPtreated UC-MSCs had higher proliferative activity than 5% PRP and 10% FBS-treated cells (P < 0.05) (n = 5).
osteogenic genes, including ALP, OPN, RUNX2 and COL-I, was examined by quantitative PCR at 7 days after differentiation. Date showed that ALP and RUNX2 expression in 10% PRP and 5% PRP-treated groups were higher than those in 10% FBStreated group (P < 0.05); COL-I expression in 10% PRP-treated group was higher than that in 10% FBS-treated group. There was no difference between 10% PRP and 5% PRP-treated groups
X-ray analysis
After 3 weeks, no obvious bone structure was observed in UCMSC group, and defect region was rough in PRP + UC-MSC group (Fig. 5A). At 8-week, little bone structure was observed in the margins of the defect regions in UC-MSC group, while high-density regions were observed in PRP + UC-MSC group (Fig. 5B). The relative density of PRP + UC-MSC group showed significantly higher percentage than UC-MSCs group (Fig. 5C).
3.6.
Histological analysis of bone formation
Histological analysis of the calvarial defect regions in each group is shown in Fig. 6. At 3 weeks, H&E staining revealed abundant connective tissue mixed with inflammatory cells in the defect regions, and hardly any new bone formation was observed in the UC-MSCs group (Fig. 6A-a, b). In the PRP + UCMSCs group, abundant connective tissue mixed with inflammatory cells could be still observed in the defects, although new osteoids began to form (Fig. 6A-c, d). At 8 weeks, bone structure formed in the margins of the defect region in the UCMSCs group (Fig. 6B-a). The defects showed good healing, with large areas of osteoid formation in the PRP + UC-MSCs group (Fig. 6B-b).
Fig. 3 – The osteogenic potential of UC-MSCs. (A) Osteogenic potential of UC-MSCs under osteogenic medium. Different groups of ALP staining of UC-MSCs at days 10; matrix mineralization was determined on days 21 by Alizarin red staining (B) The ALP activity was determined at 1 and 2 weeks under normal medium and absorbance measurements at 405 nm were assayed using p-nitrophenyl phosphate (pNPP). The results showed that ALP activities of MSCs in 10% PRP and 5% PRPtreated groups were higher than that in 10%FBS-treated group (n = 3). (C) Co-cultured in osteogenic differentiation medium for 1 week and 2 weeks, ALP activities in 10% PRP and 5% PRP-treated groups were higher than that in 10% FBS-treated group (> , *compared with 10% FBS group; n = 5).
archives of oral biology 59 (2014) 1146–1154
Fig. 4 – Osteoblast-associated gene expression for UC-MSCs. Expression of osteogenic genes, including ALP, COL-I, RUNX2 and OPN were examined by q-PCR at 7 days. Data showed that ALP and RUNX2 expression in 10% PRP and 5% PRP-treated groups were higher than those in 10% FBStreated group (P < 0.05); COL-I expression in 10% PRP-treated group was higher than that in 10%FBS-treated group. There was no difference between 10% PRP and 5% PRP-treated groups for OPN expression compared with 10%FBS-treated group (P > 0.05) (> compared with10% FBS group n = 5).
4.
Discussion
Due to the wide application of stem cells in bone engineering, it is important to identify alternative sources of MSCs that function as well as BMSCs but overcome the limitations of BMSCs.12 In recent years, UC-MSCs have been explored as a source of MSCs, and they have clear advantages over BMSCs.
1151
UC-MSCs isolated from discarded umbilical cords are an inexhaustible alternative cell source for bone repair and reconstruction because of the convenient and noninvasive harvesting procedure.29,30 In addition, UC-MSCs have the ability to differentiate into mesenchymal cell lineages.25,31,32 In our study, UC-MSCs presented a spindle-shaped morphology when cultured in a monolayer. Flow cytometry analysis revealed that UC-MSCs expressed the mesenchymal markers CD105 and the cell adhesion molecules CD29, CD44 and CD90. UC-MSCs could differentiate into certain cell types in conditional media. Moreover, the number of fibroblast colony-forming units is significantly higher in UC-MSCs compared with BMSCs.17 UC-MSCs have a faster proliferation rate in monolayer culture than other adult stem cells18; thus, UCMSCs may provide a larger number of cells in shorter time period to meet the needs of bone tissue engineering. Furthermore, multiple types of growth factors are concentrated in PRP and can be easily and rapidly obtained by centrifugation from whole blood. Thus, PRP may be used in place of FBS as a serum source for MSC cultivation.33 PRP is a promising supplement for ex vivo cell expansion,34 and it has been suggested that PRP could be used as a supplement for ex vivo expansion of MSCs.35,36 Short and long-term proliferation data revealed that PRP enhanced the proliferation of a variety of MSCs derived from bone marrow, adipose tissue and muscle tissue37 and had a potent effect on the proliferation of MSCs, both in the presence and absence of FBS.38 Our study produced a similar result: the proliferative activity of MSCs in the 10% PRP group was higher than that of MSCs in the 5% PRP and 10% FBS groups in monolayer cultures. More importantly, the use of PRP in place of FBS eliminates risks connected with the use of xenogeneic supplements.
Fig. 5 – X-ray analysis of calvarial defect. (A) X-ray image of calvarial defect samples at 3 weeks. No obvious bone structure was observed in UC-MSC group, and defect region was rough in PRP + UC-MSC group (B) X-ray image of calvarial defect samples at 8 weeks. Little bone structure was observed in the margins of the defect regions in UC-MSC group, while highdensity regions were observed in PRP + UC-MSC group (C) The relative density of different groups. PRP + MSCs group showed significantly higher percentage than only MSCs group at 8 weeks (n = 5, $P < 0.05).
1152
archives of oral biology 59 (2014) 1146–1154
Fig. 6 – Histomorphometry analysis of bone formation. (A) Haematoxylin & eosin (H&E) staining was used to evaluate osteogenesis of the defect regions at 3 weeks. (A-a, b) UC-MSCs group showed abundant connective tissue mixed with inflammatory cells in the defects; (A-c, d) PRP + UC-MSCs group showed that connective tissue mixed with inflammatory cells could be still observed in the defects, but new osteoid began to form at the same time. (B) HE staining was used to evaluate the bone regeneration at 8 weeks. (B-a) bone structure was observed in the margins of the defect region in the UCMSCs group, (B-b) good healing with large areas of osteoid formation in the PRP + UC-MSCs group (scale bar = 200 mm).
In our previous study, UC-MSCs showed good potential for bone tissue engineering; however, only minimal bone structure was observed in the margins of the defect region in the UC-MSC-based bone tissue regeneration experiment. Thus, we aimed to identify a new method to improve the effectiveness of UC-MSCs used in bone tissue engineering. Fortunately, PRP contains both scaffolds and growth factors, which are other important aspects of tissue engineering. It was found that when these growth factors are released from platelet lysate, MSC expansion is enhanced in vitro36,39; this finding was also confirmed by our study. PRP has been applied for the promotion of bone healing and developed as a novel material for bone regeneration. PRP obtained from patients can be used as a source of autologous growth factors for the repair of various tissues. PRP has the advantage of being a growth factor concentrate, and it contains growth factors at the proportions necessary for aiding the healing process of tissue injuries. In addition to being autologous in nature, PRP has recently been combined with MSCs for tissue regeneration and has been used as a PRP-gel delivery vehicle for cells during transplantation.40,41 When co-administered with MSCs, platelet gel can improve bone formation in animal models,42 therefore posing no risk of disease transmission or immunogenic reaction; additionally, platelet gel can be used to treat periodontal
defects and in maxillofacial reconstructive surgery.43 The potential of using PRP directly to accelerate the healing of tissue injuries has also been expanded. Moreover, UC-MSCs exhibit bone regeneration potential with strong expression of specific osteogenic markers in vitro.13 In the present study, our data showed that cells treated with 10% PRP exhibited the strongest ALP and Alizarin red staining, and osteogenic genes, including ALP, COL-1 and RUNX2 showed higher expression at early stage in these cells. These results indicate that PRP could enhance the osteogenic ability of UC-MSCs in vitro. PRP retained and improved the differentiation of UC-MSCs and the capacity for in vivo bone formation in a setting that is adaptable to autogenous use.27 PRP-expanded cells also maintained their osteogenic differentiation capacity. Meanwhile, when co-cultured in osteogenic differentiation medium, PRP enhanced the activities of ALP. Recent studies have suggested positive, synergistic effects of MSCs and PRP mixtures in enhancing bone formation in the oral and maxillofacial regions.44,45 PRP was confirmed to improve bone healing in a rabbit model of diaphysis. The areas of bone formation were larger in areas adjacent to the bone resection areas and towards the intact ulna.46 Previous studies support the use of PRP for bone healing as an off-the-shelf therapy. Our study showed that when transplants were combined with a
archives of oral biology 59 (2014) 1146–1154
PRP and UC-MSC mixture, calvarial defects presented good healing with large areas of osteoid formation. Our data suggest that PRP could be used as a supplement for the expansion of UC-MSCs in place of FBS. To the best of our knowledge, this is the first study to demonstrate the efficacy PRP for the expansion and osteogenic induction of UC-MSCs. The use of PRP for UC-MSC expansion has the potential to reduce the cost of cell culture and increase the safety of this cell-based protocol because both PRP and UC-MSCs can be collected autologously or, under well-controlled conditions, allogeneically. In addition, osteogenic induction may be due to a direct effect of the platelet gel on local recruitment of osteoprogenitors. These results may indicate that UC-MSCs have a good potential for use in bone tissue engineering. Moreover, liquid PRP and UC-MSCs could be applied by injection and grafted in a minimally invasive way. If this method can be applied in the clinic, it will serve as a new type of bioremediation agent for use in bone defect regeneration.
5.
Conclusions
Our data suggest that UC-MSCs may serve as alternative mesenchymal stem cells in the reconstruction and regeneration of bone defects, and the UC-MSCs/PRP combination can be used effectively for bone tissue engineering. The PRP-gel delivery vehicle can be applied to cells during transplantation.
Funding This work was supported by grants from the National Natural Science Foundation of China (Grant No. 81300885), China Postdoctoral Science Foundation Funded Project (Grant No. 2013M531618), Independent Innovation Foundation of Shandong University, IIFSDU (Grant No. 2012GN048), Shandong Pharmaceutical and Health Science Technology Development Programme (Grant No. 2013WS0212) and Shandong Provincial Natural Science Foundation, China (Grant Nos. ZR2013HQ052 and ZR2013HM086).
Competing interests None declared.
Ethical approval The experimental protocol was approved by the Institutional Animal Care and Use Committee (School of Stomatology, Shandong University, Jinan, PR China) protocol number 2012-16.
references
1. Chimutengwende-Gordon M, Khan WS. Advances in the use of stem cells and tissue engineering applications in bone repair. Curr Stem Cell Res Ther 2012;7:122–6.
1153
2. O’Keefe RJ, Mao J. Bone tissue engineering and regeneration: from discovery to the clinic – an overview. Tissue Eng B Rev 2011;17:389–92. 3. Montjovent MO, Burri N, Mark S, Federici E, Scaletta C, Zambelli PY, et al. Fetal bone cells for tissue engineering. Bone 2004;35(6):1323–33. 4. Kasten P, Vogel J, Geiger F, Niemeyer P, Luginbuhl R, Szalay K. The effect of platelet-rich plasma on healing in criticalsize long-bone defects. Biomaterials 2008;29(29):3983–92. 5. Rose FR, Oreffo RO. Bone tissue engineering: hope vs hype. Biochem Biophys Res Commun 2002;292(1):1–7. 6. Bianco P, Riminucci M, Gronthos S, Robey PG. Bone marrow stromal stem cells: nature, biology, and potential applications. Stem Cells 2001;19(3):180–92. 7. Kon E, Muraglia A, Corsi A, Bianco P, Marcacci M, Martin I, et al. Autologous bone marrow stromal cells loaded onto porous hydroxyapatite ceramic accelerate bone repair in critical-size defects of sheep long bones. J Biomed Mater Res 2000;49(3):328–37. 8. Petite H, Viateau V, Bensaid W, Meunier A, de Pollak C, Bourguignon M, et al. Tissue-engineered bone regeneration. Nat Biotechnol 2000;18(9):959–63. 9. Quarto R, Mastrogiacomo M, Cancedda R, Kutepov SM, Mukhachev V, Lavroukov A, et al. Repair of large bone defects with the use of autologous bone marrow stromal cells. N Engl J Med 2001;344(5):385–6. 10. Mueller SM, Glowacki J. Age-related decline in the osteogenic potential of human bone marrow cells cultured in threedimensional collagen sponges. J Cell Biochem 2001;82(4):583–90. 11. Lee SY, Miwa M, Sakai Y, Kuroda R, Matsumoto T, Iwakura T, et al. In vitro multipotentiality and characterization of human unfractured traumatic hemarthrosis-derived progenitor cells: a potential cell source for tissue repair. J Cell Physiol 2007;210(3):561–6. 12. Wang HS, Hung SC, Peng ST, Huang CC, Wei HM, Guo YJ, et al. Mesenchymal stem cells in the Wharton’s Jelly of the human umbilical cord. Stem Cells 2004;22(7):1330–7. 13. Zuk PA, Zhu M, Ashjian P, De Ugarte DA, Huang JI, Mizuno H, et al. Human adipose tissue is a source of multipotent stem cells. Mol Biol Cell 2002;13(12):4279–95. 14. Williams JT, Southerland SS, Souza J, Calcutt AF, Cartledge RG. Cells isolated from adult human skeletal muscle capable of differentiating into multiple mesodermal phenotypes. Am Surg 1999;65(1):22–6. 15. De Coppi P, Bartsch Jr G, Siddiqui MM, Xu T, Santos CC, Perin L, et al. Isolation of amniotic stem cell lines with potential for therapy. Nat Biotechnol 2007;25(1):100–6. 16. Lee OK, Kuo TK, Chen WM, Lee KD, Hsieh SL, Chen TH. Isolation of multipotent mesenchymal stem cells from umbilical cord blood. Blood 2004;103(5):1669–75. 17. Lu LL, Liu YJ, Yang SG, Zhao QJ, Wang X, Gong W, et al. Isolation and characterization of human umbilical cord mesenchymal stem cells with hematopoiesis-supportive function and other potentials. Haematologica 2006;91(8):1017–26. 18. Troyer DL, Weiss ML. Wharton’s Jelly-derived cells are a primitive stromal cell population. Stem Cells 2008;26(3):591–9. 19. Boyapati L, Wang HL. The role of platelet-rich plasma in sinus augmentation: a critical review. Implant Dent 2006;15(2):160–70. 20. Tozum TF, Demiralp B. Platelet-rich plasma: a promising innovation in dentistry. J Can Dent Assoc 2003;69(10):664. 21. Hosgood G. Wound healing: the role of platelet-derived growth factor and transforming growth factor beta. Vet Surg 1993;22(6):490–5. 22. Bolander ME. Regulation of fracture repair by growth factors. Proc Soc Exp Biol Med 1992;200(2):165–70. 23. Kitoh H, Kitakoji T, Tsuchiya H, Katoh M, Ishiguro N. Transplantation of culture expanded bone marrow cells and
1154
24.
25.
26.
27.
28.
29.
30.
31.
32.
33.
34.
35.
archives of oral biology 59 (2014) 1146–1154
platelet rich plasma in distraction osteogenesis of the long bones. Bone 2007;40(2):522–8. Smith SE, Roukis TS. Bone and wound healing augmentation with platelet-rich plasma. Clin Podiatr Med Surg 2009;26(4):559–88. Sarugaser R, Lickorish D, Baksh D, Hosseini MM, Davies JE. Human umbilical cord perivascular (HUCPV) cells: a source of mesenchymal progenitors. Stem Cells 2005;23(2):220–9. Han J, Meng HX, Tang JM, Li SL, Tang Y, Chen ZB. The effect of different platelet-rich plasma concentrations on proliferation and differentiation of human periodontal ligament cells in vitro. Cell Prolif 2007;40(2):241–52. Schmitz JP, Hollinger JO. The critical size defect as an experimental model for craniomandibulofacial nonunions. Clin Orthop Relat Res 1986;205:299–308. Cowan CM, Shi YY, Aalami OO, Chou YF, Mari C, Thomas R, et al. Adipose-derived adult stromal cells heal critical-size mouse calvarial defects. Nat Biotechnol 2004;22(5):560–7. Wang L, Tran I, Seshareddy K, Weiss ML, Detamore MS. A comparison of human bone marrow-derived mesenchymal stem cells and human umbilical cord-derived mesenchymal stromal cells for cartilage tissue engineering. Tissue Eng A 2009;15(8):2259–66. Hou T, Xu J, Wu X, Xie Z, Luo F, Zhang Z, et al. Umbilical cord Wharton’s Jelly: a new potential cell source of mesenchymal stromal cells for bone tissue engineering. Tissue Eng A 2009;15(9):2325–34. Ma L, Feng XY, Cui BL, Law F, Jiang XW, Yang LY, et al. Human umbilical cord Wharton’s Jelly-derived mesenchymal stem cells differentiation into nerve-like cells. Chin Med J (Engl) 2005;118(23):1987–93. Baksh D, Yao R, Tuan RS. Comparison of proliferative and multilineage differentiation potential of human mesenchymal stem cells derived from umbilical cord and bone marrow. Stem Cells 2007;25(6):1384–92. Goedecke A, Wobus M, Krech M, Munch N, Richter K, Holig K, Bornhauser M. Differential effect of platelet-rich plasma and fetal calf serum on bone marrow-derived human mesenchymal stromal cells expanded in vitro. J Tissue Eng Regen Med 2011;5(8):648–54. Shahdadfar A, Fronsdal K, Haug T, Reinholt FP, Brinchmann JE. In vitro expansion of human mesenchymal stem cells: choice of serum is a determinant of cell proliferation, differentiation, gene expression, and transcriptome stability. Stem Cells 2005;23(9):1357–66. Bieback K, Hecker A, Kocaomer A, Lannert H, Schallmoser K, Strunk D, et al. Human alternatives to fetal bovine serum for the expansion of mesenchymal stromal cells from bone marrow. Stem Cells 2009;27(9):2331–41.
36. Doucet C, Ernou I, Zhang Y, Llense JR, Begot L, Holy X, et al. Platelet lysates promote mesenchymal stem cell expansion: a safety substitute for animal serum in cell-based therapy applications. J Cell Physiol 2005;205(2):228–36. 37. Kocaoemer A, Kern S, Kluter H, Bieback K. Human AB serum and thrombin-activated platelet-rich plasma are suitable alternatives to fetal calf serum for the expansion of mesenchymal stem cells from adipose tissue. Stem Cells 2007;25(5):1270–8. 38. Li H, Usas A, Poddar M, Chen CW, Thompson S, Ahani B, et al. Platelet-rich plasma promotes the proliferation of human muscle derived progenitor cells and maintains their stemness. PLOS ONE 2013;8(6):e64923. 39. Capelli C, Domenghini M, Borleri G, Bellavita P, Poma R, Carobbio A, et al. Human platelet lysate allows expansion and clinical grade production of mesenchymal stromal cells from small samples of bone marrow aspirates or marrow filter washouts. Bone Marrow Transplant 2007;40(8):785–91. 40. Kasten P, Vogel J, Luginbuhl R, Niemeyer P, Weiss S, Schneider S, et al. Influence of platelet-rich plasma on osteogenic differentiation of mesenchymal stem cells and ectopic bone formation in calcium phosphate ceramics. Cells Tissues Org 2006;183(2):68–79. 41. Niemeyer P, Fechner K, Milz S, Richter W, Suedkamp NP, Mehlhorn AT, et al. Comparison of mesenchymal stem cells from bone marrow and adipose tissue for bone regeneration in a critical size defect of the sheep tibia and the influence of platelet-rich plasma. Biomaterials 2010;31(13):3572–9. 42. Liu Y, Zhou Y, Feng H, Ma GE, Ni Y. Injectable tissueengineered bone composed of human adipose-derived stromal cells and platelet-rich plasma. Biomaterials 2008;29(23):3338–45. 43. Lekovic V, Camargo PM, Weinlaender M, Vasilic N, Kenney EB. Comparison of platelet-rich plasma, bovine porous bone mineral, and guided tissue regeneration versus platelet-rich plasma and bovine porous bone mineral in the treatment of intrabony defects: a re-entry study. J Periodontol 2002;73(2):198–205. 44. Yamada Y, Boo JS, Ozawa R, Nagasaka T, Okazaki Y, Hata K, et al. Bone regeneration following injection of mesenchymal stem cells and fibrin glue with a biodegradable scaffold. J Craniomaxillofac Surg 2003;31(1):27–33. 45. Yamada Y, Ueda M, Naiki T, Nagasaka T. Tissue-engineered injectable bone regeneration for osseointegrated dental implants. Clin Oral Implants Res 2004;15(5):589–97. 46. Kim YH, Furuya H, Tabata Y. Enhancement of bone regeneration by dual release of a macrophage recruitment agent and platelet-rich plasma from gelatin hydrogels. Biomaterials 2014;35(1):214–24.
Available online at www.sciencedirect.com
ScienceDirect journal homepage: http://www.elsevier.com/locate/aob
Platelet-rich plasma enhanced umbilical cord mesenchymal stem cells-based bone tissue regeneration Yong Wen a,b, Weiting Gu c, Jun Cui d, Meijiao Yu a,b, Yunpeng Zhang a,b, Cuizhu Tang a,b, Pishan Yang a,b,*, Xin Xu a,b,* a
School of Stomatology, Shandong University, Jinan, PR China Shandong Provincial Key Laboratory of Oral Biomedicine, Jinan, PR China c Qilu Hospital, Shandong University, Jinan, PR China d Jinan Stomatologic Hospital, Jinan, PR China b
article info
abstract
Article history:
Objectives: To evaluate the effects of platelet-rich plasma (PRP) on the proliferation and
Accepted 3 July 2014
differentiation of umbilical cord mesenchymal stem cells (UC-MSCs) and explore the
Keywords:
in vivo.
Umbilical cord mesenchymal stem
Methods: The proliferation potential of UC-MSCs was evaluated by 3-(4,5-dimethylthiazol-2-
cells (UC-MSCs)
yl)-2,5-diphenyltetrazolium bromide (MTT) assay. The pluripotent differentiation capacity
possibility that PRP combined with UC-MSCs may be useful for bone tissue regeneration
Platelet-rich plasma (PRP)
and alkaline phosphatase (ALP) expression were further determined by ALP staining. The
Bone regeneration
expression of osteoblast-associated genes was evaluated by real-time PCR. In addition, rat
Tissue engineering
critical-sized calvarial defects were examined to evaluate bone regeneration in vivo. Results: PRP enhanced UC-MSC proliferation, and 10% PRP caused the strongest ALP and Alizarin red staining. At 7 days, the expression levels of ALP, Collagen 1 (COL-1) and Runtrelated transcription factor 2 (RUNX2) in the PRP group were higher than those in the FBS group. Newly regenerated bone was observed in the defect areas, and PRP combined with UC-MSCs can accelerate bone regeneration at an early stage. Conclusions: Our current data suggest that UC-MSCs may be utilized in alternative stem cellbased approaches for the reconstruction and regeneration of bone defects, and PRP combined with UC-MSCs can enhance bone regeneration in vivo. # 2014 Elsevier Ltd. All rights reserved.
1.
Introduction
Bone tissue engineering can reduce the expense and risks of using autografts or allografts and can also generate new bone
tissue with good biological function and mechanical qualities.1,2 The concept of bone tissue engineering is based on three elements: scaffolds, cells and growth factors.3,4 Mesenchymal stem cells (MSCs) are an attractive cell source for tissueengineered bone and stem cell-based bone regeneration and
* Corresponding authors at: School of Stomatology, Shandong University, No. 44-1, Wenhua Xi Road, Jinan, Shandong 250012, PR China. Tel.: +86 531 88382923; fax: +86 531 88382923. E-mail addresses: [email protected] (Y. Wen), [email protected] (P. Yang), [email protected] (X. Xu). http://dx.doi.org/10.1016/j.archoralbio.2014.07.001 0003–9969/# 2014 Elsevier Ltd. All rights reserved.
archives of oral biology 59 (2014) 1146–1154
have already been used in clinical trials.5 Bone mesenchymal stem cells (BMSCs) have been successfully used to repair damaged skeletal tissue or large bone defects6–9; however, their differentiation potential and number in the marrow decreases significantly with ageing.10 Moreover, the harvesting procedure is painful and invasive, which may lead to complications and morbidity.11 Because of the disadvantages associated with BMSCs, it is necessary to find new alternative sources of MSCs that function as well as BMSCs but overcome these limitations.12 Recently, we isolated MSCs from various tissues, including adipose tissue,13 umbilical cord tissue,12 skeletal muscle,14 amniotic fluid15 and umbilical cord blood.16 Among these sources, human umbilical cord tissue is routinely discarded as clinical waste, which makes it an ideal candidate cell source for bone tissue engineering. Moreover, the number of fibroblast colony-forming units is significantly higher in human umbilical cord mesenchymal stem cells (hUC-MSCs), and these cells have a faster proliferation rate in monolayer culture.17,18 Therefore, we hypothesize that umbilical cord tissue may provide a large number of cells in short time period to meet the needs of bone tissue engineering. Platelets were thought to be rich sources of growth factors, including platelet-derived growth factor (PDGF), vascular endothelial growth factor, and transforming growth factor-b (TGF-b).19,20 TGF-b and PDGF-AB are typically present in the highest amounts, promoting the healing of soft tissue and bone through stimulation of collagen production to improve wound strength and the initiation of callus formation.21,22 Platelet rich plasma (PRP) has been applied to promote bone healing and was developed as a novel material for bone regeneration. Transplantation of BMSCs and PRP shortened the treatment period and reduced the associated complications.23 Autologous platelet-rich plasma has been shown to be safe, reproducible, and effective in mimicking the natural process of bone and wound healing.24 In this study, we examined the effects of PRP on proliferation and compared the osteogenic differentiation capacity of UC-MSCs treated with PRP compared to foetal bovine serum (FBS). Furthermore, we applied PRP combined with UC-MSCs in a rat model of critical-sized calvarial defects to evaluate their effects on bone regeneration in vivo.
2.2.
1147
Flow cytometric analysis
Approximately 5 105 cells were incubated with specific phycoerythrin (PE)- or fluorescein isothiocyanate (FITC)-conjugated mouse monoclonal antibodies against human CD29, CD105 (Biolegend), CD34, CD44 (eBioscience), and CD90 (R&D Systems). Flow cytometry data were analyzed using CellQuest (BD Biosciences) analysis software.
2.3.
Osteogenic differentiation
UC-MSCs were incubated in 6-well plates (8 103 cells/cm2) overnight and exposed to osteogenic induction medium supplemented with a-MEM containing 10% FBS (Hyclone), 0.1 mM dexamethasone (Sigma), 10 mM b-glycerophosphate (AlfaAesar), 50 mM ascorbate-2-phosphate (Sinopharm Chemical Reagent Co.) and 100 U/ml penicillin/streptomycin (Sigma). The medium was changed every 3–4 days. After 3 weeks later, mineralization was detected by Alizarin red.
2.4.
Adipogenic differentiation
UC-MSCs were incubated in 6-well plates (8 103 cells/cm2) in a-MEM growth medium, allowed to adhere overnight, and replaced with adipogenic induction medium supplemented with a-MEM, containing 10% FBS, 1 mM dexamethasone (Sigma), 200 mM indomethacin (Sigma), 10 mM insulin (Sigma), 0.5 mM isobutyl-methylxanthine (IBMX, Sigma) and 100 U/ml penicillin/streptomycin (Sigma). After 2 weeks, Oil Red O staining was used to detect the formation of oil droplets.
2.5.
Preparation of activated platelet-rich plasma
2.
Materials and methods
Two whole blood samples were derived from a healthy volunteer. PRP was prepared by a traditional two-step centrifugation procedure.26 Briefly, whole blood was initially centrifuged at 220 g for 15 min. The superstratum of yellow plasma was removed to another tube and subsequently centrifuged at 220 g for 15 min. After centrifugation, the platelets accumulated at the bottom, with the platelet-poor plasma (PPP) accumulating on top. To separate PRP from PPP, the PPP was drawn off. The platelets were activated by thrombin activators, and the mixture was allowed to undergo maximal clot retraction at 4 8C overnight prior to centrifugation at 3000 g for 10 min. The superstratum (rich in growth factors released from PRP) was collected and stored at 70 8C.
2.1.
Isolation and characterization of UC-MSCs
2.6.
UC-MSCs were isolated in a manner similar to that described by others.25 Briefly, the arteries and vein were removed from umbilical cord fragments, washed and incubated in 1% type I collagenase (Sigma) for 20 min at 37 8C. A cell pellet was obtained by centrifugation (300 g) for 5 min, and 1 106 UC-MSCs were collected and plated in a 100 mm Petri dish. UC-MSCs were cultured in complete a-MEM (Gibco) containing 10% FBS (Hyclone), 100 U/ml penicillin and 100 mg/ml streptomycin (Sigma) in a tissue culture dish at 37 8C with 5% CO2. The medium was changed every 2–3 days.
UC-MSC proliferation in 2D culture
Cell proliferation analysis was performed using the MTT assay. UC-MSCs were seeded in 96-well plates, and the optical density (OD) of the plates was determined with a microplate reader (Bio-Rad Model 550, Hercules, CA, USA) at a wavelength of 490 nm.
2.7.
Alkaline phosphatase activity of UC-MSCs
UC-MSCs seeded in 24-well plates were induced in osteogenic induction medium. The level of ALP activity was determined on day 7 by absorbance measurements at 405 nm using
1148
archives of oral biology 59 (2014) 1146–1154
p-nitrophenyl phosphate (pNPP). The total protein content was determined with the BCA method using aliquots of the same samples with the PIERCE protein assay kit (Rockford, IL, USA); the samples were read at 562 nm. The ALP levels were normalized to the total protein contents.
2.8.
ALP staining
UC-MSCs were incubated in 6-well plates (8 103 cells/cm2) overnight and exposed to osteogenic induction medium supplemented with a-MEM containing 0.1 mM dexamethasone (Sigma), 10 mM b-glycerophosphate (AlfaAesar), 50 mM ascorbate-2-phosphate (Sinopharm Chemical Reagent Co.) and 100 U/ml penicillin/streptomycin (Sigma). 10% PRP, 5% PRP and 10% FBS (Hyclone) were added to different group. The medium was changed every 3–4 days. After 10 days, the in vitro mineralization was assayed by ALP staining with an alkaline phosphatase measurement kit (Sigma).
2.9.
Alizarin red staining
UC-MSCs were incubated in 12-well plates (4 103 cells/cm2) overnight and exposed to osteogenic induction medium supplemented with a-MEM containing 0.1 mM dexamethasone (Sigma), 10 mM b-glycerophosphate (AlfaAesar), 50 mM ascorbate-2-phosphate (Sinopharm Chemical Reagent Co.) and 100 U/ml penicillin/streptomycin (Sigma). 10% PRP, 5% PRP and 10% FBS (Hyclone) were added to different group. After 3 weeks later, mineralization was detected by Alizarin red. The cultures were washed three times with PBS (pH 7.4) and subsequently stained with 0.5% Alizarin red S in H2O (pH 4.0) for 1 h at room temperature. After staining, the cultures were washed three times with H2O followed by 70% ethanol.
2.10.
Total RNA isolation and quantitative PCR
Total RNA was extracted at 7 days using TRIzol reagent (Invitrogen, CA). A total of 1.0 mg of RNA (in a 20 ml reaction volume) was reverse transcribed using M-MLV reverse transcriptase (TAKARA) and oligo-dT (TAKARA) primers to synthesize first-strand cDNA. RT-PCR reactions were then performed as follows: one cycle of 95 8C for 5 min, followed by 40 cycles of 95 8C for 30 s, 58 8C for 30 s and 72 8C for 30 s, with a final 7-min extension at 72 8C. Real-time PCR was carried out in a Biorad IQ5 amplification system, and changes in gene expression were calculated using the delta-delta CT method. The primers were synthesized by Invitrogen, and their sequences are shown in Table 1; GAPDH was used as an internal control.
2.11.
Critical-sized calvarial defect model
Sprague-Dawley rats (SD rats, 8 weeks old, 180–200 g, male; Laboratory Animal Centre, Shandong University) were used for these experiments. The Institutional Animal Care and Use Committee at Shandong University in Jinan, China approved all of the animal experimental procedures. The critical-sized calvarial defects were induced according to previously described methods.27,28 The rats were anesthetized and swabbed with ethanol. We first prepared a 5-mmdiameter ring with the use of orthodontic ligation wire and used this model to measure and ensure identical defect size, then used dental bur in a slow speed under saline solution irrigation, and finally used periodontal probe to remove bone chip. Two 5.0-mm-diameter defects were created in parietal bone of the skull. Then we prepared collagen gel matrix (Cellmatrix type I-A, Nitta Gelatin Inc.). Mix the following solutions and keep on ice until use: A, Cellmatrix I-A; B, 10 X a-MEM; C, sterile reconstitution buffer (2.2 g NaHCO3 in 100 ml of 0.05 N NaOH and 200 mM HEPES). Mix icecold A, B, and C at a ratio 8:1:1. The order of mixing is very important. After mixing A and B well, add C and mix well again. Then 5 105 cells were suspended in 100 ml collagen solution. This mixture is called the reconstituted collagen solution. Do not make bubbles through the procedure. Then keep the reconstituted collagen solution on ice (4 8C) to prevent gel formation. Then reconstituted collagen solution and collagen gel matrix were filled in the defect, the wounds were closed with 5-0 sutures.
2.12. X-ray detection and grey scale analysis of cranial samples SD rats were anesthetized and fixed with 4% paraformaldehyde by systemic circulation fixation for half an hour and the samples were radiographed with a digital radiographic apparatus (GE Senograph 2000D) under the following conditions: 25 kV, 50 mAs and a distance of 50 cm. Grey scales of the defect regions were then analyzed with specific software (SIEMENS Sidexis).
2.13.
Histomorphometric analysis
The samples were fixed overnight in 4% PFA at 4 8C. To obtain sections, the samples were dehydrated, embedded in paraffin wax, and serially sectioned at 7 mm. Histological sections were stained with haematoxylin and eosin (H&E) to evaluate osteogenesis in the defect regions. The results were visualized by microscopy.
Table 1 – Primers used for real-time PCR. Gene ALP COL I OPN Runx2 GAPDH
Forward primer 50 –30
Reverse primer 50 –30
CCCACAATGTGGACTACCT TCCAACGAGATCGAGATCC TTCCAAGTAAGTCCAACGAAAG CGGAGTGGACGAGGCAAGAG GAGTCAACGGATTTGGTCGT
GAAGCCTTTGGGGTTCTTC AAGCCGAATTCCTGGTCT GTGACCAGTTCATCAGATTCAT TGAGGAATGCGCCCTAAATC TTGATTTTGGAGGGATCTCG
archives of oral biology 59 (2014) 1146–1154
2.14.
Statistical analysis
The data were analyzed using SAS. The statistical analysis was performed by one-way ANOVA. Multiple comparisons were carried out using the Fisher LSD test. Statistical significance was accepted when P values were 0.05), Fig. 4.
3.5.
Fig. 2 – Proliferation of UC-MSCs in 2 D culture. MTT was used to evaluate the proliferation ability of UC-MSCs, and the absorbance of each group was compared at days 3 of the exponential growth phase. Data showed that 10% PRPtreated UC-MSCs had higher proliferative activity than 5% PRP and 10% FBS-treated cells (P < 0.05) (n = 5).
osteogenic genes, including ALP, OPN, RUNX2 and COL-I, was examined by quantitative PCR at 7 days after differentiation. Date showed that ALP and RUNX2 expression in 10% PRP and 5% PRP-treated groups were higher than those in 10% FBStreated group (P < 0.05); COL-I expression in 10% PRP-treated group was higher than that in 10% FBS-treated group. There was no difference between 10% PRP and 5% PRP-treated groups
X-ray analysis
After 3 weeks, no obvious bone structure was observed in UCMSC group, and defect region was rough in PRP + UC-MSC group (Fig. 5A). At 8-week, little bone structure was observed in the margins of the defect regions in UC-MSC group, while high-density regions were observed in PRP + UC-MSC group (Fig. 5B). The relative density of PRP + UC-MSC group showed significantly higher percentage than UC-MSCs group (Fig. 5C).
3.6.
Histological analysis of bone formation
Histological analysis of the calvarial defect regions in each group is shown in Fig. 6. At 3 weeks, H&E staining revealed abundant connective tissue mixed with inflammatory cells in the defect regions, and hardly any new bone formation was observed in the UC-MSCs group (Fig. 6A-a, b). In the PRP + UCMSCs group, abundant connective tissue mixed with inflammatory cells could be still observed in the defects, although new osteoids began to form (Fig. 6A-c, d). At 8 weeks, bone structure formed in the margins of the defect region in the UCMSCs group (Fig. 6B-a). The defects showed good healing, with large areas of osteoid formation in the PRP + UC-MSCs group (Fig. 6B-b).
Fig. 3 – The osteogenic potential of UC-MSCs. (A) Osteogenic potential of UC-MSCs under osteogenic medium. Different groups of ALP staining of UC-MSCs at days 10; matrix mineralization was determined on days 21 by Alizarin red staining (B) The ALP activity was determined at 1 and 2 weeks under normal medium and absorbance measurements at 405 nm were assayed using p-nitrophenyl phosphate (pNPP). The results showed that ALP activities of MSCs in 10% PRP and 5% PRPtreated groups were higher than that in 10%FBS-treated group (n = 3). (C) Co-cultured in osteogenic differentiation medium for 1 week and 2 weeks, ALP activities in 10% PRP and 5% PRP-treated groups were higher than that in 10% FBS-treated group (> , *compared with 10% FBS group; n = 5).
archives of oral biology 59 (2014) 1146–1154
Fig. 4 – Osteoblast-associated gene expression for UC-MSCs. Expression of osteogenic genes, including ALP, COL-I, RUNX2 and OPN were examined by q-PCR at 7 days. Data showed that ALP and RUNX2 expression in 10% PRP and 5% PRP-treated groups were higher than those in 10% FBStreated group (P < 0.05); COL-I expression in 10% PRP-treated group was higher than that in 10%FBS-treated group. There was no difference between 10% PRP and 5% PRP-treated groups for OPN expression compared with 10%FBS-treated group (P > 0.05) (> compared with10% FBS group n = 5).
4.
Discussion
Due to the wide application of stem cells in bone engineering, it is important to identify alternative sources of MSCs that function as well as BMSCs but overcome the limitations of BMSCs.12 In recent years, UC-MSCs have been explored as a source of MSCs, and they have clear advantages over BMSCs.
1151
UC-MSCs isolated from discarded umbilical cords are an inexhaustible alternative cell source for bone repair and reconstruction because of the convenient and noninvasive harvesting procedure.29,30 In addition, UC-MSCs have the ability to differentiate into mesenchymal cell lineages.25,31,32 In our study, UC-MSCs presented a spindle-shaped morphology when cultured in a monolayer. Flow cytometry analysis revealed that UC-MSCs expressed the mesenchymal markers CD105 and the cell adhesion molecules CD29, CD44 and CD90. UC-MSCs could differentiate into certain cell types in conditional media. Moreover, the number of fibroblast colony-forming units is significantly higher in UC-MSCs compared with BMSCs.17 UC-MSCs have a faster proliferation rate in monolayer culture than other adult stem cells18; thus, UCMSCs may provide a larger number of cells in shorter time period to meet the needs of bone tissue engineering. Furthermore, multiple types of growth factors are concentrated in PRP and can be easily and rapidly obtained by centrifugation from whole blood. Thus, PRP may be used in place of FBS as a serum source for MSC cultivation.33 PRP is a promising supplement for ex vivo cell expansion,34 and it has been suggested that PRP could be used as a supplement for ex vivo expansion of MSCs.35,36 Short and long-term proliferation data revealed that PRP enhanced the proliferation of a variety of MSCs derived from bone marrow, adipose tissue and muscle tissue37 and had a potent effect on the proliferation of MSCs, both in the presence and absence of FBS.38 Our study produced a similar result: the proliferative activity of MSCs in the 10% PRP group was higher than that of MSCs in the 5% PRP and 10% FBS groups in monolayer cultures. More importantly, the use of PRP in place of FBS eliminates risks connected with the use of xenogeneic supplements.
Fig. 5 – X-ray analysis of calvarial defect. (A) X-ray image of calvarial defect samples at 3 weeks. No obvious bone structure was observed in UC-MSC group, and defect region was rough in PRP + UC-MSC group (B) X-ray image of calvarial defect samples at 8 weeks. Little bone structure was observed in the margins of the defect regions in UC-MSC group, while highdensity regions were observed in PRP + UC-MSC group (C) The relative density of different groups. PRP + MSCs group showed significantly higher percentage than only MSCs group at 8 weeks (n = 5, $P < 0.05).
1152
archives of oral biology 59 (2014) 1146–1154
Fig. 6 – Histomorphometry analysis of bone formation. (A) Haematoxylin & eosin (H&E) staining was used to evaluate osteogenesis of the defect regions at 3 weeks. (A-a, b) UC-MSCs group showed abundant connective tissue mixed with inflammatory cells in the defects; (A-c, d) PRP + UC-MSCs group showed that connective tissue mixed with inflammatory cells could be still observed in the defects, but new osteoid began to form at the same time. (B) HE staining was used to evaluate the bone regeneration at 8 weeks. (B-a) bone structure was observed in the margins of the defect region in the UCMSCs group, (B-b) good healing with large areas of osteoid formation in the PRP + UC-MSCs group (scale bar = 200 mm).
In our previous study, UC-MSCs showed good potential for bone tissue engineering; however, only minimal bone structure was observed in the margins of the defect region in the UC-MSC-based bone tissue regeneration experiment. Thus, we aimed to identify a new method to improve the effectiveness of UC-MSCs used in bone tissue engineering. Fortunately, PRP contains both scaffolds and growth factors, which are other important aspects of tissue engineering. It was found that when these growth factors are released from platelet lysate, MSC expansion is enhanced in vitro36,39; this finding was also confirmed by our study. PRP has been applied for the promotion of bone healing and developed as a novel material for bone regeneration. PRP obtained from patients can be used as a source of autologous growth factors for the repair of various tissues. PRP has the advantage of being a growth factor concentrate, and it contains growth factors at the proportions necessary for aiding the healing process of tissue injuries. In addition to being autologous in nature, PRP has recently been combined with MSCs for tissue regeneration and has been used as a PRP-gel delivery vehicle for cells during transplantation.40,41 When co-administered with MSCs, platelet gel can improve bone formation in animal models,42 therefore posing no risk of disease transmission or immunogenic reaction; additionally, platelet gel can be used to treat periodontal
defects and in maxillofacial reconstructive surgery.43 The potential of using PRP directly to accelerate the healing of tissue injuries has also been expanded. Moreover, UC-MSCs exhibit bone regeneration potential with strong expression of specific osteogenic markers in vitro.13 In the present study, our data showed that cells treated with 10% PRP exhibited the strongest ALP and Alizarin red staining, and osteogenic genes, including ALP, COL-1 and RUNX2 showed higher expression at early stage in these cells. These results indicate that PRP could enhance the osteogenic ability of UC-MSCs in vitro. PRP retained and improved the differentiation of UC-MSCs and the capacity for in vivo bone formation in a setting that is adaptable to autogenous use.27 PRP-expanded cells also maintained their osteogenic differentiation capacity. Meanwhile, when co-cultured in osteogenic differentiation medium, PRP enhanced the activities of ALP. Recent studies have suggested positive, synergistic effects of MSCs and PRP mixtures in enhancing bone formation in the oral and maxillofacial regions.44,45 PRP was confirmed to improve bone healing in a rabbit model of diaphysis. The areas of bone formation were larger in areas adjacent to the bone resection areas and towards the intact ulna.46 Previous studies support the use of PRP for bone healing as an off-the-shelf therapy. Our study showed that when transplants were combined with a
archives of oral biology 59 (2014) 1146–1154
PRP and UC-MSC mixture, calvarial defects presented good healing with large areas of osteoid formation. Our data suggest that PRP could be used as a supplement for the expansion of UC-MSCs in place of FBS. To the best of our knowledge, this is the first study to demonstrate the efficacy PRP for the expansion and osteogenic induction of UC-MSCs. The use of PRP for UC-MSC expansion has the potential to reduce the cost of cell culture and increase the safety of this cell-based protocol because both PRP and UC-MSCs can be collected autologously or, under well-controlled conditions, allogeneically. In addition, osteogenic induction may be due to a direct effect of the platelet gel on local recruitment of osteoprogenitors. These results may indicate that UC-MSCs have a good potential for use in bone tissue engineering. Moreover, liquid PRP and UC-MSCs could be applied by injection and grafted in a minimally invasive way. If this method can be applied in the clinic, it will serve as a new type of bioremediation agent for use in bone defect regeneration.
5.
Conclusions
Our data suggest that UC-MSCs may serve as alternative mesenchymal stem cells in the reconstruction and regeneration of bone defects, and the UC-MSCs/PRP combination can be used effectively for bone tissue engineering. The PRP-gel delivery vehicle can be applied to cells during transplantation.
Funding This work was supported by grants from the National Natural Science Foundation of China (Grant No. 81300885), China Postdoctoral Science Foundation Funded Project (Grant No. 2013M531618), Independent Innovation Foundation of Shandong University, IIFSDU (Grant No. 2012GN048), Shandong Pharmaceutical and Health Science Technology Development Programme (Grant No. 2013WS0212) and Shandong Provincial Natural Science Foundation, China (Grant Nos. ZR2013HQ052 and ZR2013HM086).
Competing interests None declared.
Ethical approval The experimental protocol was approved by the Institutional Animal Care and Use Committee (School of Stomatology, Shandong University, Jinan, PR China) protocol number 2012-16.
references
1. Chimutengwende-Gordon M, Khan WS. Advances in the use of stem cells and tissue engineering applications in bone repair. Curr Stem Cell Res Ther 2012;7:122–6.
1153
2. O’Keefe RJ, Mao J. Bone tissue engineering and regeneration: from discovery to the clinic – an overview. Tissue Eng B Rev 2011;17:389–92. 3. Montjovent MO, Burri N, Mark S, Federici E, Scaletta C, Zambelli PY, et al. Fetal bone cells for tissue engineering. Bone 2004;35(6):1323–33. 4. Kasten P, Vogel J, Geiger F, Niemeyer P, Luginbuhl R, Szalay K. The effect of platelet-rich plasma on healing in criticalsize long-bone defects. Biomaterials 2008;29(29):3983–92. 5. Rose FR, Oreffo RO. Bone tissue engineering: hope vs hype. Biochem Biophys Res Commun 2002;292(1):1–7. 6. Bianco P, Riminucci M, Gronthos S, Robey PG. Bone marrow stromal stem cells: nature, biology, and potential applications. Stem Cells 2001;19(3):180–92. 7. Kon E, Muraglia A, Corsi A, Bianco P, Marcacci M, Martin I, et al. Autologous bone marrow stromal cells loaded onto porous hydroxyapatite ceramic accelerate bone repair in critical-size defects of sheep long bones. J Biomed Mater Res 2000;49(3):328–37. 8. Petite H, Viateau V, Bensaid W, Meunier A, de Pollak C, Bourguignon M, et al. Tissue-engineered bone regeneration. Nat Biotechnol 2000;18(9):959–63. 9. Quarto R, Mastrogiacomo M, Cancedda R, Kutepov SM, Mukhachev V, Lavroukov A, et al. Repair of large bone defects with the use of autologous bone marrow stromal cells. N Engl J Med 2001;344(5):385–6. 10. Mueller SM, Glowacki J. Age-related decline in the osteogenic potential of human bone marrow cells cultured in threedimensional collagen sponges. J Cell Biochem 2001;82(4):583–90. 11. Lee SY, Miwa M, Sakai Y, Kuroda R, Matsumoto T, Iwakura T, et al. In vitro multipotentiality and characterization of human unfractured traumatic hemarthrosis-derived progenitor cells: a potential cell source for tissue repair. J Cell Physiol 2007;210(3):561–6. 12. Wang HS, Hung SC, Peng ST, Huang CC, Wei HM, Guo YJ, et al. Mesenchymal stem cells in the Wharton’s Jelly of the human umbilical cord. Stem Cells 2004;22(7):1330–7. 13. Zuk PA, Zhu M, Ashjian P, De Ugarte DA, Huang JI, Mizuno H, et al. Human adipose tissue is a source of multipotent stem cells. Mol Biol Cell 2002;13(12):4279–95. 14. Williams JT, Southerland SS, Souza J, Calcutt AF, Cartledge RG. Cells isolated from adult human skeletal muscle capable of differentiating into multiple mesodermal phenotypes. Am Surg 1999;65(1):22–6. 15. De Coppi P, Bartsch Jr G, Siddiqui MM, Xu T, Santos CC, Perin L, et al. Isolation of amniotic stem cell lines with potential for therapy. Nat Biotechnol 2007;25(1):100–6. 16. Lee OK, Kuo TK, Chen WM, Lee KD, Hsieh SL, Chen TH. Isolation of multipotent mesenchymal stem cells from umbilical cord blood. Blood 2004;103(5):1669–75. 17. Lu LL, Liu YJ, Yang SG, Zhao QJ, Wang X, Gong W, et al. Isolation and characterization of human umbilical cord mesenchymal stem cells with hematopoiesis-supportive function and other potentials. Haematologica 2006;91(8):1017–26. 18. Troyer DL, Weiss ML. Wharton’s Jelly-derived cells are a primitive stromal cell population. Stem Cells 2008;26(3):591–9. 19. Boyapati L, Wang HL. The role of platelet-rich plasma in sinus augmentation: a critical review. Implant Dent 2006;15(2):160–70. 20. Tozum TF, Demiralp B. Platelet-rich plasma: a promising innovation in dentistry. J Can Dent Assoc 2003;69(10):664. 21. Hosgood G. Wound healing: the role of platelet-derived growth factor and transforming growth factor beta. Vet Surg 1993;22(6):490–5. 22. Bolander ME. Regulation of fracture repair by growth factors. Proc Soc Exp Biol Med 1992;200(2):165–70. 23. Kitoh H, Kitakoji T, Tsuchiya H, Katoh M, Ishiguro N. Transplantation of culture expanded bone marrow cells and
1154
24.
25.
26.
27.
28.
29.
30.
31.
32.
33.
34.
35.
archives of oral biology 59 (2014) 1146–1154
platelet rich plasma in distraction osteogenesis of the long bones. Bone 2007;40(2):522–8. Smith SE, Roukis TS. Bone and wound healing augmentation with platelet-rich plasma. Clin Podiatr Med Surg 2009;26(4):559–88. Sarugaser R, Lickorish D, Baksh D, Hosseini MM, Davies JE. Human umbilical cord perivascular (HUCPV) cells: a source of mesenchymal progenitors. Stem Cells 2005;23(2):220–9. Han J, Meng HX, Tang JM, Li SL, Tang Y, Chen ZB. The effect of different platelet-rich plasma concentrations on proliferation and differentiation of human periodontal ligament cells in vitro. Cell Prolif 2007;40(2):241–52. Schmitz JP, Hollinger JO. The critical size defect as an experimental model for craniomandibulofacial nonunions. Clin Orthop Relat Res 1986;205:299–308. Cowan CM, Shi YY, Aalami OO, Chou YF, Mari C, Thomas R, et al. Adipose-derived adult stromal cells heal critical-size mouse calvarial defects. Nat Biotechnol 2004;22(5):560–7. Wang L, Tran I, Seshareddy K, Weiss ML, Detamore MS. A comparison of human bone marrow-derived mesenchymal stem cells and human umbilical cord-derived mesenchymal stromal cells for cartilage tissue engineering. Tissue Eng A 2009;15(8):2259–66. Hou T, Xu J, Wu X, Xie Z, Luo F, Zhang Z, et al. Umbilical cord Wharton’s Jelly: a new potential cell source of mesenchymal stromal cells for bone tissue engineering. Tissue Eng A 2009;15(9):2325–34. Ma L, Feng XY, Cui BL, Law F, Jiang XW, Yang LY, et al. Human umbilical cord Wharton’s Jelly-derived mesenchymal stem cells differentiation into nerve-like cells. Chin Med J (Engl) 2005;118(23):1987–93. Baksh D, Yao R, Tuan RS. Comparison of proliferative and multilineage differentiation potential of human mesenchymal stem cells derived from umbilical cord and bone marrow. Stem Cells 2007;25(6):1384–92. Goedecke A, Wobus M, Krech M, Munch N, Richter K, Holig K, Bornhauser M. Differential effect of platelet-rich plasma and fetal calf serum on bone marrow-derived human mesenchymal stromal cells expanded in vitro. J Tissue Eng Regen Med 2011;5(8):648–54. Shahdadfar A, Fronsdal K, Haug T, Reinholt FP, Brinchmann JE. In vitro expansion of human mesenchymal stem cells: choice of serum is a determinant of cell proliferation, differentiation, gene expression, and transcriptome stability. Stem Cells 2005;23(9):1357–66. Bieback K, Hecker A, Kocaomer A, Lannert H, Schallmoser K, Strunk D, et al. Human alternatives to fetal bovine serum for the expansion of mesenchymal stromal cells from bone marrow. Stem Cells 2009;27(9):2331–41.
36. Doucet C, Ernou I, Zhang Y, Llense JR, Begot L, Holy X, et al. Platelet lysates promote mesenchymal stem cell expansion: a safety substitute for animal serum in cell-based therapy applications. J Cell Physiol 2005;205(2):228–36. 37. Kocaoemer A, Kern S, Kluter H, Bieback K. Human AB serum and thrombin-activated platelet-rich plasma are suitable alternatives to fetal calf serum for the expansion of mesenchymal stem cells from adipose tissue. Stem Cells 2007;25(5):1270–8. 38. Li H, Usas A, Poddar M, Chen CW, Thompson S, Ahani B, et al. Platelet-rich plasma promotes the proliferation of human muscle derived progenitor cells and maintains their stemness. PLOS ONE 2013;8(6):e64923. 39. Capelli C, Domenghini M, Borleri G, Bellavita P, Poma R, Carobbio A, et al. Human platelet lysate allows expansion and clinical grade production of mesenchymal stromal cells from small samples of bone marrow aspirates or marrow filter washouts. Bone Marrow Transplant 2007;40(8):785–91. 40. Kasten P, Vogel J, Luginbuhl R, Niemeyer P, Weiss S, Schneider S, et al. Influence of platelet-rich plasma on osteogenic differentiation of mesenchymal stem cells and ectopic bone formation in calcium phosphate ceramics. Cells Tissues Org 2006;183(2):68–79. 41. Niemeyer P, Fechner K, Milz S, Richter W, Suedkamp NP, Mehlhorn AT, et al. Comparison of mesenchymal stem cells from bone marrow and adipose tissue for bone regeneration in a critical size defect of the sheep tibia and the influence of platelet-rich plasma. Biomaterials 2010;31(13):3572–9. 42. Liu Y, Zhou Y, Feng H, Ma GE, Ni Y. Injectable tissueengineered bone composed of human adipose-derived stromal cells and platelet-rich plasma. Biomaterials 2008;29(23):3338–45. 43. Lekovic V, Camargo PM, Weinlaender M, Vasilic N, Kenney EB. Comparison of platelet-rich plasma, bovine porous bone mineral, and guided tissue regeneration versus platelet-rich plasma and bovine porous bone mineral in the treatment of intrabony defects: a re-entry study. J Periodontol 2002;73(2):198–205. 44. Yamada Y, Boo JS, Ozawa R, Nagasaka T, Okazaki Y, Hata K, et al. Bone regeneration following injection of mesenchymal stem cells and fibrin glue with a biodegradable scaffold. J Craniomaxillofac Surg 2003;31(1):27–33. 45. Yamada Y, Ueda M, Naiki T, Nagasaka T. Tissue-engineered injectable bone regeneration for osseointegrated dental implants. Clin Oral Implants Res 2004;15(5):589–97. 46. Kim YH, Furuya H, Tabata Y. Enhancement of bone regeneration by dual release of a macrophage recruitment agent and platelet-rich plasma from gelatin hydrogels. Biomaterials 2014;35(1):214–24.
