Plant MolecularBiology 12: 655-666, 1989. © 1989 KluwerAcademic Publishers.Printedin Belgium.

655

Plastocyanin is encoded by a single-copy gene in the pea haploid genome David I. Last ~ and John C. Gray* Botany School, University of Cambridge, Downing Street, Cambridge CB2 3EA, UK (* author for correspondence); 1Present address: CSIR O Division of Plant Industry, Canberra, A C T 2601, Australia Received 12 December 1988; accepted in revised form 14 February 1989

Key words: chloroplast, presequence, promotor, light-responsive element, Z - D N A

Abstract

c D N A clones for pea plastocyanin were isolated from a pea leaf c D N A library screened with a 3Zp-labelled mixed oligonucleotide probe predicted from part of the N-terminal amino acid sequence of pea plastocyanin. The six c D N A clones isolated were found to be identical in the regions in which they overlapped. A Southern blot of restricted pea D N A probed with one of these c D N A clones showed the pea plastocyanin gene to exist as a single copy in the haploid genome. A pea genomic library in 2EMBL3 screened with the same c D N A clone gave three positive plaques which contained identical 16 kbp Bam HI fragments. A single uninterrupted plastocyanin gene was located near the middle of the fragment and was characterised by D N A sequencing. The derived amino acid sequence indicates that the plastocyanin precursor consists, of 168 amino acid residues including a presequence of 69 amino acid residues. The transcription initiation site was located by S 1 nuclease mapping approximately 50 bp upstream of the translation initiation site. A sequence similar to a consensus light-responsive element found in a large number of phytochrome-dependent light-inducible genes is located just upstream of the TATA box. A cluster of direct repeats containing potential Z-DNA-forming elements occurs 600-750 bp upstream of the transcription initiation site.

Introduction

Plastocyanin is a 10.5 kDa copper-containing protein found in the thylakoid lumen of chloroplasts where it plays an essential role in photosynthetic electron transfer [6]. Plastocyanin is encoded in the nucleus and synthesised on cytosolic ribosomes as a precursor with an N-terminal transit peptide which is proteolytically removed during import of the protein into chloroplasts [ 16]. A Silenepratensis c D N A clone encoding the complete plastocyanin precursor has been characterised [39] and the deduced amino acid se-

quence suggests that the transit peptide is composed of a chloroplast import domain and a thylakoid transfer domain. Following import of the precursor into chloroplasts the amino-terminal domain of the transit peptide is removed by a stromal protease [34] and the resulting intermediate form is then imported into the thylakoid lumen where it is processed to the mature size by a second protease [ 18, 24]. A similar two-domain structure of the plastocyanin transit sequence is suggested by the nucleotide sequences of the plastocyanin genes from spinach [35] and Arabidopsis thaliana [49].

656 Plastocyanin is present in small amounts in etiolated bean seedlings and its accumulation is greatly stimulated on illumination [20]. Plastocyanin synthesis was stimulated by red light and this stimulation was reversed by subsequent illumination with far-red light, indicating the involvement of phytochrome in the control of plastocyanin synthesis [20]. Takabe et aL [43] found using Western blotting that the amount of the plastocyanin polypeptide (per unit fresh weight) increased about 30-fold during a 72-hour greening period in pea, wheat and barley. In contrast the amount of plastocyanin active in electron transfer (per unit fresh weight) in barley seedlings has been found to remain constant during greening [33], perhaps suggesting a post-translational regulation of the amount of the plastocyanin holoprotein. In Chlamydomonas reinhardtii plastocyanin accumulation is controlled at a post-transcriptional level by the availability of copper [28, 52]. The isolation of e D N A and genomic clones for pea plastocyanin, described here, will facilitate an investigation of the regulation of expression of a higher plant plastocyanin gene. The sequence of the pea plastocyanin transit peptide is discussed with regard to current theories on targeting of proteins to chloroplasts. The upstream region of the gene contains repeated elements which may possibly participate in the regulation of transcription. Materials and methods Growth of plants

Peas (Pisum sativum cv. Feltham First) were grown in Levington Compost (Fison's, Harlton, Cambridge, UK) in an ambient temperature of 15-20 ° C in a glasshouse with supplementary artificial lighting providing a photosynthetically active irradiance of 150 #mol photons m - 2 s - 1 on a 16 h photoperiod.

were replaced by a gel filtration column of Sephadex G-100, 2.5 x 84 cm, equilibrated and run in 20 m M sodium phosphate pH 6.9. The yield of plastocyanin from 1 kg pea leaves was 10 mg (taking the molar extinction coefficient at 597 nm as 4900 and the relative molecular mass as 10 500) with a n A280/A597oxidise d of 1.3. Antibodies to purified pea plastocyanin were raised in a New Zealand White rabbit by a course of intramuscular injections of 0.5 mg of protein dissolved in 0.5 ml water emulsified with an equal volume of Freund's complete adjuvant. Blood samples (25 ml) were taken 13 days after each injection and were incubated at 37 °C for 1 h to allow clotting to take place after which the samples were centrifuged at 10000g for 10min. A "preimmune serum" was also prepared in the same way from 25 ml blood taken from the rabbit prior to the course of injections. RNA methods

R N A was extracted from pea shoots according to Thompson et al. [45] with the additional purification steps of precipitation from 3 M sodium acetate and passage through a column of Sigmacell 100. The Sigmacell 100 was autoclaved in 0 . 1 M N a O H and used to form a 2 x 3 c m column equilibrated in 0 . 5 M N a C I , 1 0 m M Tris-HCl pH 8.0, 1 m M EDTA.Na2. Poly(A) + R N A was selected on a 1 x 2 c m column of oligo-dT cellulose (Sigma) and translated in a micrococcal nuclease-treated rabbit reticulocyte lysate [22] in the presence of L-[ 35 S ]methionine. Immunoprecipitations were carried out as described by Howe et al. [21 ]. Translation products were separated by electrophoresis in a polyacrylamide gel containing SDS [26] and detected by fluorography [5]. Northern blotting was carried out using the method of Thomas [44] and S 1 nuclease analysis was performed using a combination of the methods of Berk and Sharp [4] and Weaver and Weissmann [51].

Protein methods cDNA library construction and screening

Plastocyanin was purified by a modification of the method of Plesnicar and Bendall [32] in which the second and third DEAE-cellulose columns

Double-stranded c D N A was synthesised by the method of Gubler and Hoffman [17] and was

657 rendered blunt-ended by the action of T4 DNA polymerase in the presence of all four dNTPs. Blunt-ended ds cDNA was ligated into Sma I-cut Eco K selection vector, M13K8.2 [50]. Ligations were carried out for 4 h at 25 °C and the ligated DNA was used to transfect Escherichia coli JM101 [29] by the method of Hanahan [19}. DNA from bacteriophage plaques was transferred to nylon membranes (Biodyne, Pall) according to the manufacturer's instructions for bacteriophage 2 except that the lysis and neutralisation steps were omitted. The membranes were screened by hybridisation with an oligonucleotide probe which had been end-labelled with ~[32p]ATP by the action of bacteriophage T4 polynucleotide kinase. Oligonucleotide synthesis was carried out using an Omnifit bench synthesiser. Up to four successive screenings were used to purify positive plaques to homogeneity. Positive M13 clones were identified directly by DNA sequencing [36]. Further cDNA clones were identified by screening the cDNA library with the isolated cDNA fragment of the first clone to be obtained (M13PC1). Genomic DNA methods

DNA was isolated from destarched pea shoots according to the procedure of Domoney and Casey [ 11 ] using two sequential CsC1 gradients. The Southern blot of restricted total DNA [41] was probed with the isolated cDNA fragment of M13PC1 labelled with 32p using the method of Feinberg and Vogelstein [12]. A copy number reconstruction was based on a value of 4.9 pg as the mass of the pea haploid genorne [28]. To produce a genomic library pea genomic DNA was digested to completion with Barn HI and ligated with 2EMBL3 DNA [14] which had been digested with Barn HI and treated with calf intestinal phosphatase to remove 5 r phosphates. The ligated DNA was packaged and used to infect Escherichia coli K803 [53] as described by Maniatis et al. [27] to give a genomic library of 4 × 105 plaques. The plaques were screened by nucleic acid hybridisation with the 32p-labelled cDNA fragment of M13PC1 using a method based on that of Benton and Davis [3].

Restriction mapping and DNA sequencing

DNA fragments longer than 400 bp were cut at internal restriction sites and subcloned into M13 vectors mpl8 and m p l 9 [54] for sequence analysis [36, 37]. Both the 16 kbp Barn HI genomic insert and the internal 3.5 kbp Eco RI fragment were cloned in pUC18 [54] for restriction mapping. Results

Identification of pre-plastocyanin synthesised in vitro

Pea poly(A) ÷ RNA translated in a micrococcal nuclease-treated rabbit reticulocyte lysate in the presence of L-[35S]methionine yielded translation products of up to 50 kDa. Antibodies to purified pea plastocyanin immunoprecipitated a major product of 22 kDa, approximately the same size as the pre-plastocyanin described by Grossman et al. [16]. The immunoprecipitation of this 35S-labelled polypeptide did not occur in the presence of excess unlabelled pea plastocyanin or when the preimmune serum was substituted for immune serum (Fig. 1), suggesting that the 22 kDa polypeptide was the pea plastocyanin precursor. The polypeptides of 40 kDa and 15 kDa precipitated in the presence of excess unlabelled pea plastocyanin (Fig. 1, track D) may represent basic proteins with an affinity for the large amount of plastocyanin added to the incubation prior to immunoprecipitation.

cDNA clones

A cDNA library of 6 x 10 4 recombinant M13 plaques was generated from 0.75 #g of doublestranded cDNA produced from the pea leaf poly(A) + RNA used above. The library was screened by nucleic acid hybridisation with an oligonucleotide probe predicted from part of the N-terminal amino acid sequence of pea plastocyanin [6]. A mixture of 64 oligodeoxynucleotides was synthesised representing all the possible DNA sequences which could encode the se-

658 Five more positive clones were identified. All six clones had identical nucleotide sequences where they overlapped, suggesting that they originated from the same m R N A species. The plastocyanin m R N A was analysed by hybridisation of the c D N A fragment of M13PC1 to a Northern blot of total pea leaf RNA (Fig. 2). The pea plastocyanin m R N A migrated as a single band of 900 bases.

Fig. 1. Detection of pre-plastocyanin in a translation of pea poly(A) ÷ R N A in vitro. Fluorograph of an SDS-polyacrylamide gel of translation products produced in vitro by incubation of pea poly(A) ÷ RNA with L-[35S]methionine in a rabbit reticulocyte lysate. A. Total products. Tracks B, C and D contain products immunoprecipitated in the presence of: B, pre-immune serum; C, antiserum to pea plastocyanin; D, antiserum to pea plastocyanin + 10/~g pea plastocyanin.

quence Phe-Lys-Asn-Asn-Ala-Gly. The synthetic oligonucleotides had the sequence 5'-CCNGCRTTRTTYTTRAA-3'. Screening the c D N A library with the mixed oligonucleotide probe yielded one positive plaque, M13PC1. Singlestranded M13PC1 D N A was prepared from an infected culture of Escherichia coli and used as a template for D N A sequencing. The c D N A insert was found to contain a sequence of 418 bp which encoded the published N-terminal sequence of pea plastocyanin (see Fig. 5). A large-scale RF D N A preparation of M 13PC1 was prepared and the c D N A fragment was isolated for use as a hybridisation probe to rescreen the c D N A library.

Fig. 2. Northern blot of total pea leaf RNA probed with a pea plastocyanin eDNA. The isolated e D N A fragment from M13PC1 was labeled with ~2p and used to probe for the mRNA for pre-plastocyanin in total pea leaf RNA. The result is shown in track A. Track M contains size-markers of bacteriophage 2 D N A cut with Sty I and end-labelled with 32p.

659 Determination of the plastocyanin gene copy number

Aliquots containing 10/~g of pea total DNA were digested for 5 hours with Eco RI, Bam HI or Hind III (200 units in each case) and subjected to electrophoresis in an agarose gel for 16 h at 80 V. Copy number standards of M13PC1 RF DNA, linearised with Bam HI, in quantities corresponding with 0.5, 1, 2, 4 and 8 gene copies per haploid (1C) genome were included on the gel. A Southern blot of the fragments was probed with the isolated cDNA fragment of M13PC1. The result is shown in Figure 3A. A single band occurs in each track of digested pea DNA corresponding

to fragments of DNA of 16, 3.5 and 5.0 kbp for Bam HI, Eco RI and Hind III respectively. This suggests that the pea plastocyanin gene occurs as a single copy and that it does not contain any sites for these three enzymes within the region which hybridises to M 13PC1. Further evidence that the gene exists as a single copy in the haploid genome is provided by a comparison of the intensities of the bands in pea DNA tracks with those in the copy number standard tracks. Of these, the track which corresponds to 1 gene copy per haploid genome contains the band which is closest in intensity to the bands in pea DNA tracks.

Genomic clones

Fig. 3. Determination of the plastocyanin gene copy number by Southern blotting. A. The isolated cDNA fragment from M13PC1 was labelled with 32p and used to probe a Southern blot of total pea DNA cut with Barn HI (track A), Eco RI (track B) and Hind III (track C). Each track contained 10/2g of restricted DNA. Tracks D, E, F, G and H contain 10, 20, 40, 80 and 160 pg M13PCI DNA linearised with Bam HI, equivalent to 0.5, 1, 2, 4 and 8 gene copies per haploid genome. B. Southern blot of fragments of genomic clone probed with M 13PCI. DNA was prepared from the genomic clone 2GPC3 and small samples (20 ng) were cut with Eco RI and Barn HI before being subjected to electrophoresis in a 0.8 % agarose gel. A Southern blot was prepared from the gel and probed with the 32p-labelled cDNA fragment of M13PC1. The autoradiograph of the blot reveals the presence of a 16 kbp Bam HI fragment and a 3.5 kbp Eco RI fragment as seen in the whole genome blot (A).

As it had been found that the pea plastocyanin gene was located on a Bam HI fragment of 16 kbp, a pea genomic library in 2EMBL3 [ 14] was constructed using total pea DNA digested to completion with Bam HI. This library should be enriched in Bam HI fragments in the optimum size range (15-20 kbp) for packaging in vitro and should include the 16kbp Bam HI fragment carrying the plastocyanin gene. A library of 4 x 105 plaques was screened by nucleic acid hybridisation with the isolated cDNA fragment of M13PC1. Four positive clones were detected, three of which were isolated and analysed further. DNA was prepared from each of them and digested with Barn HI and Eco RI. A Southern blot of restricted DNA from all the three clones revealed the 16 kbp Barn HI fragment and the 3.5 kbp Eco RI fragment first detected in the genomic Southern blot (Fig. 3B). To facilitate restriction mapping, the 16 kbp Barn HI fragment and the 3.5 kbp Eco RI fragment of one of the clones, 2GPC3, were each subcloned into pUC18 to give pBGPC1 and pEGPC1 respectively. Internal fragments of the 3.5 kbp Eco RI fragment were cloned into M13 for sequence analysis. Figure 4 shows the location of the plastocyanin gene and the 3.5 kbp Eco RI fragment within the 16 kbp Barn HI fragment. The sequencing strategy used is also shown. The DNA sequence of the gene with 812bp of upstream non-coding se-

660

E

o

=

=

-7

o

o

E o

LU

Ill

=0 I

!

_

=

,v

o I

= I

o

II

J

Z

--.~ I

J

=

-~

[

!

Synthesis of pea pre-plastocyanin in vitro

Z

I

I

U 0

r 200bp

\

Located 31-38 bp upstream of the putative transcription start site is the sequence TATAAAAT which presumably constitutes part of the promoter for the plastocyanin gene. Tobacco total RNA did not give any protection of the probe, suggesting considerable sequence divergence in this region of the pea and tobacco plastocyanin genes.

7

/

Fig. 4. Restriction map of the pea genomic insert of 2GPC3 showing the position of the plastocyanin gene. The solidheaded arrows indicate the PC coding sequence and the direction of transcription. The sequencing strategy is given by arrows which show the direction and extent of sequence reading rather than the full length of each cloned fragment.

quence is shown in Figure 5. This uninterrupted gene encodes a precursor of 168 amino acid residues comprising a mature protein of 99 residues with a transit peptide of 69 residues. The derived mature N-terminal sequence is identical with that obtained by N-terminal protein sequencing [7].

S1 nuclease mapping of the transcription start site A 630 base Hind III-Nhe I restriction fragment covering part of the coding region of the genomic clone with 444 bases of upstream sequence was hybridised with pea poly(A) ÷ RNA and analysed by S 1 mapping. Figure 6 shows that the largest protected fragment is 243 bases long. There are several other protected fragments which are only a few bases shorter. Taking the size of the protected fragment as 243 bases gives a putative transcription start site at about - 53 as shown in Fig. 5 assuming that there is no posttranscriptional processing of the 5' end of the mRNA.

!

As the plastocyanin gene had no introns it was possible to investigate whether a genomic clone (2GPC3) was able to direct the synthesis of a normal plastocyanin precursor in vitro. A genomic fragment containing the whole coding sequence of the precursor without any upstream start codons was excised with Dra III and Hinc II and endrepaired with T4 D N A polymerase. The bluntended molecule was cloned into the Hinc II site of pSP65 and a clone (pPSPC1) with the fragment in the correct orientation was selected after restriction mapping of small-scale D N A isolations using Nhe I and Barn HI. RNA was transcribed from the insert of pPSPC1 using SP6 RNA polymerase and translated in a wheat germ extract in the presence of L-[35S]methionine. The translation products were analysed by gel electrophoresis in the presence of SDS and fluorography of the gel (Fig. 7). The genomic clone was seen to direct the synthesis of a product which co-migrated with Silene pre-plastocyanin and was precipitated by an antiserum to pea plastocyanin. In Fig. 7 the bands running ahead of pre-plastocyanin in both the pea and Silene tracks probably result from initiation of translation at A U G codons within the coding region. The lower molecular weight band in track p (total products from pPSPC1) also appears in track i (immunoprecipitated products) showing that it is a product of translation in the correct reading frame. It probably results from initiation of translation at the methionine codon within the transit peptide. The bases close to this A U G make it a suitable translation initiator according to the modified scanning ribosome model of Kozak [25].

661 -800 -750 CGTTCATACAATAGTGTAGAATTGGACATATGCAACTTAGAACGTGCACTCGCGGAGGATiGGACGTGTG~AACTTACAACGTACGCATTGTT~GTTCATACAAT A • D -700 -650 -600 GTGTAGAATTGGAGATGTGCAACTTACAACATGTGCAACTTACAACGTGCGCTCGCGGAGGAATGTGAAGTTGAACACGTACAAACTTACGTCATTTGTGCATGCAGAAGCATAGAGCT

A

• ~-550 -500 GAGCACACAATTCATAATTTGAAGGACACATGATTTGCTATAAAGAACTCTTTAGAAGTACCACAACTTTGACTGAGTTTGATATAGCTAATAAAGATGGAGCTCATTATAATTTGAAT -450 -400 GGCATAATGCAAC.CTAAACGAA•AAGCTTAGTTAATCATGTTAAACAACAATTCTTTGTAATAATAAAATTGTCTTTCAACTAGTCCAAGTTTATGAGTTGATTCTTCGGAATAAATTA

-300 -250 G~dx-zk~TATCTTAGATTTTATACTTCATTGATTATTTCATAGAGCAAGTAGGAG/~T/~TATACTAGTATTATTTACT~J~d~TCT/~G~CACGTCGGAGGAT/~CAT~/~C -200 -150 CCAGCCAATCACAGCAATGTTCATCAGATAACCCACTTTAAGCCCACGCACTCTGTGGCACATCTACATTATCTAAATCACATATTCTTCCACACATCTTAGCCACACAAAAACCCAAT -100 -50 -1 1 Met Ala CCAcATCTTTATCAT•cATTCTATAAAATCAc•TTCTGTGTGT•TCTCTTTCGATTCC•TTCAAAcACATACAAATTCAGTAGAGAAGAAACTCATTAcT•TTGAGAAAAA ATG GCC

40 50 60 70 80 90 20 30 i0 Thr Val Thr Ser Thr Thr Val Ala Ile Pro Ser Phe Ser Gly Leu Lys Thr Ash Ala Ala Thr Lys Val Ser Ala Met Ala Lys Ile Pro ACA GTC ACT TCC ACC ACC GTT GCT ATT CCA TCA TTC TCA GGC CTT AAG ACA AAC GCA GCA ACT AAA GTT AGT GCC ATG GCT AAG ATT CCA

130 140 150 160 170 180 ii0 120 i00 Thr Ser Thr Ser Gln Set Pro Arg Leu Cys Val Arg Ala Ser Leu Lys Asp Phe Gly Val Ala Leu Val Ala Thr Ala Ala Ser Ala Val ACT TCA ACT TCC CAA TCG CCA AGG CTT TGT GTG AGA GCT TCA CTC AAA GAC TTT GGA GTT GCT CTT GTT GCC ACT GCT GCA AGT GCA GTG 200 210 220 230 240 250 260 270 190 Leu Ala Ser Asn Ala Leu Ala Val Glu Val Leu Leu Gly Ala Ser A s p Gly Gly Leu Ala Phe Val Pro Ser Ser Leu Glu Val Ser Ala C T A G C T AGC AAT GCC TTG GCT GTT GAG GTT TTG CTT GGT GCC AGT GAT GGG GGT TTG GCT TTT GTT CCA AGC AGT TTG GAA GTG AGC GCT 290 300 310 320 330 340 350 360 280 Gly Glu Thr Ile Val Phe Lys Asn Asn Ala Gly Phe Pro His Asn Val Val Phe Asp Glu Asp Glu Ile Pro Ala Gly Val Asp Ala Set G G A G A G ACC ATT GTA TTC AAG AAC AAT C42T GGT TTT CCT CAC AAT GTT GTC TTT GAT GAA GAC GAG ATT CCT GCT GGG GTT GAT GCA TCG 400 410 420 430 440 450 380 390 370 Lys Ile Ser Met Pro Glu Glu Asp Leu Leu Asn Ala Pro Gly Glu Thr Tyr Ser Val Lys Leu Asp Ala Lys Gly Thr Tyr Lys Phe Tyr AAA ATT TCC ATG CCT GAA GAA GAT CTT CTC AAT GCG CCT GGT GAG ACT TAC AGC GTC AAG TTG GAT GCT AAG GGT ACC TAC AAA TTC TAC 490 500 550 480 470 460 Cys Ser Pro His Gln Gly Ala Gly Met Val Gly Gln Val Thr Val Asn ... TGC TCA CCT CAC CAA GGA GCT GGT ATG GTT GGA CAA GTC ACT GTT AAT TAA ATTATAATGCTTTGTCTCCTCTTTATAATATGGTTTGTTCATGTTAATTTT 600 650 GTTCTTGTTGAAGAC-CTTAATTAATCGTTGTTGTTATGGAATACTATTGTATGAGATGAACTTGTGTAATAATGTAATTCATTTACTTCAGTGGAGTCAGAATGTTTTCCGCCGTATAT

ATACCATGCAATGCAT

Fig. 5. Nucleotide sequence of the gene for pea plastocyanin. The sequence from genomic clone 2GPC3 shows the coding region of the pea plastocyanin precursor and 812 bp of upstream non-coding sequence. The numbering of nucleotides starts at + 1 for the "A" of the initiator methionine codon of the transit peptide. Nucleotides upstream of the coding region have negative numbers. There is no position zero. The putative transcription start site determined by S1 nuclease analysis (Fig. 6) is underlined close to position - 53. A "TATA box" about 30 bp upstream ( - 90 to - 83) is underlined. Direct repeat sequences are indicated by arrows. The c D N A insert in MI3PCI corresponds to nucleotides - 3 2 to 386.

Discussion

of the tracks of pea D N A digested with Bam HI, Eco RI and Hind III in the genomic Southern blot

The isolation of c D N A and genomic clones for pea plastocyanin has produced information on the organisation of the gene and on the nature of the pea plastocyanin precursor. Evidence that the pea plastocyanin gene is present as a single copy in the haploid genome is provided from at least four sources. A single band only is seen in each

(Fig. 3A). All three band are of similar intensity which is closely comparable with the intensity of the standard band corresponding with 1 gene copy per haploid genome. All three genomic clones analysed were identical and could be digested with restriction enzymes to give fragments of the same sizes as those detected in the whole genome

662

Fig. 6. S1 mapping of the transcription start site of the pea plastocyanin gene. An M 13rap 19 clone containing a 630 bp Nhe I-Hind III fragment was used to make a "prime-cut" probe. Track 1: untreated probe; track 2: probe treated with S1 nuclease; track 3: probe + 50/~g pea RNA, treated with S1 nuclease; track 4: probe + 50/tg tobacco RNA, treated with S1 nuclease. (The ladder was produced with the same template as was used to make the probe, using the 15met primer.) The plant RNA preparations were extracted from dark-grown (pea) or dark-adapted (tobacco) plants which were greened under white light for 48 h prior to harvesting.

Southern blot (Fig. 3B). The six cDNA clones sequenced were all identical in the regions in which they overlapped. This is consistent with a single plastocyanin mRNA as suggested by the Northern blot (Fig. 2). It has recently been reported that the plastocyanin gene probably occurs as

a single copy in spinach [35] and Arabidopsis thaliana [49]. Several other components of the photosynthetic apparatus appear to be encoded by single-copy nuclear genes; these include ferredoxin in Silenepratensis [40], photosystem I polypeptides and the Rieske Fe-S protein of the cytochrome b-f complex in spinach [46]. This contrasts with the genes for the small subunit of ribulose bisphosphate carboxylase, the chlorophyll a/b-binding proteins [9], ferredoxin-NADP reductase [31 ] and the 33 kDa extrinsic protein of photosystem II [46] all of which occur in small multi-gene families. The nucleotide sequence of the genomic clone shows that the plastocyanin gene contains no introns in the coding sequence, a feature which is shared with the spinach and Arabidopsis plastocyanin genes. The open reading frame encodes a precursor of 168 amino acid residues, the first 69 residues of which constitute the transit peptide. The nucleotide sequence encoding the transit peptide is followed by a sequence encoding the published N-terminal amino acid sequence of the mature protein [7]. The derived amino acid sequence of mature pea plastocyanin has all the features expected of a higher-plant plastocyanin. The amino acid sequence of the pea plastocyanin transit peptide derived from the nucleotide sequence of the gene is compared with the transit peptides of Silene, spinach and Arabidopsis plastocyanins in Figure 8. The transit peptides show considerable sequence similarities at the N-terminus and at the C-terminus, but the region between these sequences is not well conserved. The alignment in this region has been made by inspection of the nucleotide sequence and this suggests that a large number of deletions and/or insertions are responsible for the variation. The plastocyanin transit peptides are characterised by a high proportion of basic residues (Lys and Arg) at conserved positions, as well as conserved regions of hydroxylated and hydrophobic residues. Karlin-Neumann and Tobin [23] identified three blocks of homology within the transit peptides of the small subunit of ribulose bisphosphate carboxylase, the chlorophyll a/b-binding proteins and ferredoxin. Homologues of blocks I

663

Fig. 7. Synthesis of pea pre-plastocyanin in vitro under the direction of a genomic clone. RNA was transcribed from plasmids containing plastocyanin-eoding sequences using SP6 RNA polymerase and translated in vitro in a wheat germ extract in the presence of L-[35S]methionine. The translation products were analysed by SDS-polyacrylamide gel electrophoresis and fluorography of the gel. Track s contains translation products from pSPPC74 (Silene pratensis plastocyanin eDNA clone [38]). Track p contains translation products from pPSPC1 (pea plastoeyanin genomic construct). Track i is as track p but products have been immunoprecipitated with an antiserum to pea plastocyanin. The track labeled m contains molecular weight markers labelled with ['4C]acetimidate: bovine serum albumin (68 kDa), ovalbumin (43 kDa), carbonic anhydrase (29 kDa), trypsin inhibitor (20 kDa) and cytochrome c (12.4 kDa).

a basic residue) but is less well conserved than blocks I and II. Block III may form a secondary structure feature recognised by the stromal processing protease, leading to cleavage in the region of the sequence CVR (residues 42-44) in pea. The C-terminal 25-27 amino acids of the transit peptide (the thylakoid transfer domain)

and II are to be found in the plastocyanin transit peptides. Block I consists of the N-terminal region of 6-8 residues which are predicted to form an a-helical structure. Block II-consists of the conserved sequence PSFXGLK.(residues 12-18 in pea). Block III may be Present (SPRL in pea plastocyanin, which may form a fl-turn containing

ps

MATVTSTT-VAIPSFSGLKTNAATKVSA---MAK-I-PT-STSQ-S-PRLCVRASLKDIGVALVATAASAVLASNALA ::::::.

::::::

:::

:..

:

:: . . . .

sp

MATVTSSAAVAIPSFAGLKASSTTRAAT---V-K-VA--V-AT

so

MATVASSAAVAVPSFTGLKASGSIKPTT

at

MAAITSAT-VTIPSFTGLKLAVSSKPKTLSTISR--S-S-SATR-APPKLALKSSLKDFGVIAVATAASIVLAGNAMA

::::

::

::::::.:::

.

:

:

:::::

.:::::::

.

,

:

: ....

:

::

:

.... .

V :::::.::...::::

..::

::,:

PRMSIKASLKDVGVVVAATAAAGILA-NAMA ::::::::::::::::::::::::::

:::!

AKII-PT-TTA-V--PRLSVKASLKNVGAAVVATAAAGLLAGNAMA .

o

.

:.:

.:

:::..:.

.:::::

. A . V

.:::::::

. M

Fig. 8. Comparison of plastocyanin transit peptides. The sequences of the transit peptides ~om pea (ps), Silene pramns~ (sp) [38], spinach (so) [34] and Arabidops~ Naliana (at) [48] have been aligned. Identical residues are indicated by a colon (:) and conservative changes by a dot (.). Homology blocks I, II and III [23] are underlined. The arrow indicates the site of cleavage to yield the mature protein.

664 A

rbcS-E9 pea PC LRE

-35 -105

CATTATATAAAGCAAGTTT CTTTATCATCCATTCTATAAAATCACCTT CCTTATCATN0-5TATATATA

-17 -77

pea PC At PC At PC

-435 -343 -316

AATCATGTTAAACAACAATTCTTTG TTTCCTGTTAAACAAGAGGTTTATG TTGCATGTTAAAAAAGAGGTTTAGG

pea PC

-792

ATTGGACATATGCAACTTAGAACGTGCACTCGCGGAGG

-754

ATTGGACGTGTGCAACTTACAACGTACGCATTGTTCGT

-717

-699

ATTGGAGATGTGCAACTTACAACATGTGCAACTTACAA

-662

-683

TTACAACATGTGCAACTTACAACGTGCGCTCGCGGAGG

-646

B

-411 -319 -292

C -755

Fig. 9. Comparisonofupstreamnon-codingsequences.A. Alignment ofsequenees near the TATA box from the pea plastocyanin gene, the pea rbc S-E9 gene [ 10] and the light-responsive element (LRE) of phytochrome-dependent light-inducible genes [ 15]. B. Alignment of the pea sequence with the 25 bp direct repeat in the Arabidopsis thaliana (At) plastocyanin gene [48]. C. Alignment of direct repeat sequences in the upstream region of the pea plastocyanin gene. Potential Z-DNA elements are underlined.

resemble a typical prokaryotic or eukaryotic signal peptide [48]. In common with signal sequences the thylakoid transfer domain has a positively charged N-terminal region (n region), a central hydrophobic region (h region) and a C-terminal region with small neutral residues at positions 1 and - 3 which may define the cleavage site [47]. The sequence "AIa-X-Ala" immediately before the mature N-terminus is also found in spinach, Arabidopsis and Silene pre-plastocyanins as well as in the precursors of the 33, 23 and 16 kDa polypeptides of the oxygen-evolving complex of spinach and pea and may reflect recognition by the same thylakoid protease. The negative charge at the N-terminus of the mature protein might also form part of such a recognition site. The upstream sequences of the pea plastocyanin gene have been compared with other pea genes for chloroplast proteins. Only very limited regions of sequence similarity have been observed with the pea rbcS genes [ 10, 30] and the lightharvesting chlorophyll a/b protein gene AB 80 [ 8 ]. The sequence around the TATA box of the pea plastocyanin gene is similar to a sequence conserved in all rbc S genes (Fig. 9A). This is part of a 33 bp sequence which is involved in lightinducible gene expression [30]. In addition, the sequence CTTTATCAT located 6 bp upstream from the TATA box of the pea plastocyanin gene (Fig. 9A) is similar to a consensus light-respon-

sive element (CCTTATCAT) found in a similar position in many phytochrome-dependent lightinducible genes [15]. However no obvious sequence homology was observed with the conserved elements of the light-responsive enhancer of the pea rbcS genes [ 13]. Comparison of the upstream sequence of the pea, spinach and Arabidopsis plastocyanin genes reveals only very limited sequence homology. In pea there is a single copy of a 15 bp sequence which is similar to sequences in a 25 bp direct repeat in Arabidopsis (Fig. 9B). These sequences are further upstream than the limit of the published spinach sequence. The most striking feature of the upstream sequences of the pea plastocyanin gene is a series of overlapping direct repeats in the region 640-810 bp upstream of the translation initiation codon (Fig. 5 and Fig. 9C). A similar sequence occurs within the coding sequence of the gene (nucleotides 398-434 in Fig. 5). Some of the upstream direct repeat sequences contain alternating purine and pyrimidine bases indicating they are potential Z-DNA forming elements. Three of the direct repeats contain pairs of elements separated by 7 bp. A potential Z-DNA forming element has been reported to form part of an essential upstream region of the nopaline synthase (nos) promoter and it has been noted that potential Z-DNA sequences are present in the upstream regions of

665 plant genes [ 1]. Further work is needed to establish whether these upstream sequences are involved in the regulation of expression of the pea plastocyanin gene.

Acknowledgements We are extremely grateful to David Baulcombe, Aine Plant, Hugh Salter, Greg Winter for help and advice. The oligonucleotides were synthesised by Steve Powell, MRC Laboratory of Molecular Biology, Cambridge. The experiments with the Silene cDNA clone were carded out in collaboration with Ken Keegstra, University of Madison. DIL was supported by an SERC Biotechnology Directorate studentship.

References 1. An G: A potential Z-DNA-forming sequence is an essential upstream element of a plant promoter. BioEssays 7: 211-214 (1987). 2. Bennett MD, Smith JB: Nuclear DNA amounts in angiosperms. Phil Trans Roy Soc Lond Ser B 274: 227-274 (1976). 3. Benton WD, Davis RW: Screening 2gtl I recombinant clones by hybridisation to single plaques in situ. Science 196:180-182 (1977). 4. Berk AJ, Sharp PA: Sizing and mapping of early adenovirus mRNAs by gel electrophoresis of S 1 endonuclease digested hybrids. Cell 12:721-732 (1977). 5. Bonner WM, Laskey RA: A film detection method for tritium-labelled proteins and nucleic acids in polyacrylamide gels. Eur J Biochem 46:83-88 (1974). 6. Boulter D, Haslett BG, Peacock D, Ramshaw JAM, Scawen MD: Chemistry, function and evolution ofplastocyanin. In: Northcotc DH (ed) International Review of Biochemistry 13, Plant Biochemistry II, pp. 1-40. University Park Press, Baltimore (1977). 7. Boulter D, Peacock D, Guise A, Gleaves JT, Estabrook G: Relationships between the partial amino acid sequences of plastocyanin from members of ten families of flowering plants. Phytochemistry 8:603-608 (1979). 8. Cashmore A: Structure and expression of a pea nuclear gene encoding a chlorophyll a/b-binding protein polypeptide. Proc Natl Acad Sci USA 81:2960-2964 (1984). 9. Coruzzi G, Broglie R, Cashmore A, Chua N-H: Nucleotide sequences of two pea cDNA clones encoding the small subunit of ribulose 1,5-bisphosphate carboxylase and the major chlorophyll a/b-binding thylakoid polypeptide. J Biol Chem 258:1399-1402 (1983).

10. Coruzzi G, Broglie R, Edwards C, Chua N-H: Tissuespecific and light-regulated expression of a pea nuclear gene encoding the small subunit of ribulose-1,5-bisphosphate carboxylase. EMBO J 3:1671-1679 (1984). 11. Domoney C, Casey R: Measurement ofgene number for seed storage proteins in Pisum. Nucleic Acids Res 13: 687-699 (1985). 12. Feinberg AP, Vogelstein B: A technique for radiolabeling DNA restriction endonuclease fragments to high specific activity. Anal Biochem 132:6-13 (1983). 13. Fluhr R, Kuhlemeier C, Nagy F, Chua N-H: Organspecific and light-induced expression of plant genes. Science 232:ll06-1112 (1986). 14. Frischauf A-M, Lehrach H, Poustika A, Murray N: Lambda replacement vectors carrying polylinker sequences. J Mol Biol 170:827-842 0983). 15. Grob U, Stuber K: Discrimination of phytochrome dependent light inducible from non-light inducible plant genes. Prediction of a common light-responsive element (LRE) in phytochrome dependent light inducible plant genes. Nucleic Acids Res 15:9957-9973 (1987). 16. Grossman AR, Bartlett SG, Schmidt GW, Mullet JE, Chua N-H: Optimal conditions for post-translational uptake of proteins by isolated chloroplasts. J Biol Chem 257:1558-1563 (1982). 17. Gubler U, Hoffman BJ: A simple and very efficient method for generating cDNA libraries. Gene 25: 263-269 (1983). 18. Hageman J, Robinson C, Smeekens S, Weisbeek P: A thylakoid processing protease is required for complete maturation of the lumen protein plastocyanin. Nature 324:567-569 (1986). 19. Hanahan D: Studies on transformation of Escherichia coli with ptasmids. J Mol Biol 166:557-580 (1983). 20. Haslett BG, Cammack R: The development of plastocyanin in greening bean leaves. Biochem J 144:567-572 (1974). 21. Howe CJ, Bowman CM, Dyer TA, Gray JC: Localisation of wheat chloroplast genes for the beta and epsilon subunits of ATP synthase. Mol Gen Genet 186:525-530 (1982). 22. Jackson RJ, Hunt T: Preparation and use of nucleasetreated rabbit reticulocyte lysates for the translation of eukaryotic messenger RNA. Methods Enzymol 96: 50-74 (1983). 23. Karlin-Neumann GA, Tobin EM: Transit peptides of nuclear-encoded chloroplast proteins share a common amino acid framework. EMBO J 5:9-13 (1986). 24. Kirwin PM, Eiderfield PD, Robinson C: Transport of proteins into chloroplasts. Partial purification of a thylakoidal peptidase involved in plastocyanin biogenesis. J Biol Chem 262:16386-16390 (1987). 25. Kozak M: Possible role of flanking nucleotides in recognition of the AUG initiator codon by eukaryotic ribosomes. Nucleic Acids Res 9:5233-5252 (1981). 26. Laemmi UK: Cleavage of structural proteins during the assembly of the head of the bacteriophage T4. Nature 227:680-685 (1970).

666 27. Maniatis T, Fritsch EF, Sambrook J: Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY (1982). 28. Merchant S, Bogorad L: Regulation by copper of the expression of plastocyanin and cytochrome c-522 in Chlamydomonas reinhardtii. Mol Cell Biol 6:462-469 (1986). 29. Messing J: New M13 vectors for cloning. Meth Enzymol 101:20-78 (1983). 30. Morelli G, Nagy F, Fraley RT, Rogers SG, Chua N-H: A short conserved sequence is involved in the light-inducibility of a gene encoding ribulose 1,5-bisphosphate carboxylase small subunit of pea. Nature 315:200-204 (1985). 31. Newm~in BJ, Gray JC: Characterisation of a full-length cDNA clone for pea ferredoxin-NADP ÷ reductase. Plant Mol Biol 10f 511-520 (1988). 32. Plesnicar M, Bendail DS: The plastocyanin content of chloroplasts from some higher plants estimated by a sensitive enzymic assay. Biochim Biophys Acta 216: 192-199 (1970). 33. Plesnicar M, Bendall DS: The photochemical activities and electron carriers of developing barley leaves. Biochem J 136:803-812 (1973). 34. Robinson C, Ellis RJ: Transport of proteins into chloroplasts. Partial purification of a chloroplast protease involved in the processing of imported precursor polypeptides. Eur J Biochem 142:337-342 (1984). 35. Rother C, Jansen T, Tyagi A, Tittgen J, Herrmann RG: Plastocyanin is encoded by an uninterrupted nuclear gene in spinach. Curr Genet 11:171-176 (1986). 36. Sanger F, Coulson AR, Barrel BG, Smith AJH, Roe BA: Cloning in single-stranded bacteriophage as an aid to rapid DNA sequencing. J Mol Biol 143:161-178 (1980). 37. Sanger F, Nicklen S, Coulson AR: DNA sequencing with chain-terminating inhibitors. Proc Natl Acad Sci USA 74:5463-5467 (1977). 38. Smeekens S, Bauerle C, Hageman J, Keegstra K, Weisbeek P: The role of the transit peptide in the routing of precursors toward different chloroplast compartments. Cell 46:365-375 (1986). 39. Smeekens S, De Groot M, Van Binsbergen J, Weisbeek P: Sequence of the precursor of the chloroplast thylakoid lumen protein, plastocyanin. Nature 317:456-458 (1985). 40. Smeekens S, Van Binsbergen J, Weisbeek P: The plant ferredoxin precursor: nucleotide sequence of a full length cDNA clone. Nucleic Acids Res 13:3179-3194 (1985).

41. Southern EM: Detection of specific sequences among DNA fragments separated by gel electrophoresis. J Mol Biol 98:503-517 (1975). 42. Takabe T, Ishikawa H, Niwa S, Tanaka Y: Electron transfer reactions of chemically modified plastocyanin with P700 and cytochrome f. Importance of local charges. J Biol Chem 96:385-393 (1986). 43. Takabe T, Takabe T, Akazawa AT: Biosynthesis of P700-chlorophyll a protein, plastocyanin, and cytochrome b6-f complex. Plant Physiol 81:60-66 (1986). 44. Thomas P: Hybridisation of denatured RNA and small DNA fragments transferred to nitrocellulose. Proc Natl Acad Sci USA 77:5201-5205 (1980). 45. Thompson WF, Everett M, Polans NO, Jorgensen RA, Palmer J D: Phytochrome control of RNA levels in developing pea and mung-bean leaves. Planta 158:487-500 (1983). 46. Tittgen J, Hermans J, Steppuhn J, Jansen T, Jansson C, Andersson B, Nechushtai R, Nelson N, Herrmann RG: Isolation of cDNA clones for fourteen nuclear-encoded thylakoid membrane proteins. Mol Gen Genet 204: 258-265 (1986). 47. Von Heijne G: Patterns of amino acids near signalsequence cleavage sites. Eur J Biochem 133:17-21 (1983). 48. Von Heijne G: Signal sequences. The limits of variation. J Mol Biol 184:99-105 (1985). 49. Vorst O, Oosterhoff-Teerstra R, Vankan P, Smeekens S, Weisbeek P: Plastocyanin of Arabidopsis thaliana: isolation and characterization of the gene and chloroplast import of the precursor protein. Gene 65:59-69 (1988). 50. Waye MMY, Verhoeyen ME, Jones PT, Winter G: EcoK selection vectors for shotgun cloning into M 13 and deletion mutagenesis. Nucleic Acids Res 13:8561-8571 (1985). 51. Weaver RF, Weissmann C: Mapping of RNA by a modification of the Berk-Sharp procedure: the 5' termini of the 15S fl-globin mRNA precursor and mature 10S fl-globin mRNA have identical map coordinates. Nucleic Acids Res 7:1175-1193 (1979). 52. Wood PM: Interchangeable Cu and Fe proteins in algal photosynthesis. Eur J Biochem 87:9-19 (1978). 53. Wood WB: Host specificity of DNA produced by Escherichia coli: bacterial mutations affecting the restriction and modification of DNA. J Mol Biol 16:118-133 (1966). 54. Yanisch-Perron C, Veiera J, Messing J: Improved M13 phage cloning vectors and host strains: nucleotide sequences of the M13mpl8 and pUC19 vectors. Gene 33: 103-119 (1984).