JOURNAL OF BACTERIOLOGY, Nov. 1992, p. 7098-7103
Vol. 174, No. 22
0021-9193/92/227098-06$02.00/0 Copyright © 1992, American Society for Microbiology
Physical Map of the Listeria monocytogenes Chromosome ERIC MICHEL AND PASCALE COSSART* Laboratoire de Genetique Moleculaire des Listeria and Centre National de la Recherche Scientifique URA 1300, Institut Pasteur, 28 rue du Docteur Roux, Paris 75015, France Received 19 June 1992/Accepted 9 September 1992
The circular physical map of the pathogenic bacterium Listeria monocytogenes L028 (serovar 1/2c) was established by using pulsed-field gel electrophoresis. The L. monocytogenes chromosome contains eight NotI fragments of 1,100, 940, 400, 335, 280, 45, 30, and 20 kb in size and eight Sse8387I fragments of 860, 680, 680, 370, 335, 130, 70, and 25 kb. Therefore, the total length of the genome is 3,150 kb. To order the NotI fragments on the chromosome, we used a strategy which can be of general use. We first cloned chromosomal HindIII or EcoRI fragments in pBR322. DNA extracted from the total libraries was digested by NotI and ligated to a NotI-kanamycin resistance cassette obtained by cutting Tn5 with NotI. After transformation in Escherichia coli, kanamycin-resistant clones originating from NotI-containing EcoRI or HindIH frmMents were isolated. The two EcoRI-NotI or HindM-NotI fragments of each recombinant plasmid were isolated and used as probes on Southern blot hybridizations to identify and link the corresponding NotI fragments. Seven NotI fragments were ordered in this way. The last junction was demonstrated by partial digest analysis. All L. monocytogenes genes identified so far as well as the six rRNA operons were localized on the NotI map. Regions homologous to genes from closely related bacteria were also detected and localized. Southern blot analysis of simple Sse8387I digests or double Sse8387I-NotI digests probed with the various NotI probes allowed us to align the Sse8387I fragments and localize the single SfI site, resulting in the establishment of the first genetic and physical map of the L. monocytogenes chromosome.
The genus Listeria belongs to the nonsporulating and low-G+C-content gram-positive bacteria and is closely related to the genera Streptococcus and Bacillus (27). This genus contains six species, namely, L. monocytogenes, L. ivanovii, L. seeligeri, L. innocua, L. welshimeri, and L. grayi. All of these species can be isolated from a wide variety of soil specimens in the wild and in human and animal environments and are thus considered soil organisms. Of these species, two are pathogenic: L. monocytogenes is pathogenic for humans and animals, whereas L. ivanovii is associated only with animal disease. L. monocytogenes has recently been recognized as a food pathogen after the tracing of listeriosis outbreaks to contaminated food (17), consistent with some peculiar characteristics of L. monocytogenes, i.e., growth at low temperatures (as low as 4°C) and resistance to sodium concentrations above 10%. Clinical features of the disease consist of septicemia, meningitis, and meningoencephalitis characterized by a high mortality rate and abortions. It was discovered in the early 1960s that L. monocytogenes is able to survive in macrophages and that recovery from infection is due to a cellular immune response (18). Since then, the bacterium has been mainly used to study the induction of the cellular immune response. Recently, with the development of genetic tools and in vitro models of infection, L. monocytogenes has emerged as one of the best models for the study of the molecular basis of intracellular parasitism (6). A systematic genetic analysis in conjunction with cell biology observations has led to a precise description of the cell infection process, and several virulence genes have now been identified (for a review, see reference 24). However, a number of issues remain to be addressed, and one of the challenging questions for the future is to determine how two species in the genus Listeria have evolved to *
Corresponding author. 7098
become pathogenic. Such evolutionary considerations can be approached by both detecting pathogenic species-specific sequences and comparing genome organizations. Therefore, we have undertaken physical mapping of the L. monocytogenes chromosome. Since no transduction system is available in L. monocytogenes, the physical map will also be useful for future genetic studies such as the localization of cloned genes, analysis of genomic distribution of loci encoding virulence factors, and characterization of deletion and transposon mutants. MATERIALS AND METHODS DNA preparation. L. monocytogenes L028 was grown to stationary phase in brain heart infusion broth. Washed cells (109 cells per ml) were mixed with an equal volume of 1% low-melting-point agarose (Bethesda Research Laboratories), and the mixture was allowed to solidify in 300-pl rectangular molds (30). After 20 min at 4°C, the agarose plugs were subjected to treatment with enzymes and detergents to digest the bacterial cell wall and proteins. Briefly, plugs were incubated for 24 h at 37°C with gentle shaking in 40 ml of solution containing 6 mM Tris HCI (pH 7.5), 1 M NaCl, 100 mM EDTA (pH 8), 1% Sarkosyl, 0.2% deoxycholate, and lysozyme (2.5 mg/ml). The plugs were deproteinized by incubation in ESP (0.5 M EDTA, 1% Sarkosyl, proteinase K [2 mg/ml], pH 8) for 50 h at 50°C. They were further washed in 40 ml of TE (10 mM Tris HCI [pH 7.5], 1 mM EDTA) three times and were incubated twice for 1 h in 40 ml of TE containing 40 ,g of phenylmethylsulfonyl fluoride per ml at 50°C. The plugs were washed in TE buffer three times and kept at 4°C in 0.5 M EDTA (pH 8). Prior to restriction endonuclease digestion, they were washed in TE for 1 h and equilibrated in 200 pl of the digestion buffer for 0.5 h. Restriction digests. ApaI (GGGCCC), Sall (GTCGAC), NotI (GCGGCCGC), NarI (GGCGCC), NheI (GCTAGC),
VOL. 174, 1992
PHYSICAL MAP OF THE L. MONOCYTOGENES CHROMOSOME
MluI (ACGCGT), NaeI (GCCGGC), XhoI (CTCGAG), XbaI (TCTAGA), SacII (CCGCGG), ClaI (ATCGAT), BamHI (GGATCC), Sacl (GAGCTC), SmaI (CCCGGG), BsshII (GCGCGC), NcoI (CCATGG), Scal (AGTACT), SphI (GCATGC), StuI (AGGCCT), ScaII (CCCCCC), BglI (GC CNNNNNGGC), Sfil (GGCCNNNNNGGCC), EagI (CG GCCG), PvuI (CGATCG), SgrAI (GA/GCCGGT/CG), NnI (TCGCGA), Pacl (TTAATTAA), and Sse8387I (CCTGC AGG) were purchased from Biolabs, Amersham, or Boehringer. DNA samples in agarose (40 pl) were digested with 20 U of enzyme for 4 h (24 h for SfiI) at 37°C (25°C for SmaI and 50°C for SfiI) in 200 ,lI of the buffer recommended by the manufacturer. The reaction was stopped with 200 pl of 0.25 M EDTA. Electrophoresis conditions. DNA digests were submitted to a contour-clamped homogeneous electric field (4, 26). An apparatus purchased from Pharmacia (Uppsala, Sweden) with hexagonal electrodes was routinely used for agarose gel electrophoresis. Chilled agarose plugs were inserted into the wells of a 1.2% agarose gel (15 by 15 cm). Low-melting-point agarose (0.5%) was used to ensure good positioning of the plugs in each well. Electrophoresis in 0.5x Tris-borate-EDTA was performed for 40 to 80 h at 165 V at 8°C, with pulse times of 1 to 200 s. Two different windows of resolution were used, one for medium and large fragments and one for small and medium fragments. For the first, we used pulses of 1 s (for 12 h), 3 s (for 10 h), 20 s (for 10 h), 40 s (for 10 h), 90 s (for 11 h), and 120 s (for 12 h); for the second, we used pulses of 1 s (for 10 h), 3 s (for 6 h), 10 s (for 8 h), 20 s (for 8 h), and 40 s (for 8 h). Lambda concatemers and chromosomes from Saccharomyces cerevisiae (Bio-Rad Laboratories, Richmond, Calif.) were used as size markers. After electrophoresis, gels were stained for 20 min in ethidium bromide (20 ,ug/ml) in electrophoresis buffer, destained for 10 min in water, and photographed. Southern blot hybridization. After electrophoresis, gels were UV irradiated for 5 min at 312 nm to fragment DNA, depurinated for 20 min in 0.25 M HCl, denatured in 0.5 M NaOH-1.5 M NaCl for 45 min, and then neutralized in 0.5 M Tris HCl-1.5 M NaCl (pH 7.5) for 45 min. DNA was transferred to Hybond N ifiters (Amersham) overnight in 20x SSC (lx SSC is 0.15 M NaCl plus 0.015 M sodium citrate) and fixed by UV irradiation for 5 min at 312 nm. Hybridization was performed with 32P-labeled probes (see below). Prehybridization and hybridization were carried out by using the rapid hybridization system of Amersham. Filters were then washed twice for 30 min at 65°C in 2x SSC-0.1% sodium dodecyl sulfate (SDS), once in lx SSC0.1% SDS, and twice in 0.7x SSC-0.1% SDS for 30 min at 65°C. When heterologous probes were used, filters were hybridized and washed under low-stringency conditions as already described (31). The filters were then autoradiographed for 15 to 96 h at -80°C. Preparation of the NotI kanamycin cassette. Plasmid pRZ102 (14) was cleaved with NotI, which cuts twice in the transposon TnS, in the left and right IS50s, giving rise to a 4.6-kb NotI fragment carrying a kanamycin resistance gene. This fragment was purified using a Geneclean kit (Bio 101). Isolation of HindIH or EcoRI junction fragments. L. monocytogenes chromosomal DNA was digested with HindIII or EcoRI and ligated with pBR322 restricted by HindIII or EcoRI and dephosphorylated. After transformation of E. coli MC 1061 (3), all colonies from both libraries were collected by scraping the plates. Plasmid DNA from both libraries was subsequently prepared, cleaved with NotI, and ligated to the
7099
4.6-kb NotI fragment of TnS. After transformation, kanamycin- and ampicillin-resistant clones were selected. DNA probes. DNA fragments obtained after restriction of plasmid DNA, classical agarose gel electrophoresis, and Geneclean purification were used as probes. Alternatively, L. monocytogenes chromosomal DNA fragments were amplified by polymerase chain reaction and the fragments were purified by using a Geneclean kit. Oligonucleotides were synthesized on a Milligen oligonucleotide synthesizer (Millipore). The probe for iap was obtained by polymerase chain reaction by using L. monocytogenes chromosomal DNA with oligonucleotides CTACACAAGCAACTACACCTGC GCC (positions 972 to 996) and CCAGAGCAATCAAAT GTAGTTGGTCC (positions 1610 to 1635) (16). The probe for lmaAB was made in the same way with oligonucleotides GATTATACACCGGGAGCTGCTAAAG (positions 415 to 439 in Gohmann et al. [11]) and GCCCTCAGTAATCGT TAAATCAACAAG (positions 829 to 855 in Gohmann et al. [11]). The probe for hly was a 410-bp HindIlI fragment containing the distal end of the gene (22). The inlA probe was a 1.2-kb HindIII fragment (9). The ctxA probe was an EcoRI fragment kindly provided by J. C. Perez-Diaz. The recA gene probe (8) was a 340-bp fragment kindly provided by P. Duwat. The Clostridium perfingens 16S rRNA and 23S rRNA probes were the HindIII-SmaI fragments of plasmids pBC15 and pBC23, respectively (10) (see Fig. 5C), kindly provided by B. Canard. The 3.5-kb C. perfringens gyrase probe (1) was kindly provided by B. Canard. Probes were labeled with [32P]dCTP at 3,000 Ci mM-1, using the random priming labeling kit of Amersham. Other techniques. The cloning procedures and routine DNA techniques used were described previously (23). RESULTS Estimation of the genome size. The first goal of this project was to evaluate the size of the genome of the clinical strain L. monocytogenes L028 (serotype 1/2c) by using pulsedfield gel electrophoresis (PFGE). L. monocytogenes DNA was cut with restriction endonucleases that were expected to be rare cutters of the genome because of the rather low G+C content (38%) of the DNA. Analysis of the cleavage products by PFGE showed that SalI, NarI, NheI, Mulu, NaeI, XhoI, XbaI, SacII, ClaI, BamHI, SacI, SmaI, BsshII, NcoI, Scal, SphI, StuI, ScaII, BglI, EagI, PvuI, SgrAI, Nrul, and PacI generated many (more than 40) fragments. Cleavage with ApaI resulted in about 35 to 40 fragments, with sizes ranging between 1 and 500 kb. In agreement with preliminary observations (32), NotI reproducibly gave rise to eight fragments of 1,100 (Not A), 940 (Not B), 400 (Not C), 335 (Not D), 280 (Not E), 45 (Not F), 30 (Not G), and 20 (Not H) kb as shown in Fig. 1. Sse8387I also cleaved the chromosome in eight fragments of 860 (Sse A), 680 (Sse B1 and B2), 370 (Sse C), 335 (Sse D), 130 (Sse E), 70 (Sse F), and 25 (Sse G) kb (Fig. 1). Thus, the genome size deduced from these two single digests was evaluated to be 3,150 + 50 kb. Construction of the physical map. The NotI fragments were ordered by using the strategy presented in Fig. 2. Six different plasmids with inserts corresponding to linked NotI fragments were obtained from the EcoRI library, and six were obtained from the HindIII library. After double digestion of the plasmids with NotI and either EcoRI or HindIII, seven nonredundant recombinant plasmids carrying junctions between successive NotI fragments were selected: plasmid pEco32 contained two EcoRI-NotI fragments of 0.58 kb; pEco4l contained two EcoRI-NotI fragments of 0.7
A 2
-4
KI1
.1
Sse'
Soe
It
_
J. BACTERIOL.
MICHEL AND COSSART
7100
A-
-
1H1 SI15 6S0
112-
450
(C. se D)-
2 -
E
Sse
F
-
194
97 -
se
)
G;-
48.5
23.1
Sse (Sse 1)-
Not
C.
Notl )Not 1.-194
Tn5
N,I *Km'
I
*
V-A \
N
N1 I N
Notl
Kmr
*
N
*i
t L-1-
E N
Sse
1 -
St
(G- Not G. Not 11.
NoF
48.5 23.1
9.4
/ E
N
N
N
\
probe2
N
N
1,100
Not B
940
Not C
400
Not D
335
Not E
280
Not F Not G
45 30
Not H
20
Sse A
860
Plasmid(s) used
Gene(s)
for alignment"
pHind39 (0.8)
pEco32 (0.58), pEco5O (1.2) pHind39 (1.7), pEco4l (3) pEco4 (7), pEco5O (2.5) pEco4l (0.7), pEco32 (0.58) pEcol9 (4.3) pEcol9 (1.8), pEcol8 (4) pEco4 (0.85), pEcol8 (1.45)
hly locus, lmaAB; inlAB, gyr recA, rrn
iap
cixA
rrn
hly locus, lmaAB,
inlAB, rm, gyr cixA, rm 680 recA 680 rn 370 335 Uap 130 70 25 a The size of the HindIII-NotI or EcoRI-NotI probe in kilobases is indicated
Sse Bi Sse B2 Sse C Sse D Sse E Sse F Sse G
in parentheses.
E fE
probe l
Not A
(kb)
97
and 3 kb; pEcoSO contained two EcoRI-NotI fragments of 1.2 and 2.5 kb; pEcoi8 contained two EcoRI-NotI fragments of 1.45 and 4 kb; pEcol9 contained two EcoRI-NotI fragments of 1.8 and 4.3 kb; pEco4 contained two EcoRI-NotI
N
Size
-450
FIG. 1. PFGE of L. monocytogenes L028 chromosomal DNA digested with NotI (lane 1), NotI and Sse8387I (lane 2), and Sse83871 (lane 3). In lane 4, S. cerevisiae chromosomes and lambda concatemers used as size markers were deposited in the gel as half-agarose plugs. Panels A and B correspond to two different windows of resolution (see Material and Methods). The names of the fragments have been indicated to the left of each panel.
EcoRI
Fragment K})
ise F.-
SSt
Sse
TABLE 1. Specific features of L. monocytogenes L028 NotI and Sse8387I fragments
B
E
FIG. 2. Strategy used to isolate linking probes. E, EcoRI sites; N, NotI sites; *, HindIll sites.
fragments of 0.85 and 7 kb; and pHind 39 contained two HindIII-NotI fragments of 0.8 and 1.7 kb (Table 1). The EcoRI-NotI or HindIII-NotI fragments were then purified and used to probe membranes onto which NotI digests of chromosomal DNA had been transferred. The two fragments originating from pEco32 hybridized with fragments Not E and B, those of pHind39 hybridized with fragments Not A and C, the two fragments of pEco41 hybridized with fragments Not E and C, those originating from pEcoSO hybridized with Not D and B, those from pEco4 hybridized with Not H and D, those from pEcoi8 hybridized with Not H and G, and those of pEcol9 hybridized with Not G and F. Therefore, fragments Not A, C, E, B, D, H, G, and F were aligned, in the order given. Linkage of Not F and A was shown by use of a partial digestion analysis. Thus, total chromosomal DNA was partially digested with NotI, submitted to PFGE, and transferred. The membrane was probed with the 4.3-kb EcoRI-NotI fragment of pEcol9 (Fig. 3). This resulted in the unambiguous labeling of the largest NotI fragment, Not A, whose size increased 45 kb, confirming that Not F was next to Not A and thus demonstrating the circularity of the chromosome. The Sse8387I fragments were aligned by analysis of Southern blots after simple Sse8387I or double Sse8387I-NotI digestions by using a combination of probes originating from the plasmids used for the alignments of the Notl fragments as well as gene probes (see below). A single Sfil site was localized in the same way. All of these results confirmed the circularity of the chromosome. The resulting physical map of the circular genome of L. monocytogenes is given in Fig. 4. Mapping of virulence factors genes and other genes. Few L. monocytogenes genes have been isolated. All of these genes are more or less involved in virulence (for a review, see reference 24). Probes for each of these genes were used to locate them on the physical map (Fig. 4). We localized on
PHYSICAL MAP OF THE L. MONOCYTOGENES CHROMOSOME
VOL. 174, 1992 1
2
3
4
5
6
7
8
9
10
3500 kb-
.zF
4-
Not A+Not F
-940 kh
kb ~~~~~~~~~~~~-815
FIG.
I.
PFGE
and
Southe
blot
digestion of the L. monocytogenes a Not F-specific probe. Lanes: 1
Sacchamomycespombe
analysis
of
partial probed with
NotI
a
chromosome DNA
and 10, yeast chromosomes of
and S. cerevisiae,
respectively,
used
as
(22),
the
hly
locus which contains the
p1cA -prfA
operon
(19, 20),
listeriolysin and
the
0 gene
lecithinase
(31), which itself consists of mpl (7, 21) (a gene coding for a metalloprotease), actA (a gene involved in actin polymerization) (15), and plcB (the gene coding for the lecithinase). The inl locus, which encodes internalin, a protein involved in entry of L. monocytogenes into epithelial cells (9), and the lmaAB operon (11) also mapped to Not A. Gene iap (16) mapped to Not C. The gene homologous to the cixA toxidn gene of Vibrio cholerae (9a) mapped to Not D. The recA gene (8) was mapped to Not B and Sse B2. By using low-stringency conditions of hybridization, we localoperon
hly locus, gyr, lmaAB, inLUB, \ rnn
recA
rrn
ml
ized a gene homologous to the gyrA gene of C perfringens on Not A and Sse A (1). Mapping of rRNA operons. The number of rRNA operons was established by Southern blot analysis of total chromosomal DNA digested with a panel of restriction enzymes, using as probes two DNA fragments specific for the 16S and 23S rRNA genes of C. perfringens (10). This study was facilitated by knowledge of the total sequence of the 16S rRNA gene of L. monocytogenes (5). This gene contains several unique restriction sites, namely, SmaI, NruI, PstI, and EcoRI, and does not contain cleavage sites for HpaI and EcoRV. Southern blot analysis of the restriction pattern with HpaI or EcoRV resulted in exactly the same six-band pattern with the two 16S or 23S rRNA probes (Fig. 5A and B, lanes 7 and 8), suggesting the presence of six rRNA operons. This was confirmed by all digestions. For example, six fragments hybridizing to the 16S rRNA probe were obtained with PstI, NruI, HindIII, and EcoRV. The six operons were localized to the two contiguous NotI fragments Not A and F, to Not B, and to three contiguous Sse83871 fragments, Sse A, Bi, and C.
size
markers; 2, native L028 DNA; 3 to 9, L028 DNA digested with increasing doses of NotI (lane 3, 0.1 U; lane 4, 0.2 U; lane 5, 0.5 U; lane 6, 1 U; lane 7, 2 U; lane 8, 9 U; lane 9, 36 U). The position of the Not A+F fragment is indicated by an arrow.
Not A the
7101
ctxA
FIG. 4. Physical and genetic map of the L. monocytogenes circular chromosome. The external intervals correspond to NotI fragments, the intermediate ones correspond to Sse83871 fragments, and the last inner circle indicates the location of the unique SfiI site. Intervals where genes have been located are indicated by arcs outside the circular map.
DISCUSSION In this work, we have established that the size of the L. monocytogenes L028 (serovar 1/2c) chromosome is 3,150 kb. Circularity of the genome was demonstrated by using linking clones containing the ends of contiguous NotI fragments and partial digest analysis. The genome size is similar to that of C. perfringens (3,600 kb) (1). A recent report describing restriction digests of several L. monocytogenes strains indicated that the genome size varies between serovars of L. monocytogenes but that the genome is always smaller than 2,750 kb (2). This is not in agreement with our results and is probably due to technical problems with the resolution of comigrating bands in PFGE. The use of linking clones to order fragments was first proposed in 1986 (29, 30). The strategy that we used took advantage of the presence of two NotI sites located at each end of TnS. By this technique, we cloned EcoRI or HindIII fragments containing all but one of the NotI sites of the Listeria chromosome. The reason we did not get one of the NotI sites is probably due to the fact that the corresponding EcoRI or HindIII fragments were too large to be cloned in pBR322. It is to be noted that in this strategy, if two unlinked NotI-containing fragments are coligated, they lead to aberrant linking clones. We obtained such a clone, but the ambiguity was easily solved by the detection of two types of linking plasmids possessing the same EcoRI-NotI fragment and the subsequent analysis of the Sse8387I digests. Several genes were mapped on the chromosome. However, clusters of virulence genes could not be identified because of the small number of genes available and the large size of the NotI and Sse8387I fragments containing those genes. Such an analysis would require establishment of a map with smaller arbitrary intervals, an absolute prerequisite to establish a precise genetic map of the genome. This is in progress in our laboratory. Six putative rRNA operons were detected on the basis of homology with C. perfringens rRNA genes. This value is not in agreement with a previous evaluation (2). The putative ribosomal operons were localized in two parts of the chromosome, most of them being clustered in one portion of the chromosome. Clustering of ribosomal operons has been reported in a number of cases, and the origin of replication has in some cases been localized within the ribosomal gene
MICHEL AND COSSART
7102
1 2
A
3 4 5 6
8 9 10 1I 12 13
7
p
1 2
Rf OMP
3 4
5
lw,
6
kb
."L
( 10 I(1
7
w
kb 23,1
J. BACTERIOL.
12 13
,zl,
w^5 ...Xri **a....*
^ i
.#.
23,1
-
i_ _
_!'
omm
9,4 6,5 4,3 -
A.
994 6,5
..
2_ *so*
4,3
..,:
W ."*Am
law _ M ._
me0o 04.
2,3 2
2,3 2 .:
w
*,
__ j_ _.
._
4-
......
i4KX
,z4v.;:,., :.:. :.
40.'wk'
..
-I
0,5
0,5
FIG. 5. Ribosomal operon analysis. Southern blot analysis of L. monocytogenes chromosomal DNA restricted with EcoRI (lane 1),
C C.perfringens 23s rRNA
16s rRNA
5s
RNA 11 l
......
HindlIl
Smal
SmaI
HindlIl
pBC23
pBC15
1
kb
L.monocytogenes 16s rRNA
PstI (lane 2), NruI (lane 3), HindIII (lane 4), BglII (lane 5), Sacl (lane 6), HpaI (lane 7), EcoRV (lane 8), BamHI (lane 9), SmaI (lane 10), SmaI and HindIII (lane 11), SmaI and SacI (lane 12), and SmaI and HpaI (lane 13), probed with pBC15 (A), a probe which is specific for the 16S rRNA gene, and with pBC23 (B), a 23S rRNA gene-specific probe (10), is shown as well as a schematic representation of the C. perftingens rRNA operon (C, top), indicating the location of the probes used in panels A and B, and the L. monocytogenes 16S rRNA region (C, bottom). Known unique restriction
sites (5)
are
indicated.
........ . . ..........
EcoRI
Pstl
Nrul Smal
0,4 kb region (12, 13). Therefore, it is tempting to speculate that the replication origin of L. monocytogenes lies in the extremity of Not A, which is close to Not F. It is still unknown whether the hly locus which is in Not A lies close to this origin of replication, but it is interesting to note that in C. perfringens, the pfo gene encoding perfringolysin o, a toxin related to listeriolysin 0, as well as other C. perfringens virulence genes, which are absent in other Clostridium species, lie next to the replication origin (1). This finding was unexpected since bacterial replication origin regions were previously known to be genetically very stable, with a low
frequency of mutation (28). Nevertheless, in C. perfringens, this region was shown to be the site of insertions or deletions (reviewed in reference 25). Whether the same evolutionary events have occurred in the genus Listeria is an open question. Finally, the physical map presented here (Fig. 4) is also the first genetic map of L. monocytogenes. Since classical genetic analysis with transducing phages is not available in this species, this map is the first tool available to localize genes on the chromosome and identify unlinked mutations obtained by transposon mutagenesis. ACKNOWLEDGMENTS We thank H. Shuman for suggesting the strategy used to align the NotI fragments; B. Canard, S. Cole, J. Levilliers, and C. Petit for helpful discussions and advice; B. Canard, P. Duwat, and J. C. Perez-Diaz for the gift of probes; P. Mazodier for suggesting the use of TnS as a NotI kanamycin cassette; E. Gouin for help in probe preparation; B. Sheehan for reading the manuscript; and J. Davies for enthusiastic and friendly support. This work was supported by INSERM (CRE 891003), EEC (contract SC1-CT91-0682), the Ministere de l'Agriculture (contract R 91/37), the Company Barry, the CNRS, and the Pasteur Institute.
VOL. 174, 1992
PHYSICAL MAP OF THE L. MONOCYTOGENES CHROMOSOME
REFERENCES 1. Canard, B., and S. T. Cole. 1989. Genome organization of the anaerobic pathogen Clostridium perfringens. Proc. Natl. Acad. Sci. USA 86:6676-6680. 2. Carriere, C., A. Allardet-Servent, G. Bourg, A. Audurier, and M. Ramuz. 1991. DNA polymorphism in strains of Listeria monocytogenes. J. Clin. Microbiol. 29:1351-1355. 3. Casadaban, M. J., and S. N. Cohen. 1980. Analysis of gene control signals by DNA fusion and cloning in Escherichia coli. J. Mol. Biol. 138:179-207. 4. Chu, G., D. Vollrath, and R. W. Davis. 1986. Separation of large DNA molecules by contour-clamped homogeneous electric fields. Science 234:1582-1585. 5. Collins, M. D., S. Wallbanks, D. J. Lane, J. Shah, R. Nietupski, J. Smida, M. Dorsch, and E. Stackebrandt. 1991. Phylogenetic analysis of the genus Listeria based on reverse transcriptase sequencing of 16S rRNA. Int. J. Syst. Bacteriol. 37:266-270. 6. Cossart, P., and J. Mengaud. 1989. Listeria monocytogenes: a model system for the molecular study of intracellular parasitism. Mol. Biol. Med. 6:463-474. 7. Domann, E., and T. Chakraborty. 1989. Nucleotide sequence of the listeriolysin gene from a Listeria monocytogenes serotype 1/2a strain. Nucleic Acids Res. 17:6406. 8. Duwat, P., S. D. Ehrlich, and A. Gruss. 1992. A general method for cloning recA genes of gram-positive bacteria by polymerase chain reaction. J. Bacteriol. 174:5171-5175. 9. Gailiard, J.-L., P. Berche, C. Frehel, E. Gouin, and P. Cossart. 1991. Entry of L. monocytogenes into cells is mediated by internalin, a repeat protein reminiscent of surface antigens from gram-positive cocci. Cell 65:1127-1141. 9a.Garcia del Portillo, F., M. Sanchez-Campillo, F. Baquero, and J. C. Perez-Diaz. 1992. New genes of Listeria monocytogenes presumptively related to pathogenicity, p. 500-505. In B. Witholt, J. E. Alouf, G. J. Boulnois, P. Cossart, B. W. Dijkstra, P. Falmagne, F. J. Fehrenbach, J. Freer, H. Niemann, R. Reffuoli, and T. Wadstrom (ed.), Bacterial protein toxins. Gustav Fisher Verlag, Stuttgart, Germany. 10. Gamier, T., B. Canard, and S. T. Cole. 1991. Cloning, mapping and molecular characterization of the ribosomal operons of Clostridium perfringens. J. Bacteriol. 173:5431-5438. 11. Gohmann, S., M. Leimeister-Wachter, E. Schiltz, W. Goebel, and T. Chakraborty. 1990. Characterization of a Listeria monocytogenes-specific protein capable of inducing delayed hypersensitivity in Listeria-immune mice. Mol. Microbiol. 4:10911099. 12. Heenckes, G., F. Vannier, M. Seiki, N. Ogasawara, S. Yoshikawa, and S. J. Seror-Laurent. 1982. Ribosomal RNA genes in the replication origin region of Bacillus subtilis chromosome. Nature (London) 299:268-271. 13. Jinks-Robertson, S., and M. Nomura. 1987. Ribosomes and tRNA, p. 1358-1385. In F. C. Neidhardt, J. L. Ingraham, K. B. Low, B. Magasanik, M. Schaechter, and H. E. Umbarger, Escherichia coli and Salmonella typhimurium: cellular and molecular biology, vol. 2. American Society for Microbiology, Washington, D.C. 14. Jorgensen, R. A., S. J. Rothstein, and W. S. Reznikoff. 1979. A restriction enzyme cleavage map of Tn5 and location of a region encoding neomycin resistance. Mol. Gen. Genet. 177:65-72. 15. Kocks, C., E. Gouin, M. Tabouret, P. Berche, H. Ohayon, and P. Cossart. 1992. Listeria monocytogenes-induced actin assembly requires the actA gene product, a surface protein. Cell 68:521531.
7103
16. Kohler, S., M. Leimeister-Wichter, T. Chakraborty, F. Lottspeich, and W. Goebel. 1990. The gene coding for protein p60 of Listeria monocytogenes and its use as a specific probe for Listeria monocytogenes. Infect. Immun. 58:1943-1950. 17. Kvenberg, J. E. 1988. Outbreaks of listeriosis/Listeria-contaminated foods. Microbiol. Sci. 5:355-358. 18. Mackaness, G. B. 1962. Cellular resistance to infection. J. Exp. Med. 116:381-406. 19. Mengaud, J., C. Braun-Breton, and P. Cossart. 1991. Identification of a phosphatidylinositol-specific phospholipase C in Listeria monocytogenes: a novel type of virulence factor? Mol. Microbiol. 5:367-372. 20. Mengaud, J., S. Dramsi, E. Gouin, J. A. Vazquez-Boland, G. Milon, and P. Cossart. 1991. Pleiotropic control of Listena monocytogenes virulence factors by a gene which is autoregulated. Mol. Microbiol. 5:2273-2283. 21. Mengaud, J., C. Geoffroy, and P. Cossart. 1991. Identification of a novel operon involved in virulence of Listeria monocytogenes: its first gene encodes a protein homologous to bacterial metalloproteases. Infect. Immun. 59:1043-1049. 22. Mengaud, J., M. F. Vincente, J. Chenevert, J. Moniz Pereira, C. Geoffroy, B. Gicquel-Sanzey, F. Baquero, J. C. Perez-Diaz, and P. Cossart. 1988. Expression in Eschenchia coli and sequence analysis of the listeriolysin 0 determinant of Listeria monocytogenes. Infect. Immun. 56:766-772. 23. Michel, E., K. A. Reich, R. Favier, P. Berche, and P. Cossart. 1990. Attenuated mutants of the intracellular bacterium Listeria monocytogenes obtained by single amino-acid substitutions in listeriolysin 0. Mol. Microbiol. 4:2167-2178. 24. Portnoy, D. A., T. Chakraborty, W. Goebel, and P. Cossart. 1992. Molecular determinants of Listeria monocytogenes pathogenesis. Infect. Immun. 60:1263-1267. 25. Rood, J., and S. Cole. 1991. Molecular genetics and pathogenesis of Clostridium perfringens. Microbiol. Rev. 55:621-648. 26. Schwartz, D. C., and C. R. Cantor. 1984. Separation of yeast chromosome-sized DNAs by pulsed-field gradient gel electrophoresis. Cell 37:65-75. 27. Seeliger, H. P. R., and D. Jones. 1986. Genus Listeria Pirie 1940, 383 AL, p. 1232. In P. H. A. Sneath, N. S. Mair, N. E. Sharpe, and J. Holt (ed.), Bergey's manual of systematic bacteriology, vol. 2. The Williams & Wilkins Co., Baltimore. 28. Sharp, P. M., D. C. Shields, K. H. Wolfe, and W. H. U. 1989. Evolutionary rates in enterobacterial genes vary with chromosomal location. Science 246:808-810. 29. Smith, C. L., and C. R. Cantor. 1986. Approaches to physical mapping of the human genome. Cold Spring Harbor Symp. Quant. Biol. 51:115-122. 30. Smith, C. L., P. E. Warburton, A. Gools, and C. R. Cantor. 1986. Analysis of genome organization by pulsed-field gradient gel electrophoresis, p. 45-70. In J. Setlow and A. Hollaender (ed.), Genetic engineering, vol. 8. Plenum Publishing Corp., New York. 31. Vazquez-Boland, J.-A., C. Kocks, S. Dramsi, H. Ohayon, C. Geoffroy, J. Mengaud, and P. Cossart. 1992. Nucleotide sequence of the lecithinase operon of Listeria monocytogenes and possible role of lecithinase in cell-to-cell spread. Infect. Immun. 60:219-230. 32. Vicente, M. F., J. C. Perez-Diaz, R. Amib, F. Begner, and I. Marin. 1983. Towards a physical map of the Listeria chromosome: the pulse field electrophoresis approach. Acta Microbiol. Hung. 36:193-197.
Vol. 174, No. 22
0021-9193/92/227098-06$02.00/0 Copyright © 1992, American Society for Microbiology
Physical Map of the Listeria monocytogenes Chromosome ERIC MICHEL AND PASCALE COSSART* Laboratoire de Genetique Moleculaire des Listeria and Centre National de la Recherche Scientifique URA 1300, Institut Pasteur, 28 rue du Docteur Roux, Paris 75015, France Received 19 June 1992/Accepted 9 September 1992
The circular physical map of the pathogenic bacterium Listeria monocytogenes L028 (serovar 1/2c) was established by using pulsed-field gel electrophoresis. The L. monocytogenes chromosome contains eight NotI fragments of 1,100, 940, 400, 335, 280, 45, 30, and 20 kb in size and eight Sse8387I fragments of 860, 680, 680, 370, 335, 130, 70, and 25 kb. Therefore, the total length of the genome is 3,150 kb. To order the NotI fragments on the chromosome, we used a strategy which can be of general use. We first cloned chromosomal HindIII or EcoRI fragments in pBR322. DNA extracted from the total libraries was digested by NotI and ligated to a NotI-kanamycin resistance cassette obtained by cutting Tn5 with NotI. After transformation in Escherichia coli, kanamycin-resistant clones originating from NotI-containing EcoRI or HindIH frmMents were isolated. The two EcoRI-NotI or HindM-NotI fragments of each recombinant plasmid were isolated and used as probes on Southern blot hybridizations to identify and link the corresponding NotI fragments. Seven NotI fragments were ordered in this way. The last junction was demonstrated by partial digest analysis. All L. monocytogenes genes identified so far as well as the six rRNA operons were localized on the NotI map. Regions homologous to genes from closely related bacteria were also detected and localized. Southern blot analysis of simple Sse8387I digests or double Sse8387I-NotI digests probed with the various NotI probes allowed us to align the Sse8387I fragments and localize the single SfI site, resulting in the establishment of the first genetic and physical map of the L. monocytogenes chromosome.
The genus Listeria belongs to the nonsporulating and low-G+C-content gram-positive bacteria and is closely related to the genera Streptococcus and Bacillus (27). This genus contains six species, namely, L. monocytogenes, L. ivanovii, L. seeligeri, L. innocua, L. welshimeri, and L. grayi. All of these species can be isolated from a wide variety of soil specimens in the wild and in human and animal environments and are thus considered soil organisms. Of these species, two are pathogenic: L. monocytogenes is pathogenic for humans and animals, whereas L. ivanovii is associated only with animal disease. L. monocytogenes has recently been recognized as a food pathogen after the tracing of listeriosis outbreaks to contaminated food (17), consistent with some peculiar characteristics of L. monocytogenes, i.e., growth at low temperatures (as low as 4°C) and resistance to sodium concentrations above 10%. Clinical features of the disease consist of septicemia, meningitis, and meningoencephalitis characterized by a high mortality rate and abortions. It was discovered in the early 1960s that L. monocytogenes is able to survive in macrophages and that recovery from infection is due to a cellular immune response (18). Since then, the bacterium has been mainly used to study the induction of the cellular immune response. Recently, with the development of genetic tools and in vitro models of infection, L. monocytogenes has emerged as one of the best models for the study of the molecular basis of intracellular parasitism (6). A systematic genetic analysis in conjunction with cell biology observations has led to a precise description of the cell infection process, and several virulence genes have now been identified (for a review, see reference 24). However, a number of issues remain to be addressed, and one of the challenging questions for the future is to determine how two species in the genus Listeria have evolved to *
Corresponding author. 7098
become pathogenic. Such evolutionary considerations can be approached by both detecting pathogenic species-specific sequences and comparing genome organizations. Therefore, we have undertaken physical mapping of the L. monocytogenes chromosome. Since no transduction system is available in L. monocytogenes, the physical map will also be useful for future genetic studies such as the localization of cloned genes, analysis of genomic distribution of loci encoding virulence factors, and characterization of deletion and transposon mutants. MATERIALS AND METHODS DNA preparation. L. monocytogenes L028 was grown to stationary phase in brain heart infusion broth. Washed cells (109 cells per ml) were mixed with an equal volume of 1% low-melting-point agarose (Bethesda Research Laboratories), and the mixture was allowed to solidify in 300-pl rectangular molds (30). After 20 min at 4°C, the agarose plugs were subjected to treatment with enzymes and detergents to digest the bacterial cell wall and proteins. Briefly, plugs were incubated for 24 h at 37°C with gentle shaking in 40 ml of solution containing 6 mM Tris HCI (pH 7.5), 1 M NaCl, 100 mM EDTA (pH 8), 1% Sarkosyl, 0.2% deoxycholate, and lysozyme (2.5 mg/ml). The plugs were deproteinized by incubation in ESP (0.5 M EDTA, 1% Sarkosyl, proteinase K [2 mg/ml], pH 8) for 50 h at 50°C. They were further washed in 40 ml of TE (10 mM Tris HCI [pH 7.5], 1 mM EDTA) three times and were incubated twice for 1 h in 40 ml of TE containing 40 ,g of phenylmethylsulfonyl fluoride per ml at 50°C. The plugs were washed in TE buffer three times and kept at 4°C in 0.5 M EDTA (pH 8). Prior to restriction endonuclease digestion, they were washed in TE for 1 h and equilibrated in 200 pl of the digestion buffer for 0.5 h. Restriction digests. ApaI (GGGCCC), Sall (GTCGAC), NotI (GCGGCCGC), NarI (GGCGCC), NheI (GCTAGC),
VOL. 174, 1992
PHYSICAL MAP OF THE L. MONOCYTOGENES CHROMOSOME
MluI (ACGCGT), NaeI (GCCGGC), XhoI (CTCGAG), XbaI (TCTAGA), SacII (CCGCGG), ClaI (ATCGAT), BamHI (GGATCC), Sacl (GAGCTC), SmaI (CCCGGG), BsshII (GCGCGC), NcoI (CCATGG), Scal (AGTACT), SphI (GCATGC), StuI (AGGCCT), ScaII (CCCCCC), BglI (GC CNNNNNGGC), Sfil (GGCCNNNNNGGCC), EagI (CG GCCG), PvuI (CGATCG), SgrAI (GA/GCCGGT/CG), NnI (TCGCGA), Pacl (TTAATTAA), and Sse8387I (CCTGC AGG) were purchased from Biolabs, Amersham, or Boehringer. DNA samples in agarose (40 pl) were digested with 20 U of enzyme for 4 h (24 h for SfiI) at 37°C (25°C for SmaI and 50°C for SfiI) in 200 ,lI of the buffer recommended by the manufacturer. The reaction was stopped with 200 pl of 0.25 M EDTA. Electrophoresis conditions. DNA digests were submitted to a contour-clamped homogeneous electric field (4, 26). An apparatus purchased from Pharmacia (Uppsala, Sweden) with hexagonal electrodes was routinely used for agarose gel electrophoresis. Chilled agarose plugs were inserted into the wells of a 1.2% agarose gel (15 by 15 cm). Low-melting-point agarose (0.5%) was used to ensure good positioning of the plugs in each well. Electrophoresis in 0.5x Tris-borate-EDTA was performed for 40 to 80 h at 165 V at 8°C, with pulse times of 1 to 200 s. Two different windows of resolution were used, one for medium and large fragments and one for small and medium fragments. For the first, we used pulses of 1 s (for 12 h), 3 s (for 10 h), 20 s (for 10 h), 40 s (for 10 h), 90 s (for 11 h), and 120 s (for 12 h); for the second, we used pulses of 1 s (for 10 h), 3 s (for 6 h), 10 s (for 8 h), 20 s (for 8 h), and 40 s (for 8 h). Lambda concatemers and chromosomes from Saccharomyces cerevisiae (Bio-Rad Laboratories, Richmond, Calif.) were used as size markers. After electrophoresis, gels were stained for 20 min in ethidium bromide (20 ,ug/ml) in electrophoresis buffer, destained for 10 min in water, and photographed. Southern blot hybridization. After electrophoresis, gels were UV irradiated for 5 min at 312 nm to fragment DNA, depurinated for 20 min in 0.25 M HCl, denatured in 0.5 M NaOH-1.5 M NaCl for 45 min, and then neutralized in 0.5 M Tris HCl-1.5 M NaCl (pH 7.5) for 45 min. DNA was transferred to Hybond N ifiters (Amersham) overnight in 20x SSC (lx SSC is 0.15 M NaCl plus 0.015 M sodium citrate) and fixed by UV irradiation for 5 min at 312 nm. Hybridization was performed with 32P-labeled probes (see below). Prehybridization and hybridization were carried out by using the rapid hybridization system of Amersham. Filters were then washed twice for 30 min at 65°C in 2x SSC-0.1% sodium dodecyl sulfate (SDS), once in lx SSC0.1% SDS, and twice in 0.7x SSC-0.1% SDS for 30 min at 65°C. When heterologous probes were used, filters were hybridized and washed under low-stringency conditions as already described (31). The filters were then autoradiographed for 15 to 96 h at -80°C. Preparation of the NotI kanamycin cassette. Plasmid pRZ102 (14) was cleaved with NotI, which cuts twice in the transposon TnS, in the left and right IS50s, giving rise to a 4.6-kb NotI fragment carrying a kanamycin resistance gene. This fragment was purified using a Geneclean kit (Bio 101). Isolation of HindIH or EcoRI junction fragments. L. monocytogenes chromosomal DNA was digested with HindIII or EcoRI and ligated with pBR322 restricted by HindIII or EcoRI and dephosphorylated. After transformation of E. coli MC 1061 (3), all colonies from both libraries were collected by scraping the plates. Plasmid DNA from both libraries was subsequently prepared, cleaved with NotI, and ligated to the
7099
4.6-kb NotI fragment of TnS. After transformation, kanamycin- and ampicillin-resistant clones were selected. DNA probes. DNA fragments obtained after restriction of plasmid DNA, classical agarose gel electrophoresis, and Geneclean purification were used as probes. Alternatively, L. monocytogenes chromosomal DNA fragments were amplified by polymerase chain reaction and the fragments were purified by using a Geneclean kit. Oligonucleotides were synthesized on a Milligen oligonucleotide synthesizer (Millipore). The probe for iap was obtained by polymerase chain reaction by using L. monocytogenes chromosomal DNA with oligonucleotides CTACACAAGCAACTACACCTGC GCC (positions 972 to 996) and CCAGAGCAATCAAAT GTAGTTGGTCC (positions 1610 to 1635) (16). The probe for lmaAB was made in the same way with oligonucleotides GATTATACACCGGGAGCTGCTAAAG (positions 415 to 439 in Gohmann et al. [11]) and GCCCTCAGTAATCGT TAAATCAACAAG (positions 829 to 855 in Gohmann et al. [11]). The probe for hly was a 410-bp HindIlI fragment containing the distal end of the gene (22). The inlA probe was a 1.2-kb HindIII fragment (9). The ctxA probe was an EcoRI fragment kindly provided by J. C. Perez-Diaz. The recA gene probe (8) was a 340-bp fragment kindly provided by P. Duwat. The Clostridium perfingens 16S rRNA and 23S rRNA probes were the HindIII-SmaI fragments of plasmids pBC15 and pBC23, respectively (10) (see Fig. 5C), kindly provided by B. Canard. The 3.5-kb C. perfringens gyrase probe (1) was kindly provided by B. Canard. Probes were labeled with [32P]dCTP at 3,000 Ci mM-1, using the random priming labeling kit of Amersham. Other techniques. The cloning procedures and routine DNA techniques used were described previously (23). RESULTS Estimation of the genome size. The first goal of this project was to evaluate the size of the genome of the clinical strain L. monocytogenes L028 (serotype 1/2c) by using pulsedfield gel electrophoresis (PFGE). L. monocytogenes DNA was cut with restriction endonucleases that were expected to be rare cutters of the genome because of the rather low G+C content (38%) of the DNA. Analysis of the cleavage products by PFGE showed that SalI, NarI, NheI, Mulu, NaeI, XhoI, XbaI, SacII, ClaI, BamHI, SacI, SmaI, BsshII, NcoI, Scal, SphI, StuI, ScaII, BglI, EagI, PvuI, SgrAI, Nrul, and PacI generated many (more than 40) fragments. Cleavage with ApaI resulted in about 35 to 40 fragments, with sizes ranging between 1 and 500 kb. In agreement with preliminary observations (32), NotI reproducibly gave rise to eight fragments of 1,100 (Not A), 940 (Not B), 400 (Not C), 335 (Not D), 280 (Not E), 45 (Not F), 30 (Not G), and 20 (Not H) kb as shown in Fig. 1. Sse8387I also cleaved the chromosome in eight fragments of 860 (Sse A), 680 (Sse B1 and B2), 370 (Sse C), 335 (Sse D), 130 (Sse E), 70 (Sse F), and 25 (Sse G) kb (Fig. 1). Thus, the genome size deduced from these two single digests was evaluated to be 3,150 + 50 kb. Construction of the physical map. The NotI fragments were ordered by using the strategy presented in Fig. 2. Six different plasmids with inserts corresponding to linked NotI fragments were obtained from the EcoRI library, and six were obtained from the HindIII library. After double digestion of the plasmids with NotI and either EcoRI or HindIII, seven nonredundant recombinant plasmids carrying junctions between successive NotI fragments were selected: plasmid pEco32 contained two EcoRI-NotI fragments of 0.58 kb; pEco4l contained two EcoRI-NotI fragments of 0.7
A 2
-4
KI1
.1
Sse'
Soe
It
_
J. BACTERIOL.
MICHEL AND COSSART
7100
A-
-
1H1 SI15 6S0
112-
450
(C. se D)-
2 -
E
Sse
F
-
194
97 -
se
)
G;-
48.5
23.1
Sse (Sse 1)-
Not
C.
Notl )Not 1.-194
Tn5
N,I *Km'
I
*
V-A \
N
N1 I N
Notl
Kmr
*
N
*i
t L-1-
E N
Sse
1 -
St
(G- Not G. Not 11.
NoF
48.5 23.1
9.4
/ E
N
N
N
\
probe2
N
N
1,100
Not B
940
Not C
400
Not D
335
Not E
280
Not F Not G
45 30
Not H
20
Sse A
860
Plasmid(s) used
Gene(s)
for alignment"
pHind39 (0.8)
pEco32 (0.58), pEco5O (1.2) pHind39 (1.7), pEco4l (3) pEco4 (7), pEco5O (2.5) pEco4l (0.7), pEco32 (0.58) pEcol9 (4.3) pEcol9 (1.8), pEcol8 (4) pEco4 (0.85), pEcol8 (1.45)
hly locus, lmaAB; inlAB, gyr recA, rrn
iap
cixA
rrn
hly locus, lmaAB,
inlAB, rm, gyr cixA, rm 680 recA 680 rn 370 335 Uap 130 70 25 a The size of the HindIII-NotI or EcoRI-NotI probe in kilobases is indicated
Sse Bi Sse B2 Sse C Sse D Sse E Sse F Sse G
in parentheses.
E fE
probe l
Not A
(kb)
97
and 3 kb; pEcoSO contained two EcoRI-NotI fragments of 1.2 and 2.5 kb; pEcoi8 contained two EcoRI-NotI fragments of 1.45 and 4 kb; pEcol9 contained two EcoRI-NotI fragments of 1.8 and 4.3 kb; pEco4 contained two EcoRI-NotI
N
Size
-450
FIG. 1. PFGE of L. monocytogenes L028 chromosomal DNA digested with NotI (lane 1), NotI and Sse8387I (lane 2), and Sse83871 (lane 3). In lane 4, S. cerevisiae chromosomes and lambda concatemers used as size markers were deposited in the gel as half-agarose plugs. Panels A and B correspond to two different windows of resolution (see Material and Methods). The names of the fragments have been indicated to the left of each panel.
EcoRI
Fragment K})
ise F.-
SSt
Sse
TABLE 1. Specific features of L. monocytogenes L028 NotI and Sse8387I fragments
B
E
FIG. 2. Strategy used to isolate linking probes. E, EcoRI sites; N, NotI sites; *, HindIll sites.
fragments of 0.85 and 7 kb; and pHind 39 contained two HindIII-NotI fragments of 0.8 and 1.7 kb (Table 1). The EcoRI-NotI or HindIII-NotI fragments were then purified and used to probe membranes onto which NotI digests of chromosomal DNA had been transferred. The two fragments originating from pEco32 hybridized with fragments Not E and B, those of pHind39 hybridized with fragments Not A and C, the two fragments of pEco41 hybridized with fragments Not E and C, those originating from pEcoSO hybridized with Not D and B, those from pEco4 hybridized with Not H and D, those from pEcoi8 hybridized with Not H and G, and those of pEcol9 hybridized with Not G and F. Therefore, fragments Not A, C, E, B, D, H, G, and F were aligned, in the order given. Linkage of Not F and A was shown by use of a partial digestion analysis. Thus, total chromosomal DNA was partially digested with NotI, submitted to PFGE, and transferred. The membrane was probed with the 4.3-kb EcoRI-NotI fragment of pEcol9 (Fig. 3). This resulted in the unambiguous labeling of the largest NotI fragment, Not A, whose size increased 45 kb, confirming that Not F was next to Not A and thus demonstrating the circularity of the chromosome. The Sse8387I fragments were aligned by analysis of Southern blots after simple Sse8387I or double Sse8387I-NotI digestions by using a combination of probes originating from the plasmids used for the alignments of the Notl fragments as well as gene probes (see below). A single Sfil site was localized in the same way. All of these results confirmed the circularity of the chromosome. The resulting physical map of the circular genome of L. monocytogenes is given in Fig. 4. Mapping of virulence factors genes and other genes. Few L. monocytogenes genes have been isolated. All of these genes are more or less involved in virulence (for a review, see reference 24). Probes for each of these genes were used to locate them on the physical map (Fig. 4). We localized on
PHYSICAL MAP OF THE L. MONOCYTOGENES CHROMOSOME
VOL. 174, 1992 1
2
3
4
5
6
7
8
9
10
3500 kb-
.zF
4-
Not A+Not F
-940 kh
kb ~~~~~~~~~~~~-815
FIG.
I.
PFGE
and
Southe
blot
digestion of the L. monocytogenes a Not F-specific probe. Lanes: 1
Sacchamomycespombe
analysis
of
partial probed with
NotI
a
chromosome DNA
and 10, yeast chromosomes of
and S. cerevisiae,
respectively,
used
as
(22),
the
hly
locus which contains the
p1cA -prfA
operon
(19, 20),
listeriolysin and
the
0 gene
lecithinase
(31), which itself consists of mpl (7, 21) (a gene coding for a metalloprotease), actA (a gene involved in actin polymerization) (15), and plcB (the gene coding for the lecithinase). The inl locus, which encodes internalin, a protein involved in entry of L. monocytogenes into epithelial cells (9), and the lmaAB operon (11) also mapped to Not A. Gene iap (16) mapped to Not C. The gene homologous to the cixA toxidn gene of Vibrio cholerae (9a) mapped to Not D. The recA gene (8) was mapped to Not B and Sse B2. By using low-stringency conditions of hybridization, we localoperon
hly locus, gyr, lmaAB, inLUB, \ rnn
recA
rrn
ml
ized a gene homologous to the gyrA gene of C perfringens on Not A and Sse A (1). Mapping of rRNA operons. The number of rRNA operons was established by Southern blot analysis of total chromosomal DNA digested with a panel of restriction enzymes, using as probes two DNA fragments specific for the 16S and 23S rRNA genes of C. perfringens (10). This study was facilitated by knowledge of the total sequence of the 16S rRNA gene of L. monocytogenes (5). This gene contains several unique restriction sites, namely, SmaI, NruI, PstI, and EcoRI, and does not contain cleavage sites for HpaI and EcoRV. Southern blot analysis of the restriction pattern with HpaI or EcoRV resulted in exactly the same six-band pattern with the two 16S or 23S rRNA probes (Fig. 5A and B, lanes 7 and 8), suggesting the presence of six rRNA operons. This was confirmed by all digestions. For example, six fragments hybridizing to the 16S rRNA probe were obtained with PstI, NruI, HindIII, and EcoRV. The six operons were localized to the two contiguous NotI fragments Not A and F, to Not B, and to three contiguous Sse83871 fragments, Sse A, Bi, and C.
size
markers; 2, native L028 DNA; 3 to 9, L028 DNA digested with increasing doses of NotI (lane 3, 0.1 U; lane 4, 0.2 U; lane 5, 0.5 U; lane 6, 1 U; lane 7, 2 U; lane 8, 9 U; lane 9, 36 U). The position of the Not A+F fragment is indicated by an arrow.
Not A the
7101
ctxA
FIG. 4. Physical and genetic map of the L. monocytogenes circular chromosome. The external intervals correspond to NotI fragments, the intermediate ones correspond to Sse83871 fragments, and the last inner circle indicates the location of the unique SfiI site. Intervals where genes have been located are indicated by arcs outside the circular map.
DISCUSSION In this work, we have established that the size of the L. monocytogenes L028 (serovar 1/2c) chromosome is 3,150 kb. Circularity of the genome was demonstrated by using linking clones containing the ends of contiguous NotI fragments and partial digest analysis. The genome size is similar to that of C. perfringens (3,600 kb) (1). A recent report describing restriction digests of several L. monocytogenes strains indicated that the genome size varies between serovars of L. monocytogenes but that the genome is always smaller than 2,750 kb (2). This is not in agreement with our results and is probably due to technical problems with the resolution of comigrating bands in PFGE. The use of linking clones to order fragments was first proposed in 1986 (29, 30). The strategy that we used took advantage of the presence of two NotI sites located at each end of TnS. By this technique, we cloned EcoRI or HindIII fragments containing all but one of the NotI sites of the Listeria chromosome. The reason we did not get one of the NotI sites is probably due to the fact that the corresponding EcoRI or HindIII fragments were too large to be cloned in pBR322. It is to be noted that in this strategy, if two unlinked NotI-containing fragments are coligated, they lead to aberrant linking clones. We obtained such a clone, but the ambiguity was easily solved by the detection of two types of linking plasmids possessing the same EcoRI-NotI fragment and the subsequent analysis of the Sse8387I digests. Several genes were mapped on the chromosome. However, clusters of virulence genes could not be identified because of the small number of genes available and the large size of the NotI and Sse8387I fragments containing those genes. Such an analysis would require establishment of a map with smaller arbitrary intervals, an absolute prerequisite to establish a precise genetic map of the genome. This is in progress in our laboratory. Six putative rRNA operons were detected on the basis of homology with C. perfringens rRNA genes. This value is not in agreement with a previous evaluation (2). The putative ribosomal operons were localized in two parts of the chromosome, most of them being clustered in one portion of the chromosome. Clustering of ribosomal operons has been reported in a number of cases, and the origin of replication has in some cases been localized within the ribosomal gene
MICHEL AND COSSART
7102
1 2
A
3 4 5 6
8 9 10 1I 12 13
7
p
1 2
Rf OMP
3 4
5
lw,
6
kb
."L
( 10 I(1
7
w
kb 23,1
J. BACTERIOL.
12 13
,zl,
w^5 ...Xri **a....*
^ i
.#.
23,1
-
i_ _
_!'
omm
9,4 6,5 4,3 -
A.
994 6,5
..
2_ *so*
4,3
..,:
W ."*Am
law _ M ._
me0o 04.
2,3 2
2,3 2 .:
w
*,
__ j_ _.
._
4-
......
i4KX
,z4v.;:,., :.:. :.
40.'wk'
..
-I
0,5
0,5
FIG. 5. Ribosomal operon analysis. Southern blot analysis of L. monocytogenes chromosomal DNA restricted with EcoRI (lane 1),
C C.perfringens 23s rRNA
16s rRNA
5s
RNA 11 l
......
HindlIl
Smal
SmaI
HindlIl
pBC23
pBC15
1
kb
L.monocytogenes 16s rRNA
PstI (lane 2), NruI (lane 3), HindIII (lane 4), BglII (lane 5), Sacl (lane 6), HpaI (lane 7), EcoRV (lane 8), BamHI (lane 9), SmaI (lane 10), SmaI and HindIII (lane 11), SmaI and SacI (lane 12), and SmaI and HpaI (lane 13), probed with pBC15 (A), a probe which is specific for the 16S rRNA gene, and with pBC23 (B), a 23S rRNA gene-specific probe (10), is shown as well as a schematic representation of the C. perftingens rRNA operon (C, top), indicating the location of the probes used in panels A and B, and the L. monocytogenes 16S rRNA region (C, bottom). Known unique restriction
sites (5)
are
indicated.
........ . . ..........
EcoRI
Pstl
Nrul Smal
0,4 kb region (12, 13). Therefore, it is tempting to speculate that the replication origin of L. monocytogenes lies in the extremity of Not A, which is close to Not F. It is still unknown whether the hly locus which is in Not A lies close to this origin of replication, but it is interesting to note that in C. perfringens, the pfo gene encoding perfringolysin o, a toxin related to listeriolysin 0, as well as other C. perfringens virulence genes, which are absent in other Clostridium species, lie next to the replication origin (1). This finding was unexpected since bacterial replication origin regions were previously known to be genetically very stable, with a low
frequency of mutation (28). Nevertheless, in C. perfringens, this region was shown to be the site of insertions or deletions (reviewed in reference 25). Whether the same evolutionary events have occurred in the genus Listeria is an open question. Finally, the physical map presented here (Fig. 4) is also the first genetic map of L. monocytogenes. Since classical genetic analysis with transducing phages is not available in this species, this map is the first tool available to localize genes on the chromosome and identify unlinked mutations obtained by transposon mutagenesis. ACKNOWLEDGMENTS We thank H. Shuman for suggesting the strategy used to align the NotI fragments; B. Canard, S. Cole, J. Levilliers, and C. Petit for helpful discussions and advice; B. Canard, P. Duwat, and J. C. Perez-Diaz for the gift of probes; P. Mazodier for suggesting the use of TnS as a NotI kanamycin cassette; E. Gouin for help in probe preparation; B. Sheehan for reading the manuscript; and J. Davies for enthusiastic and friendly support. This work was supported by INSERM (CRE 891003), EEC (contract SC1-CT91-0682), the Ministere de l'Agriculture (contract R 91/37), the Company Barry, the CNRS, and the Pasteur Institute.
VOL. 174, 1992
PHYSICAL MAP OF THE L. MONOCYTOGENES CHROMOSOME
REFERENCES 1. Canard, B., and S. T. Cole. 1989. Genome organization of the anaerobic pathogen Clostridium perfringens. Proc. Natl. Acad. Sci. USA 86:6676-6680. 2. Carriere, C., A. Allardet-Servent, G. Bourg, A. Audurier, and M. Ramuz. 1991. DNA polymorphism in strains of Listeria monocytogenes. J. Clin. Microbiol. 29:1351-1355. 3. Casadaban, M. J., and S. N. Cohen. 1980. Analysis of gene control signals by DNA fusion and cloning in Escherichia coli. J. Mol. Biol. 138:179-207. 4. Chu, G., D. Vollrath, and R. W. Davis. 1986. Separation of large DNA molecules by contour-clamped homogeneous electric fields. Science 234:1582-1585. 5. Collins, M. D., S. Wallbanks, D. J. Lane, J. Shah, R. Nietupski, J. Smida, M. Dorsch, and E. Stackebrandt. 1991. Phylogenetic analysis of the genus Listeria based on reverse transcriptase sequencing of 16S rRNA. Int. J. Syst. Bacteriol. 37:266-270. 6. Cossart, P., and J. Mengaud. 1989. Listeria monocytogenes: a model system for the molecular study of intracellular parasitism. Mol. Biol. Med. 6:463-474. 7. Domann, E., and T. Chakraborty. 1989. Nucleotide sequence of the listeriolysin gene from a Listeria monocytogenes serotype 1/2a strain. Nucleic Acids Res. 17:6406. 8. Duwat, P., S. D. Ehrlich, and A. Gruss. 1992. A general method for cloning recA genes of gram-positive bacteria by polymerase chain reaction. J. Bacteriol. 174:5171-5175. 9. Gailiard, J.-L., P. Berche, C. Frehel, E. Gouin, and P. Cossart. 1991. Entry of L. monocytogenes into cells is mediated by internalin, a repeat protein reminiscent of surface antigens from gram-positive cocci. Cell 65:1127-1141. 9a.Garcia del Portillo, F., M. Sanchez-Campillo, F. Baquero, and J. C. Perez-Diaz. 1992. New genes of Listeria monocytogenes presumptively related to pathogenicity, p. 500-505. In B. Witholt, J. E. Alouf, G. J. Boulnois, P. Cossart, B. W. Dijkstra, P. Falmagne, F. J. Fehrenbach, J. Freer, H. Niemann, R. Reffuoli, and T. Wadstrom (ed.), Bacterial protein toxins. Gustav Fisher Verlag, Stuttgart, Germany. 10. Gamier, T., B. Canard, and S. T. Cole. 1991. Cloning, mapping and molecular characterization of the ribosomal operons of Clostridium perfringens. J. Bacteriol. 173:5431-5438. 11. Gohmann, S., M. Leimeister-Wachter, E. Schiltz, W. Goebel, and T. Chakraborty. 1990. Characterization of a Listeria monocytogenes-specific protein capable of inducing delayed hypersensitivity in Listeria-immune mice. Mol. Microbiol. 4:10911099. 12. Heenckes, G., F. Vannier, M. Seiki, N. Ogasawara, S. Yoshikawa, and S. J. Seror-Laurent. 1982. Ribosomal RNA genes in the replication origin region of Bacillus subtilis chromosome. Nature (London) 299:268-271. 13. Jinks-Robertson, S., and M. Nomura. 1987. Ribosomes and tRNA, p. 1358-1385. In F. C. Neidhardt, J. L. Ingraham, K. B. Low, B. Magasanik, M. Schaechter, and H. E. Umbarger, Escherichia coli and Salmonella typhimurium: cellular and molecular biology, vol. 2. American Society for Microbiology, Washington, D.C. 14. Jorgensen, R. A., S. J. Rothstein, and W. S. Reznikoff. 1979. A restriction enzyme cleavage map of Tn5 and location of a region encoding neomycin resistance. Mol. Gen. Genet. 177:65-72. 15. Kocks, C., E. Gouin, M. Tabouret, P. Berche, H. Ohayon, and P. Cossart. 1992. Listeria monocytogenes-induced actin assembly requires the actA gene product, a surface protein. Cell 68:521531.
7103
16. Kohler, S., M. Leimeister-Wichter, T. Chakraborty, F. Lottspeich, and W. Goebel. 1990. The gene coding for protein p60 of Listeria monocytogenes and its use as a specific probe for Listeria monocytogenes. Infect. Immun. 58:1943-1950. 17. Kvenberg, J. E. 1988. Outbreaks of listeriosis/Listeria-contaminated foods. Microbiol. Sci. 5:355-358. 18. Mackaness, G. B. 1962. Cellular resistance to infection. J. Exp. Med. 116:381-406. 19. Mengaud, J., C. Braun-Breton, and P. Cossart. 1991. Identification of a phosphatidylinositol-specific phospholipase C in Listeria monocytogenes: a novel type of virulence factor? Mol. Microbiol. 5:367-372. 20. Mengaud, J., S. Dramsi, E. Gouin, J. A. Vazquez-Boland, G. Milon, and P. Cossart. 1991. Pleiotropic control of Listena monocytogenes virulence factors by a gene which is autoregulated. Mol. Microbiol. 5:2273-2283. 21. Mengaud, J., C. Geoffroy, and P. Cossart. 1991. Identification of a novel operon involved in virulence of Listeria monocytogenes: its first gene encodes a protein homologous to bacterial metalloproteases. Infect. Immun. 59:1043-1049. 22. Mengaud, J., M. F. Vincente, J. Chenevert, J. Moniz Pereira, C. Geoffroy, B. Gicquel-Sanzey, F. Baquero, J. C. Perez-Diaz, and P. Cossart. 1988. Expression in Eschenchia coli and sequence analysis of the listeriolysin 0 determinant of Listeria monocytogenes. Infect. Immun. 56:766-772. 23. Michel, E., K. A. Reich, R. Favier, P. Berche, and P. Cossart. 1990. Attenuated mutants of the intracellular bacterium Listeria monocytogenes obtained by single amino-acid substitutions in listeriolysin 0. Mol. Microbiol. 4:2167-2178. 24. Portnoy, D. A., T. Chakraborty, W. Goebel, and P. Cossart. 1992. Molecular determinants of Listeria monocytogenes pathogenesis. Infect. Immun. 60:1263-1267. 25. Rood, J., and S. Cole. 1991. Molecular genetics and pathogenesis of Clostridium perfringens. Microbiol. Rev. 55:621-648. 26. Schwartz, D. C., and C. R. Cantor. 1984. Separation of yeast chromosome-sized DNAs by pulsed-field gradient gel electrophoresis. Cell 37:65-75. 27. Seeliger, H. P. R., and D. Jones. 1986. Genus Listeria Pirie 1940, 383 AL, p. 1232. In P. H. A. Sneath, N. S. Mair, N. E. Sharpe, and J. Holt (ed.), Bergey's manual of systematic bacteriology, vol. 2. The Williams & Wilkins Co., Baltimore. 28. Sharp, P. M., D. C. Shields, K. H. Wolfe, and W. H. U. 1989. Evolutionary rates in enterobacterial genes vary with chromosomal location. Science 246:808-810. 29. Smith, C. L., and C. R. Cantor. 1986. Approaches to physical mapping of the human genome. Cold Spring Harbor Symp. Quant. Biol. 51:115-122. 30. Smith, C. L., P. E. Warburton, A. Gools, and C. R. Cantor. 1986. Analysis of genome organization by pulsed-field gradient gel electrophoresis, p. 45-70. In J. Setlow and A. Hollaender (ed.), Genetic engineering, vol. 8. Plenum Publishing Corp., New York. 31. Vazquez-Boland, J.-A., C. Kocks, S. Dramsi, H. Ohayon, C. Geoffroy, J. Mengaud, and P. Cossart. 1992. Nucleotide sequence of the lecithinase operon of Listeria monocytogenes and possible role of lecithinase in cell-to-cell spread. Infect. Immun. 60:219-230. 32. Vicente, M. F., J. C. Perez-Diaz, R. Amib, F. Begner, and I. Marin. 1983. Towards a physical map of the Listeria chromosome: the pulse field electrophoresis approach. Acta Microbiol. Hung. 36:193-197.
