Journal of Parasitology Phylogenetic analysis using the 28S rRNA gene reveals that the genus Paracreptotrema Choudhury, Pérez-Ponce de León, Brooks and Daverdin, 2006 (Digenea: Allocreadiidae) is not monophyletic; description of two new genera and one new species. --Manuscript Draft-Manuscript Number:

15-815R1

Full Title:

Phylogenetic analysis using the 28S rRNA gene reveals that the genus Paracreptotrema Choudhury, Pérez-Ponce de León, Brooks and Daverdin, 2006 (Digenea: Allocreadiidae) is not monophyletic; description of two new genera and one new species.

Short Title:

Molecular Phylogeny of Paracrepototrema (Allocreadiidae)

Article Type:

Regular Article

Corresponding Author:

Gerardo Perez-Ponce de Leon, Dr. Universidad Nacional Autónoma de México Mexico, D.F. MEXICO

Corresponding Author Secondary Information: Corresponding Author's Institution:

Universidad Nacional Autónoma de México

Corresponding Author's Secondary Institution: First Author:

Gerardo Perez-Ponce de Leon, Dr.

First Author Secondary Information: Order of Authors:

Gerardo Perez-Ponce de Leon, Dr. Carlos Daniel Pinacho-Pinacho, MSc Berenit Mendoza-Garfias, MSc Anindo Choudhury, PhD Martin Garcia-Varela, PhD

Order of Authors Secondary Information: Abstract:

TThis study investigates the systematics of Paracreptotrema Choudhury, Pérez-Ponce de León, Brooks and Daverdin, 2006 using morphological data (stained whole-mounts and Scanning Electron Microscopy) and partial sequences of the 28S rRNA gene, obtained from freshly collected material. In total, 484 specimens representing 4 species, i.e., Paracreptotrema blancoi (157), Paracreptotrema profundulusi (12), Paracreptotrema rosenthali (8), and Paracreptotrema blancoi sensu SalgadoMaldonado et al. (2011) (307) were collected. Existing museum depositions were also studied. The 28S rRNA gene sequences of these Paracreptotrema spp. were aligned, along with sequences from 22 other allocreadiids and 4 other non-allocreadiid xiphidiatan species. Bayesian (BI) and Maximum Likelihood analyses indicated a paraphyletic Paracreptotrema split into 3 clades; 1 comprising P. blancoi and P. rosenthali that was sister to a clade formed by 3 other species of allocreadiids (species of Wallinia, Creptotrematina and Auriculostoma) typically found in characid fishes, a second clade formed solely by Paracreptotrema heterandriae as the sister taxon of the aforementioned species, and a third by P. profundulusi and specimens erroneously identified as P. blancoi. Two new taxa were erected to reflect these results; Paracreptotrematoides for P. heterandriae, and Pseudoparacreptotrema for P. profundulusi and P. macroacetabulata (the species erroneously identified as P. blancoi from profundulids across Middle-America). Closer consideration of the morphology corroborate these findings. The revised systematics also indicated that Paracreptotrema spp. are found in poeciliids, whereas Pseudoparacreptotrema spp. parasitize profundulids. The study demonstrates the value of an integrative taxonomy Powered by Editorial Manager® and ProduXion Manager® from Aries Systems Corporation

approach to address the apparently complicated systematics of the allocreadiids.

Powered by Editorial Manager® and ProduXion Manager® from Aries Systems Corporation

Manuscript

Click here to download Manuscript 15-815R1 AP doc 11-9-15.doc

PÉREZ-PONCE DE LEÓN ET AL.-MOLECULAR PHYLOGENY OF PARACREPTOTREMA (ALLOCREADIIDAE) PHYLOGENETIC ANAYLSIS USING THE 28S rRNA GENE REVEALS THAT THE GENUS PARACREPTOTREMA (DIGENEA: ALLOCREADIIDAE) IS NOT MONOPHYLETIC; DESCRIPTION OF TWO NEW GENERA AND ONE NEW SPECIES Gerardo Pérez-Ponce de León, Carlos D. Pinacho-Pinacho, Berenit Mendoza-Garfias, Anindo Choudhury*, and Martín García-Varela Instituto de Biología, Universidad Nacional Autónoma de México. Ap. Postal 70-153. C.P. 04510, México D.F., México. Correspondence should be sent to: [email protected] ABSTRACT: This study investigates the systematics of Paracreptotrema Choudhury, PérezPonce de León, Brooks and Daverdin, 2006 using morphological data (stained whole-mounts and Scanning Electron Microscopy) and partial sequences of the 28S rRNA gene, obtained from freshly collected material. In total, 484 specimens representing 4 species, i.e., Paracreptotrema blancoi (157), Paracreptotrema profundulusi (12), Paracreptotrema rosenthali (8), and Paracreptotrema blancoi sensu Salgado-Maldonado et al. (2011) (307) were collected. Existing museum depositions were also studied. The 28S rRNA gene sequences of these Paracreptotrema spp. were aligned, along with sequences from 22 other allocreadiids and 4 other non-allocreadiid xiphidiatan species. Bayesian (BI) and Maximum Likelihood analyses indicated a paraphyletic Paracreptotrema split into 3 clades; 1 comprising P. blancoi and P. rosenthali that was sister to a clade formed by 3 other species of allocreadiids (species of Wallinia, Creptotrematina and Auriculostoma) typically found in characid fishes, a second clade formed solely by Paracreptotrema heterandriae as the sister taxon of the aforementioned species, and a third by P. profundulusi and specimens erroneously identified as P. blancoi. Two new taxa were erected to reflect these results;

1

Paracreptotrematoides for P. heterandriae, and Pseudoparacreptotrema for P. profundulusi and P. macroacetabulata (the species erroneously identified as P. blancoi from profundulids across Middle-America). Closer consideration of the morphology corroborate these findings. The revised systematics also indicated that Paracreptotrema spp. are found in poeciliids, whereas Pseudoparacreptotrema spp. parasitize profundulids. The study demonstrates the value of an integrative taxonomy approach to address the apparently complicated systematics of the allocreadiids. The allocreadiid genus Paracreptotrema was established by Choudhury et al. (2006) for Paracreptotrema blancoi Choudhury, Pérez-Ponce de León, Brooks and Daverdin, 2006, an intestinal parasite of the poeciliid Priapichthys annectens (Regan, 1907) from the Río Orosí, Guanacaste Province, Costa Rica. In the same study, Fellodistomum mendezi Sogandares-Bernal, 1955, a parasite of the poeciliid Brachyrhaphis episcopi (Steindachner, 1878) from Gatun Lake in Panama, was transferred to Paracreptotrema. Subsequently, 3 other congeners were described, all from Mexico: Paracreptotrema profundulusi SalgadoMaldonado, Caspeta-Mandujano and Martínez-Ramírez, 2011, in killifishes Profundulus punctatus (Günther, 1866) and P. balsanus Ahl 1935 from the Tehuantepec and Atoyac-Verde River basins respectively; P. heterandriae Salgado-Maldonado, Caspeta-Mandujano and Vázquez, 2012, in the poeciliid Pseudoxiphophorus bimaculatus (Heckel, 1848) from the Antigua River basin, in Veracruz, and, P. rosenthali Bautista-Hernández, Monks, PulidoFlores, and Miranda, 2015 in 2 poeciliids, Xiphophorus malinche Rauchenberger, Kallman and Morizot, 1990, and Pseudoxiphophorus jonesii (Günther, 1874), from the Malila River, of the Panuco River basin, (Salgado-Maldonado et al., 2011, 2012; Bautista-Hernández et al., 2015). In addition, Salgado-Maldonado et al. (2011) reported P. blancoi in 3 species of Profundulus Hubbs, 1924 from the Tehuantepec, Atoyac-Verde and Papagayo River basins, and in some localities sympatrically with P. profundulusi. Pinacho-Pinacho et al. (2014) also

2

reported P. blancoi, from 7 localities in separate River basins of the Oaxacan lowlands. Salgado-Maldonado et al. (2014) expanded the host and distribution records of P. blancoi, in 4 species of Profundulus from localities in Oaxaca and Chiapas, Mexico, and in Guatemala, and El Salvador. In a recent comprehensive checklist of helminth parasites of profundulids (Pinacho-Pinacho et al., 2015) P. blancoi is listed as occurring in 8 species of Profundulus, and in 38 localities across Middle-America. Thus, the genus currently comprises 5 species that parasitize cyprinodontiform fishes in Middle-America; the distribution range extends from Gatun Lake in Panama in the south, northwards to the Papagayo River basin in Guerrero, and from the southwestern Pacific slope of Mexico in the west to La Antigua and Panuco River basins in Veracruz, on the Atlantic slope of Mexico. All 5 species of Paracreptotrema were described from stained whole mounts and without the benefit of molecular data or surface ultrastructure information (SEM studies). The reportedly wide distribution of P. blancoi prompted us to examine specimens reported by Salgado-Maldonado et al. (2011), deposited in the Colección Nacional de Helmintos (CNHE), Mexico City; our observations suggested that these specimens may not be of P. blancoi, and raised questions about some of the morphological characters used to distinguish species of Paracreptotrema. Over the past several months, we sampled freshwater cyprinodontiforms (species of Profundulidae and Poeciliidae) in several areas of Middle-America, including localities in Guatemala, Honduras, Costa Rica, and southern Mexico (in rivers across the states of Hidalgo, Oaxaca, and Chiapas), where species of Paracreptotrema have been reported. As a matter of convenience, in this paper we use Middle-America for the region between the southern boundary of the Nearctic biogeographic region in Mexico and the southern border of Panama in Central America, thereby avoiding current controversy over the term Mesoamerica (Winkler, 2011; Sánchez-González et al., 2013). Our sampling included the type hosts and

3

localities of P. profundulusi, and P. rosenthali, both in Mexico, and P. blancoi in Costa Rica, which allowed us to reassess relationships among members of the genus and their position within the Allocreadiidae. In addition, we examined the ultrastructure of the body surface using SEM. The results of the phylogenetic analysis and morphological studies as well as an assessment of host associations and biogeography, required a revision of the classification and nomenclature; 2 new genera had to be erected to accommodate species of Paracreptotrema collected either from poeciliids (Pseudoxiphophorus bimaculatus) or from profundulids (Profundulus spp.) in rivers of the Atlantic or Pacific ocean slopes across Mexico, Guatemala and Honduras. We also describe a new species within 1 of the new genera, for some of the material identified as P. blancoi by Salgado-Maldonado et al. (2011). Additionally, we update the phylogenetic tree of the Allocreadiidae, based on sequences of the 28S rRNA gene, and discuss some aspects of the classification of the family, including the systematic position of Paracreptotrema and the new genera. MATERIALS AND METHODS Specimen collection From November 2012 through February 2015, 186 individuals representing 8 species of Profundulus were sampled in 18 localities from southern Mexico through Guatemala, to Honduras (comprising almost the entire longitudinal distribution range of the genus in Middle-America); additionally, 32 individuals of 2 poeciliid (Poeciliidae) species, Priapichthys annectens and Xiphophorus malinche, were collected in Costa Rica, Mexico respectively) (Table I; Fig. 1). Fish were electro-fished, transported alive to the laboratory, killed by pithing, and immediately examined for helminths. Digeneans were removed from the digestive tract of their hosts. Some worms were fixed by sudden immersion in hot (steaming) 4% formalin without flattening, and stored in 4% formalin for morphological observations; others were

4

washed twice with clean saline solution, and immediately preserved in 100% ethanol. Specimens for morphology were stained with Mayer’s paracarmine or Gomori´s trichrome, dehydrated in graded ethanol series, cleared in methyl salicylate and mounted as permanent slides using Canada balsam. Drawings were made with the aid of a drawing tube. Measurements of the descriptions are presented in micrometers (µm) with the range followed by the mean, and standard deviation, in parentheses. Some individuals were preserved in 4% formalin, dehydrated through a graded series of ethyl alcohol and then critical point dried with carbon dioxide. These specimens were mounted on metal stubs with silver paste, coated with gold and examined in a Hitachi Stereoscan Model SU1510 (Hitachi High-Technologies Mexico S.A.de C.V, Mexico) at 10 kV. Specimens of P. blancoi from Costa Rica, P. rosenthali from Hidalgo, Mexico, and those of the new species from Profundulus spp. in Mexico, Guatemala and Honduras were deposited in the Colección Nacional de Helmintos (CNHE), Instituto de Biología, Universidad Nacional Autónoma de México (UNAM). The following museum specimens were examined (accession numbers are preceded by the museum abbreviations and the number of specimens examined are in parentheses): Fellodistomum mendezi, NMNH 37482 (holotype and paratype); Paracreptotrema heterandriae, CNHE 8238 (holotype), 8239-8247 (30 paratypes), 8862 (1 voucher); Smithsonian National Museum of Natural History, Washington, D.C. (NMNH) 107881 (1 voucher); P. profundulusi CNHE 7680 (holotype), 7681-7683 (23 paratypes); P. blancoi, NMNH 97785 (holotype), NMNH 97786-97789 (10 paratypes), CNHE 5315 (2 paratypes), P. rosenthali CNHE 9263 (holotype), 9265-9266 (3 paratypes). Finally, voucher specimens identified as P. blancoi (after Salgado-Maldonado et al., 2011), deposited at the CNHE 7684-7694 (52 specimens) were also studied. DNA extraction, PCR amplification and sequencing

5

Forty-five individuals of Paracreptotrema spp. (3 of P. profundulusi, 32 of P. blancoi sensu Salgado -Maldonado et al. (2011) from localities in Mexico, Guatemala and Honduras, 8 of P. blancoi from Costa Rica [5 from the type locality in Guanacaste, Costa Rica, 3 from Quebrada Plata], and 2 of P. rosenthali from the type locality in Hidalgo, México) were digested overnight at 56 C in a solution containing 10mM Tris-HCl (pH 7.6), 20 mM NaCl, 100mM Na2 EDTA (pH 8.0), 1% Sarkosyl, and 0.1mg/ml proteinase K. After digestion, DNA was extracted using DNAzol reagent (Molecular Research Center, Cincinnati, Ohio) according with manufacturer´s instructions. Around 1,300 bp of the 28S rRNA gene (including the domains D1-D3) were amplified by PCR using forward primer BD3 (5´GAACATCGACATCTTGAACG -3´) (Hernández-Mena et al., 2014) and reverse primer 536 (5´- CAGCTATCCTGAGGGAAAC-3´) (García-Varela and Nadler, 2005). PCR cycling parameters for 28S rRNA amplifications included denaturation at 94 C for 1 min, followed by 35 cycles of 94 C for 1 min, annealing at 50 C for 1 min, and extension at 72 C for 1 min, followed by a post-amplification incubation at 72 C for 10 min. Gene sequencing reactions were performed using the forward and reverse primers mentioned above and 4 internal primers 504 (5’– CGTCTTGAAACACGGACTAAGG-3’) 502 (5’– CAAGTACCGTGAGGGAAAGTTGC-3’) (García-Varela and Nadler, 2005) 503 (5’– CCTTGGTCCGTGTTTCAAGACG-3’) (Stock et al., 2007) BD2 (5’– TATGCTTAAATTCAGCGGGT-3’) (Luton et al.,1992). Contigs were assembled and basecalling differences resolved using Codoncode Aligner version 5.0.2 (Codoncode Corporation, Dedham, Massachusetts). Sequences of 28S rRNA gene generated in this study were deposited in GenBank with accession numbers KT833279-KT833323. Additionally, sequences of the 28S rRNA gene were generated for the following species of allocreadiids: Margotrema resolanae Pérez-Ponce de León, Martínez-Aquino, and Mendoza-Garfias, 2013 (Genbank KT833271-KT833272),

6

and Margotrema bravoe Lamothe-Argumedo, 1970 (Genbank KT833273-KT833278) from goodeids in Mexico. All these sequences were aligned with the following sequences from species of Allocreadiidae available in GenBank (Table II). Alignment and phylogenetic analysis Partial sequences obtained in this study were aligned with published sequences of Allocreadiidae and other Xiphidiatan taxa mentioned above, using ClustalW (Thompson et al., 1994) with default parameters, implemented in MEGA v5 (Tamura et al., 2011). The alignments were trimmed, prior to phylogenetic analyses, to match the shortest sequence. Nucleotide substitution models were selected for the data set; the most appropriate evolution model was selected by using jModelTest 0.1.1. (Posada, 2008) and applying the Akaike Information Criterion (AIC) (28S=GTR+I+G). Phylogenetic trees were reconstructed by Maximum Likelihood (ML) and Bayesian inference (BI) analysis. For ML analyses, the program PAUP v. 4.0 (Swofford, 2003) was used. GTR+I+G substitution model was used for ML analyses, and 10,000 bootstrap replicates were run to assess nodal support. We estimated gene trees using MrBayes 3.1.2 (Huelsenbeck and Ronquist, 2001), with 2 runs and 4 chains (1 cold, 3 heated) per run. The Metropolis-coupled Markov chain Monte Carlo (MC3) were run for 10 million generations, sampled every 1,000 generations, and the first 1,250 samples were discarded as burn-in (25%). The outputs of MrBayes were examined with Tracer v1.4 (Rambaut and Drummond, 2007) to check for convergence of different parameters, determine the approximate number of generation at which log likelihood values stabilized, identify the effective sample size (EES > 200) for each parameter, and the estimated magnitude of model parameters in individual and combined runs. Topological convergence in the 2 independent MCMC runs was checked with the ‘compare plot’ in AWTY (Wilgenbusch et al., 2004). The initial 25% of MCMCs was verified to include all the generations before stationary was archived. Posterior probabilities (PPs) of clades were obtained from after excluding the initial

7

25% as burn-in. Trees were drawn using FigTree software version 1.3.1 (Rambaut, 2006). The intra- and inter-specific genetic variation was determined using the Kimura 2-parameter distance (K2P) with the program MEGA v. 5 (Tamura et al., 2011), with analytical method and with a nucleotide substitution (transitions + transversions) and uniform rate. To compare trees representing specific alternative phylogenetic hypotheses, topological constraints were defined on trees obtained from ML analyses. In this case, the monophyly of all the species originally contained in Paracreptotrema was forced. The topological constraint was conducted using the same parameters of the ML method as described above. Differences between unconstrained (best) and constrained trees representing alternative hypotheses were evaluated using the Shimodaira/Hasegawa likelihood test (Shimodaira and Hasegawa, 1999) and were executed in PAUP (Swofford, 2003). RESULTS In total, 484 specimens of Paracreptotrema spp. were obtained from the digestive tract of their hosts, representing 4 species, i.e., P. blancoi (157), P. profundulusi (12), P. rosenthali (8), and P. blancoi sensu Salgado-Maldonado et al. (2011) from several localities (307). Molecular phylogenetic analysis Specimens from most localities were subsequently sequenced (28S rRNA) and a phylogenetic analysis was conducted to infer the sister group relationships of the samples within the phylogeny of Allocreadiidae. The phylogenetic analyses using BI and ML yielded trees with similar topologies. The results indicate that Paracreptotrema is paraphyletic due to the presence of 3 clades formed by species originally included within the genus on morphological grounds (Fig. 2). These clades are well supported by posterior probabilities and bootstrap values. The clade comprising P. blancoi, the type species, and P. rosenthali, is sister to a clade formed by 3 species of allocreadiids typically found in characid fishes (Wallinia, Creptotrematina and Auriculostoma). Paracreptotrema heterandriae placed as the sister

8

taxon of the aforementioned species. The other 2 species of Paracreptotrema, in turn, nest together as sister taxa of that clade (Fig. 2), including P. profundulusi and specimens identified as P. blancoi, from several localities across Mexico, Guatemala and Honduras. Genetic divergence levels among nominal species of Paracreptotrema are very high for this molecular marker, ranging from 3.9 to 7.0% (Table II). Additionally, to test the paraphyly of Paracreptotrema, a constrained ML tree was generated, forcing P. heterandriae, P. blancoi, P. rosanthali, P. profundulusi, and P. blancoi sensu Salgado-Maldonado et al. (2011) as a monophyletic assemblage. The -ln (likelihood) score for the original hypothesis (paraphyly of Paracreptotrema) shown in Figure 2 was –ln 7146.3208, whereas the score for the constraint hypothesis (monophyly of Paracreptotrema, tree not shown) was –ln 7159.7222. On the basis of the Shimodaira/Hasegawa likelihood test, the alternative topology is signficantly worse (P < 0.05). This also suggests that the species composition of Paracreptotrema as currently conceived is difficult to justify, requiring a further assessment of their classification based on phylogenetic analyses, as well as a re-examination of their morphology, and host and geographic distributions. The combination of the tree topology through molecular phylogenetic analyses, genetic divergence levels, and the result of the Shimodaira /Hasegawa test, led us to take a closer look into the morphology of the freshly collected specimens, along with those deposited in museum collections. All the new evidence gathered from several sources of information, including SEM observations, in the context of the phylogenetic relationships among allocreadiids, led us to describe 2 new genera to accommodate species from Middle-American poeciliids and profundulids that were previously included in Paracreptotrema (Table III; Figs. 3-11). In addition, a new species had to be described for Paracreptotrema blancoi (sensu Salgado-Maldonado et al., 2011). The new genera and species are described next. DESCRIPTIONS

9

Paracreptotrematoides n. gen. Diagnosis: Body aspinose, elongated, widest in mid region at the level of ventral sucker, with rounded anterior and posterior ends. Oral lappets or lobes lacking (Figs. 6, 11). Scattered eyespot remnants in forebody, at pharynx level. Oral sucker smaller than ventral sucker. Fifteen prominent dome-like papillae on oral sucker, 4 along inner edge and 11 on outer edge (Fig. 11). Pharynx relatively well developed. Prepharynx lacking. Esophagus relatively long, straight. Ceca not reaching anterior border of testes. Testes symmetrical, entire. Cirrus sac elongate, extending dorsally to almost reach posterior end of ventral sucker, containing simple unfolded seminal vesicle, pars prostatica, short ejaculatory duct and short unarmed cirrus. Genital pore preacetabular. Ovary dextral or sinistral, posterolateral to ventral sucker, entire. Seminal receptacle postovarian. Laurer´s canal present. Vitelline follicles extending alongside and overlapping ceca ventrally, from level of cecal bifurcation to posterior border of testes. Uterus looping between testes, extending into posttesticular space but not filling posttesticular region. Eggs relatively few, large, operculate. Excretory bladder I-shaped, extending to level of testes. Intestinal parasites of poeciliids (Cyprinodontiformes: Poeciliidae). Current distribution, Mexico. Taxonomic summary Type species: Paracreptotrematoides heterandriae (Salgado-Maldonado, Caspeta-Mandujano and Vazquez, 2012) n. gen. Type host: Pseudoxiphophorus bimaculatus (Heckel) (= Heterandria bimaculata) (Teleostei: Poeciliidae). Infection site: Intestine. Type locality: Pond at Agua Bendita (19°24′41″N, 97°00′52″W; upper basin of Río La Antigua, Veracruz, México. Other localities: Creek at Apazapán (19°19′32.2″N, 96°43′33.5″W); Río Tilapa (not

10

positioned); creek at Rancho Tizapán (19°24′24″N, 97°00’52″W); creek at San Miguel (Avestruces) (19°24′11″N, 97°29′31″W); creek at Cocaxtla (19°23′43″N, 97°29′33″W) (see Salgado-Maldonado et al., 2012). Etymology: The Greek suffix oides which means like - in the genus name refers to the fact that the new genus resembles Paracreptotrema, but does not comprise a monophyletic group with it. Remarks Paracreptotrematoides n. gen. possesses all the adult characteristics of the family Allocreadiidae as described by Caira and Bogéa (2005), such as the aspinose tegument, an unarmed cirrus, a well-developed cirrus sac, the lack of an external seminal vesicle and the general disposition of the vitelline follicles and gonads. The new genus is morphologically similar to Paracreptotrema in that both possess symmetrical testes, restricted vitelline follicles, an oral sucker that is smaller than ventral sucker, and a uterus that is mostly pretesticular. In addition to that, members of both genera are parasites in the intestine of poeciliids. However, the new genus can be readily distinguished from Paracreptotrema by the body shape, cirrus sac, vitelline follicles and uterus. Paracreptotrematoides is elongate instead of squat, with a rounded rather than a tapered posterior end, the cirrus sac almost reaches the posterior border of the ventral sucker and possesses an unfolded internal seminal vesicle rather than being short with a folded seminal vesicle, the vitelline follicles extend from the cecal bifurcation to the posterior border of testes instead of being restricted between the level of the pharynx and mid-region of the testes, and the uterus may extend to the posttesticular space, whereas uterine loops in Paracreptotrema only reach the intertesticular area. The new genus is monotypic and contains P. heterandriae, a parasite of Pseudoxiphophorus bimaculatus, with a restricted distribution, since it has only been found in some localities of the Río La Antigua basin, in Veracruz, on the Gulf of Mexico slope. Razo-

11

Mendivil et al. (2014b) mentioned 18 dome-like papillae on the oral sucker in this species; our observations in this study indicate that they actually possess 15 papillae. The genus Paracreptotrema currently contains 3 species, all described as parasites of poeciliids, P. blancoi, the type species, from at least 2 localities of Costa Rica, in both Atlantic and Pacific ocean slopes, parasitizing Priapichthys annectens (see Choudhury et al., 2006), P. rosenthali from Xiphophorus malinche and Pseudoxiphophorus jonesii, with a restricted distribution in Río Malila, in Hidalgo, Mexico (Bautista-Hernández et al., 2015), and P. mendezi, from Brachyraphis episcopi from Gatun Lake in Panama (Sogandares-Bernal, 1955), for which sequence data are unfortunately not yet available. We hypothesize, however, that once sequence data from this species is obtained, it will nest as a sister taxa of the other two species of Paracreptotrema, following the suggestion by Choudhury et al. (2006) that species of the genus would be found in other poeciliids elsewhere in the Neotropical region. Pseudoparacreptotrema n. gen. Diagnosis: Body aspinose, squat, widest in mid region at the level of ventral sucker, with bluntly rounded ends. Oral lappets or lobes lacking (Figs. 7-8, 12-13). Scattered eyespot remnants in forebody, at pharynx level. Oral sucker smaller than ventral sucker. Fifteen prominent dome-like papillae on oral sucker, 4 in the inner edge and 11 in the outer edge (Figs. 12-13). Pharynx relatively well developed. Prepharynx lacking. Esophagus relatively long, straight. Ceca extending to level of testes or slightly beyond. Testes entire, symmetrical. Cirrus sac voluminous, extending from posterior end of pharynx to anterior end of ventral sucker, containing a folded seminal vesicle, pars prostatica, and unarmed ejaculatory duct. Genital pore prebifurcal, at level of pharynx. Ovary entire, dextral or sinistral, posterolateral to ventral sucker. Seminal receptacle postovarian. Laurer´s canal present. Vitelline follicles extending from level of pharynx to either level of testes or midway between testes and posterior end of body, overlapping ceca ventrally. Uterus mostly pretesticular, looping

12

between testes in some specimens. Eggs relatively few, large, operculate. Excretory bladder Ishaped, extending to level of testes. Parasites in the intestine or stomach of profundulids (Cyprinodontiformes: Profundulidae), Middle-America. Taxonomic summary Type species: Pseudoparacreptotrema profundulusi (Salgado-Maldonado, CaspetaMandujano, and Martínez Ramírez, 2011) n. gen. Type host: Profundulus punctatus (Günther), Oaxaca killifish (Cyprinodontiformes: Profundulidae). Other host: Profundulus balsanus Ahl; P. oaxacae (Meek) (Salgado-Maldonado et al., 2014); Profundulus sp. 2 (this work) Infection site: Stomach. Type locality: Río Templo, Tehuantepec River basin, Oaxaca, México (16°53′56.3″N, 96°09′57.3’’W) Other localities: Ojo de Agua Creek, Tehuantepec River basin, Oaxaca (16°39′38.6″N, 95°49′36.6″W). Rıo San José de las Flores, Atoyac-Verde River basin, Oaxaca (16°24′21.5″N, 97°44′22.6″W). Río Cahoapán, Guerrero (17°16′37.8″N, 99°35′04.7″W); Arroyo los Sabinos (16°25′39.9″N, 97°4′28.9″W); Río Chacalapa (15°55′54.8″N, 95°56′00.3″W); Río Chico (16°55′34.50″N, 96°12′27.42″W), Oaxaca (Salgado-Maldonado et al., 2014). Etymology: The genus name reflects the fact the type species has the appearance of Paracreptotrema and was mistakenly allocated to that genus, and is not even closely related. Remarks Pseudoparacreptotrema n. gen. possesses all the adult characteristics of the family Allocreadiidae as stated by Caira and Bogéa (2005), including an aspinose tegument, unarmed cirrus, well developed cirrus sac, lack of an external seminal vesicle, and the general

13

disposition of the vitelline follicles and gonads. The new genus can be readily distinguished from 9 of the remaining 14 genera of Allocreadiidae (Creptotrema, Creptotrematina, Bunoderella, Trematichthys, Crepidostomum, Allobunodera, Bunodera, Megalogonia, and Auriculostoma) by the lack of oral lappets (‘muscular papillae’) or lobes (Scholz et al., 2004; Caira and Bogéa, 2005). Further, Pseudoparacreptotrema n. gen differs from Allocreadium and Pseudoallocreadium by the position of testes (symmetrical instead of in tandem) and by the extensive distribution of vitelline follicles, and from 2 other genera (Margotrema, and Wallinia) by having a uterus entirely pretesticular and by the position of testes (symmetrical instead of oblique). The type species of Pseudoparacreptotrema n. gen. is P. profundulusi, a parasite of killifishes of the genus Profundulus spp. in Oaxaca, Mexico. The new genus is erected to accommodate Paracreptotrema profundulusi, but it also includes the species mistakenly reported by Salgado-Maldonado et al. (2011, 2014) as Paracreptotrema blancoi from the same hosts and localities in Oaxaca as P. profundulusi. This mistaken identity was repeated in PinachoPinacho et al. (2014). Pinacho-Pinacho et al. (2015) again listed this second species of Pseudoparacreptotrema as P. blancoi although they pointed out that these specimens represented a new species that would be described in a separate paper. We observed several morphological differences (e.g., the size of the ventral sucker and the distribution of the vitelline follicles) that clearly indicate they represented a different species. Sequence data corroborated the proposition that these specimens do not belong in Paracreptotrema, and they are actually of the sister species of Pseudoparacreptotrema profundulusi. This new species is described below based on the museum specimens and new samples from killifishes in several localities of Oaxaca and Chiapas in Mexico, and from Guatemala and Honduras. Pseudoparacreptotrema macroacetabulata n. sp. (Figs. 8,13, 14-16)

14

Description based on 25 individuals collected from 6 species of Profundulus, 4 from P. balsanus, 5 from P. candalarius, 3 from P. guatemalensis, 3 from P. kreiseri, 3 from P. oaxacae and 7 from P. punctatus. Body 527.7–1269 (695.56 ± 143.91) long. Anterior end rounded, posterior end slightly tappered; maximum width of 264.5–817.6 (399.1± 107.54) at level of ventral sucker. Scattered eyespot remnants in forebody, at pharynx level. Oral sucker subterminal, 79.8–139.4 (112.2 ± 14.57) long, 69.94–155 (119.95± 18.92) wide, bearing 11 papillae along outer edge, 4 in the anterior part, 4 in the middle and 3 in the posterior part (Fig. 13). Oral lappets or lobes lacking. Ventral sucker well-developed, 173.6–288 (241.68 ± 33.34) long, 131–298.5 (215.39 ± 44.7) wide, strongly muscular (Fig. 8), occupying most of the posterior half of body. Oral sucker length: ventral sucker length ratio 1:0.39–0.56 (0.46 ± 0.04) and oral sucker width: ventral sucker width ratio 1:0.41–0.81 (0.57 ± 0.1). Prepharynx absent. Pharynx muscular, 34.73–73.29 (52.17 ± 9.31) long, 36.04–66.93 (53.83 ± 7.26) wide. Esophagus relatively long, straight, 30.96–95.73 (60.32 ± 20.91). Cecal bifurcation at the level of the ventral sucker anterior margin. Ceca extending along the body, terminating blindly at level of anterior margin of testes, 117–294 (182 ± 39.07) from posterior end. Testes 2, symmetrical, rounded, entire, right testis 64.49–159.3 (103.15 ± 21.1) long, 55.53–106.8 (77.53 ± 14.84) wide; distance between posterior margin and posterior end of body 25.75–162 (76.7 ± 27.96); left testis 73.26–128.7 (102.8 ± 15.78) long, 43.63–95.51 (72.25 ± 12.6) wide; distance between posterior margin and posterior end of body 42.8–129.5 (75.46 ± 25.35). Cirrus sac short, ovoid, median, dorsal, overlapping dorsally anterior margin of ventral sucker, 129–192 (160 ± 20.51) long, 43–73 (65 ± 9.8) wide, containing folded tubular seminal vesicle, and pars prostatica. Genital pore median, prebifurcal, between pharynx and anterior margin of ventral sucker. Ovary 46.49–99.08 (75.79 ± 15.3) long, 41.95–74.11 (58.56 ± 7.84) wide, rounded, entire, dextral, immediately anterior to right testis, overlapping with posterior border of ventral sucker. Mehlis’ gland and Laurer’s canal not observed Seminal receptacle

15

lateral to ovary, rounded. Uterus short, mostly pretesticular, with short loop extending between testes, metraterm weakly developed. Eggs few, ovoid, large, operculate, 34.55–68.57 (53.29 ± 6.67) long, 22.56–40.84 (30.38 ± 4.38) wide. Vitelline follicles follicular, in 2 ventrolateral fields, extending from level of posterior margin of oral sucker and pharynx to the area bewteen posterior margin of ventral sucker and anterior margin of testes, follicles overlapping cecal field ventrally. Excretory vesicle I-shaped, tubular, reaching anteriorly the testes level. Excretory pore terminal. Taxonomic summary Type host: Profundulus candalarius (Hubbs, 1924), Headwater killifish (Cyprinodontiformes: Profundulidae). Infection site: Intestine. Type locality: Río San Carlos, Chiapas, México (16°19′1″N, 91°58′0″W). Other localities: See Table III. Etymology: The species name derives from the Greek word ‘makros’, meaning large, and refers to the unusually large size of the ventral sucker, its most distinctive character. Remarks Pseudoparacreptotrema macroacetabulata n. sp. resembles P. profundulusi in having a similar shape, a relatively long esophagus, symmetrical testes, and a prebifurcal genital pore. Both are parasites of killifishes (Profundulidae) in Middle-America. However, the new species can be readily distinguished by its more restricted vitelline fields, which extends from the level of the pharynx to the area between the ventral sucker and testes, the short cirrus sac, and ceca that bifurcate at the level of the ventral sucker and end at the level of the testes. In P. profundulusi, the vitelline follicles extend posteriorly almost to the end of body, the cirrus sac is longer, the cecal bifurcation is located between the ventral sucker and pharynx, and ceca extend posteriorly beyond the posterior margin of testes. The most distinctive character

16

of the new species is the presence of a very large ventral sucker (Figs. 8, 14). SalgadoMaldonado et al. (2011) recorded the presence of Paracreptotrema blancoi in 3 species of Profundulus from Guerrero and Oaxaca, Mexico, occasionally in concurrent infections with P. profundulusi. Specimens reported as P. blancoi from Mexico had a smaller oral sucker and a larger ventral sucker compared to the specimens from Costa Rica, where the species was described for the first time (Choudhury et al., 2006); the pharynx, ovary, testes, and eggs of the Mexican specimens were also slightly smaller. However, Salgado-Maldonado et al. (2011) attributed these differences to intraspecific geographical variation. Further survey work on profundulids in different areas of Middle-America, followed this identification (SalgadoMaldonado et al., 2014: Pinacho-Pinacho et al., 2014, 2015). Based on the phylogenetic relationships, the level of genetic divergence, and a re-assessment of the morphology, including SEM photomicrographs of the body surface, we unambiguously recognize this species from profundulids as a new species, Pseudoparacreptotrema macroacetabulata n. sp. Additional Remarks: Currently, Allocreadiidae contains 14 genera (Scholz et al., 2004; Caira and Bogéa, 2005; Choudhury and León-Régagnon, 2005; Curran et al., 2006, 2011; Choudhury et al., 2007; Pérez-Ponce de León et al., 2007): Bunodera Railliet, 1896; Allocreadium Looss, 1900; Crepidostomum Braun, 1900; Creptotrema Travassos, Artigas and Pereira, 1928; Megalogonia Surber, 1928; Trematichthys Vaz, 1932; Creptotrematina Yamaguti, 1953; Bunoderella Schell, 1964; Margotrema Lamothe-Argumedo, 1970; Allobunodera Yamaguti, 1971; Pseudoallocreadium Yamaguti, 1971; Wallinia Pearse 1920; Auriculostoma Scholz, Aguirre-Macedo and Choudhury, 2004; and Paracreptotrema Choudhury, Pérez-Ponce de León, Brooks and Daverdin, 2006. With the present study, 2 new genera have been added to the classification scheme of the family raising the number to 16, pending a complete phylogenetic analysis that includes all the representative genera; sequences of the 28S rRNA

17

gene are available for 12 of the 16 genera. Pseudoparacreptotrema n. gen. is morphologically similar to Paracreptotrema and Paracreptotrematoides n. gen., but can be readily distinguished from both by the extent of the vitelline follicles (from the level of the pharynx to the posterior end of body), the position of the genital pore (prebifurcal), the shape and size of the cirrus sac, and the posterior extent of the ceca. DISCUSSION The results reveal that the genus Paracreptotrema, as currently constituted, is not monophyletic, and 2 new genera were erected to accommodate species that morphologically resemble Paracreptotrema, but belong to separate lineages. The results indicate that Paracreptotrema, Paracreptotrematoides n. gen., and Pseudoparacreptotrema n. gen. belong in the Allocreadiidae, but they are not sister taxa. In this study, we followed an integrative taxonomy approach (Padial et al., 2010) to further evaluate the inference that Paracreptotrema is paraphyletic, by reassessing morphology from whole mounts, scanning electron microscopy, host association, and geographical data. All 3 taxa lack oral lappets (or lobes on the oral sucker), which sets them apart from the genus Creptotrema Travassos, Artigas and Pereira, 1928, and infect either poeciliids (Paracreptotrema and Paracreptotrematoides n. gen.) or profundulids (Pseudoparacreptotrema n. gen.) across Middle-America. When Choudhury et al. (2006) described the genus Paracreptotrema for specimens from Costa Rica, 3 particular points were made: 1) That the genus tentatively belongs in Allocreadiidae; 2) That in the absence of a phylogenetic analysis that included all allocreadiids, it was not possible to determine sister-group relationships of this genus, and 3) That the congeneric species are intestinal parasites of poeciliid fishes in Central America, but that species of Paracreptotrema may occur in these or other poeciliids elsewhere in the Neotropical region. Pseudoparacreptotrema macroacetabulata n. gen. n. sp. and its sister species P.

18

profundulusi are remarkably different in their biogeography; the former infects 9 of 10 Profundulus spp. and is widely distributed, from Río Papagayo on the Pacific slope in Guerrero to Honduras, while its congener is apparently restricted to 4 Profundulus spp. all in Oaxaca, Mexico. The southern boundary of this trematode genus appears to be marked by one of the hosts, P. portillorum, which is found in the headwaters of the Ulúa and Nacaome River basins in the Atlantic and Pacific slopes of Honduras; as a result, the trematode encompasses the entire geographic range of Profundulus in Middle-America (Matamoros and Schaefer, 2010; Matamoros et al., 2012). Despite the large geographic range and host spectrum, the intraspecific genetic divergence for the 28S rRNA gene of P. macroacetabulata is very low, varying between 0 and 0.9%. The morphology seems to reflect this low divergence because specimens of the new species from different hosts and localities are very similar. This finding needs to be tested with the use of a more variable marker such as COI, to explore if further diversification has taken place. Both species, P. profundulusi and P. macroacetabulata n. sp., are exclusively parasites of killifishes of the genus Profundulus, occurring across the range of this host genus, and as such can be regarded as members of the ‘core’ helminth fauna of profundulids (sensu Pérez-Ponce de León and Choudhury, 2005). Interestingly, this is the second case where a group of allocreadiid trematodes, conventionally regarded as a monophyletic assemblage, is shown to be a paraphyletic group. Atopkin and Shedko (2014) estimated the genetic divergence and the phylogenetic relationships of 4 species of Crepidostomum Braun, 1900 through partial sequences of the 28S rRNA gene. Based on available sequences from several Crepidostomum spp., these authors demonstrated that this papillose allocreadiid genus (Caira, 1989) is paraphyletic. Our results corroborate the paraphyly of Crepidostomum (Figs. 2, 3), and while an assessement of Crepidostomum is beyond the scope of this paper, it is clear that an integrative taxonomy

19

approach is required to clarify the taxonomic status of allocreadiid species, and to propose new genera. The case of Crepidostomum and Paracreptotrema also suggests the need to increase the genetic library of molecular markers for allocreadiids, especially from other loci in the nuclear genome, as well as mitochondrial genes such as cytochrome c oxidase subunit 1 (COI). This will help accomplish 2 tasks, to better resolve the phylogeny within the family, and to conduct molecular prospecting studies (sensu Blouin, 2002) in the search for cryptic species (Pérez-Ponce de León and Nadler, 2010; Nadler and Pérez-Ponce de León, 2011). This information will also allow us to better understand patterns of host-specificity exhibited by species of Allocreadiidae which are important components of the parasite fauna of freshwater fishes (Caira and Bogéa, 2005). The broader conclusions from our study echo thoughts expressed in Pérez-Ponce de León and Choudhury (2010) in that the future of helminth systematics, and particularly that of freshwater fishes, belongs to DNA-based taxonomic approaches that aim to not only uncover previously unrecognized biodiversity, but also solve taxonomic problems and understand more accurately the systematics of taxa. Also, ultrastructural studies provide a rich source of information for future comparative studies. In the case of allocreadiid trematodes, SEM has proved invaluable in accurately discerning the presence and shape of structures such as muscular lobes or lappets on the oral sucker as well as the shape, size, and distribution of dome-like papillae on the body surface, including on the oral and ventral suckers (e.g., Caira, 1989; Choudhury and Nelson, 2000; Moravec, 2002; Razo-Mendivil et al., 2014a; this study). The information accumulated thus far clearly shows that future taxonomic progress in allocreadiids will depend on an integrative taxonomic approach, using a combination of SEM, DNA, and traditional morphometrics, based on properly collected and fixed specimens. ACKNOWLEDGMENTS

20

The help of the following people during field work is greatly appreciated: Emilio Martínez, Jesus Hernández, Leopoldo Andrade, Eduardo Hernández, Andrés Martínez, and Carlos Mendoza. We thank Luis García-Prieto, CNHE, Mexico City, for loan of specimens. We thank Arturo Angulo for providing collecting permits to sample in northern Costa Rica, and to Patricia Ornelas for the identification of the hosts. This research was supported by grants from the Programa de Apoyo a Proyectos de Investigación e Innovación Tecnológica (PAPIIT-UNAM IN207213, and IN204514) to MGV and GPPdL, respectively, and CONACYT 179048 to MGV. CPP thanks CONACyT for granting a scholarship to complete his Ph.D. program at Posgrado en Ciencias Biológicas UNAM. AC wishes to thank St. Norbert College for a 2014 Faculty Development Summer grant. LITERATURE CITED Atopkin, D. M., and M. B. Shedko. 2014. Genetic characterization of far eastern species of the genus Crepidostomum (Trematoda: Allocreadiidae) by means of 28S ribosomal DNA sequences. Advances in Bioscience and Biotechnology 5: 209–215. Bautista-Hernández, C., S. Monks, G. Pulido-Flores, and R. Miranda. 2015. A new species of Paracreptotrema n. sp. (Digenea, Plagiorchiformes, Allocreadiidae) from Xiphophorus malinche (Teleostei, Poeciliidae) in Río Malila of the Río Pánuco basin, Hidalgo, México with a key to the species of the genus. ZooKeys 482: 55–66. Blouin, M. S. 2002. Molecular prospecting for cryptic species of nematodes: Mitochondrial DNA versus internal transcribed spacer. International Journal for Parasitology 32: 527–531. Caira, J. N. 1989. A revision of the North American papillose Allocreadiidae (Digenea) with independent cladistic analyses of larval and adult forms. Bulletin of the University of Nebraska State Museum 11: 1–58.

21

Caira, J. N., and T. Bogéa. 2005. Family Allocreadiidae Looss, 1902. In Keys to the Trematoda, A. Jones, R. A. Bray, and D. I. Gibson (eds.). CAB International and the Natural History Museum, London, U. K., p. 417–436. Choudhury, A., and P. A. Nelson. 2000. Redescription of Crepidostomum opeongoensis Caira, 1985 (Trematoda: Allocreadiidae) from fish hosts Hiodon alosoides and Hiodon tergisus (Osteichthyes: Hiodontidae). Journal of Parasitology 86: 1305–1312. Choudhury, A., and V. León Règagnon. 2005. Molecular phylogenetics and biogeography of Bunodera spp. (Trematoda: Allocreadiidae), parasites of percid and gasterosteid fishes. Canadian Journal of Zoology 83: 1540–1546. Choudhury, A., G. Pérez-Ponce de León, D. Brooks, and R. Daverdin. 2006. Paracreptotrema blancoi n. gen., n. sp. (Digenea: Plagiorchiformes: Allocreadiidae) in the Olomina, Priapichthys annectens (Osteichthyes: Poeciliidae), from the Área de Conservación Guanacaste, Costa Rica. Journal of Parasitology 92: 565–568. Choudhury, A., R. Rosas-Valdez, R. C. Johnson, B. Hoffmann, and G. Pérez-Ponce de León. 2007. The phylogenetic position of Allocreadiidae (Trematoda: Digenea) from partial sequences of the 18S and 28S ribosomal RNA genes. Journal of Parasitology 93: 192–196. Curran, S. S., V. V. Tkach, and R. B. Overstreet. 2006. A review of Polylekithum Arnold 1934 and its familial affinities using morphological and molecular data, with description of Polylekithum catahoulensis sp. nov. Acta Parasitologica 51: 238–248. Curran, S. S., V. V. Tkach, and R. B. Overstreet. 2011. Phylogenetic affinities of Auriculostoma (Digenea: Allocreadiidae), with descriptions of two new species from Peru. Journal of Parasitology 97: 661–670. García-Varela, M., and S. A. Nadler. 2005. Phylogenetic relationships of Palaeacanthocephala (Acanthocephala) inferred from SSU and LSU rDNA gene sequences. Journal of Parasitology 91: 1401–1409.

22

Hernández-Mena, D. I., L. García-Prieto, and M. García-Varela. 2014. Morphological and molecular differentiation of Parastrigea (Trematoda: Strigeidae) from Mexico, with the description of a new species. Parasitology International 63: 315–323. Huelsenbeck, J. P., and F. Ronquist. 2001. MrBayes: Bayesian inference of phylogeny. Biometrics 17: 754–755. Luton, K., D. Walkern, and D. Blair. 1992. Comparisons of ribosomal internal transcribed spacers from two congeneric species of flukes (Platyhelminthes: Trematoda: Digenea). Molecular and Biochemical Parasitology 56: 323–328. Matamoros, W. A., and J. F. Schaefer. 2010. A new species of Profundulus (Cyprinodontiformes: Profundulidae) from the Honduran central highlands. Journal of Fish Biology 76: 1498–1507. Matamoros, W. A., J. F. Schaefer, C. L. Hernández, and P. Chakrabarty. 2012. Profundulus kreiseri, a new species of Profundulidae (Teleostei, Cyprinodontiformes) from northwestern Honduras. ZooKeys 227: 49–62. Moravec, F. 2002. External morphological differences between Crepidostomum farionis and Crepidostomum metoecus (Trematoda: Allocreadiidae), parasites of salmonids, as revealed by SEM. Folia Parasitologica 49: 211–217. Nadler, S. A., and G. Pérez-Ponce de León. 2011. Integrating molecular and morphological approaches for characterizing parasite cryptic species: implications for parasitology. Parasitology 138: 1688–1709. Padial, J. S., A. Miralles, I. De la Riva, and M. Vences. 2010. The integrative future of taxonomy. Frontiers in Zoology 7: 16. Pérez-Ponce de León, G., and A. Choudhury. 2005. Biogeography of helminth parasites of freshwater fish in México: The search for patterns and processes. Journal of Biogeography 32: 645–659.

23

Pérez-Ponce de León, G., and A. Choudhury. 2010. Parasite inventories and DNA-based taxonomy: lessons from helminths of freshwater fishes in a megadiverse country. Journal of Parasitology 96: 236–244. Pérez-Ponce de León, G., A. Choudhury, R. Rosas-Valdez, and H. Mejía-Madrid. 2007. The systematic position of Wallinia spp. and Margotrema spp. (Digenea), parasites of MiddleAmerican and Neotropical freshwater fishes, based on the 28S ribosomal RNA gene. Systematic Parsitology 68: 49–55. Pérez-Ponce de León, G., and S. A. Nadler. 2010. What we don´t recognize can hurt us: A plea for awareness about cryptic species. Journal of Parasitology 96: 453–464. Pinacho-Pinacho, C. D., M. García-Varela, J. S. Hernández-Orts, C. A. Mendoza-Palmero, A. L. Sereno-Uribe, E. Martínez-Ramírez, L. Andrade-Gómez, E. Hernández-Cruz, and G. Pérez-Ponce de León. 2015. Checklist of the helminth parasites of genus Profundulus Hubbs, 1924 (Cyprinodontiformes: Profundulidae), an endemic family of freshwater fishes in MiddleAmerica. Zookeys 523: 1–30. Pinacho-Pinacho, C. D., M. A. Pérez-Ruíz, A. L. Sereno-Uribe, M. García-Varela, and E. Martínez-Ramírez. 2014. Richness and similarity of helminth communities of the freshwater fish Profundulus punctatus (Pisces: Cyprinodontidae) from Oaxaca, Mexico. Revista Mexicana de Biodiversidad 85: 1129–1138. Posada, D. 2008. jModelTest: Phylogenetic model averaging. Molecular Biology and Evolution 25: 1253–1256. Rambaut, A. 2006. FigTree v1.3.1. Institute of Evolutionary Biology, University of Edinburgh, Edinburgh. Rambaut, A., and A. J. Drummond. 2007. Tracer v1.4, Available from http://beast.bio.ed.ac.uk/Tracer.

24

Razo-Mendivil, U., B. Mendoza-Garfias, G. Pérez-Ponce de León, and M. Rubio-Godoy. 2014a. A new species of Auriculostoma (Digenea: Allocreadiidae) in the Mexican tetra Astyanax mexicanus (Actinopterygii, Characidae) from Central Veracruz, Mexico, described using morphological and molecular data. Journal of Parasitology 100: 331–337. Razo-Mendivil, U., G. Pérez-Ponce de León, and M. Rubio-Godoy. 2014b. Testing the systematic position and relationships of Paracreptotrema heterandriae within the Allocreadiidae through partial 28s rRNA sequences. Journal of Parasitology 100: 537–541. Salgado-Maldonado, G., J. Caspeta-Mandujano, and E. Martínez-Ramírez. 2011. Paracreptotrema profundulusi n. sp. and P. blancoi Choudhury, Pérez-Ponce de León, Brooks and Daverdin, 2006 (Trematoda: Allocreadiidae) from freshwater fishes of the genus Profundulus (Teleostei: Profundulidae) in southern México. Journal of Parasitology 97: 707– 712. Salgado-Maldonado, G., J. Caspeta-Mandujano, and G. Vázquez. 2012. A new allocreadiid (Trematoda) species from freshwater fish Heterandria bimaculata (Teleostei: Poeciliidae) in southeastern Mexico. Journal of Parasitology 98: 404–407. Salgado-Maldonado, G., W. A. Matamoros, J. M. Caspeta-Mandujano, E. Martínez-Ramírez, E. F. Mendoza-Franco, and E. Velázquez-Velázquez. 2014. Range extension of helminth parasites of Profundulus spp. (Teleostei: Profundulidae) from southern Mexico and Central America. Check List 10: 1507–1513. Sánchez-González, L. A., A. G. Navarro-Sigüenza, J. F. Ornelas, and J. J. Morrone. 2013. What’s in a name?: Mesoamerica. Revista Mexicana de Biodiversidad 84: 1305–1308. Shimodaira, H., and M. Hasegawa. 1989. Multiple comparisons of log-likelihoods with applications to phylogenetic inference. Molecular Biology Evolution 16: 1114–1116. Scholz, T., M. L. Aguirre-Macedo, and A. Choudhury. 2004. Auriculostoma astyanace n. gen., n. sp. (Digenea: Allocreadiidae), from the banded astyanax, Astyanax fasciatus

25

(Characiformes: Characidae), from Nicaragua, with a reevaluation of Neotropical Crepidostomum spp. Journal of Parasitology 90: 1128–1132. Sogandares-Bernal, F. 1955. Some helminth parasites of fresh and brackish water fishes from Louisiana and Panama. Journal of Parasitology 41: 587–594. Stock, P. S., J. F. Campbell, and S. A. Nadler. 2007. Phylogeny of Steinernema Travassos, 1927 (Cephalobina: Steinernematidae) inferred from ribosomal DNA sequences and morphological characters. Journal of Parasitology 87: 877–88. Swofford, D. L. 2003. PAUP*. Phylogenetic Analysis Using Parsimony (*and Other Methods). Version 4. Sinauer Associates, Sunderland, Massachusetts. Tamura, K., D. Peterson, N. Peterson, G. Stecher, M. Nei, and S. Kumar. 2011. MEGA5: Molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Molecular Biology and Evolution 28: 2731–2739. Thompson, J., D. Higgins, and T. Gibson. 1994. CLUSTAL W: Improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specifc gap penalties and weight matrix choice. Nucleic Acids Research 22: 4673–4680. Wilgenbusch, J. C., D. L. Warren, and D. L. Swofford. 2004. AWTY: A system for graphical exploration of MCMC convergence in Bayesian phylogenetic inference. Available at http://ceb.csit.fsu.edu/awty. Winker, K. 2011. Middle America, not Mesoamerica, is the accurate term for biogeography. Condor 113: 5–6.

FIGURE 1. Map of the localities where samples of Paracreptotrema were obtained in Mexico, Guatemala, Honduras and Costa Rica. Number of localities correspond to data shown in Table I. FIGURE 2. Bayesian 50 % majority-rule consensus phylogram inferred of analysis of 1,245

26

nucleotide positions of 28S rRNA sequences of species originally allocated in Paracreptotrema. Phylogram rooted with Paracreptotrematina limi. Bayesian posterior probabilities are given below the internode, and bootstrap support above the internode. In bold, species sequenced in this paper, indicating the host species and locality following Table I. FIGURE 3. Topology summary showing the phylogenetic relationships of Allocreadiidae inferred through sequences of the 28S rRNA gene indicating the sister group relationships among their members, including the new genera and species described in this study (in bold). FIGURES 4-13. Scanning electron microscopy of whole specimens of 5 species of allocreadiids (4-8) and the detail of the oral sucker showing dome-like papillae on the oral sucker, (9-13). (4,9) Paracreptotrema blancoi, (5,10) P. rosenthali, (6,11) Paracreptotrematoides heterandriae n. gen., (7,12) Pseudocreptotrema profundulusi n. gen., and (8,13) Pseudoparacreptotrema macroacetabulata n. gen., n. sp. FIGURES 14-16. Drawing of the holotype Pseudoparacreptotrema magacetabulata n. gen, n. sp. from Profundulus candalarius. Ventral view. (14) Whole worm, (B) Detail of the structure of the cirrus sac, (C) Detail of the female reproductive system.

*Division of Natural Sciences, St. Norbert College, 100 Grant Street, DePere, Wisconsin 54115.

27

Figure 1

Click here to download Figure Fig.1 final.tif

Figure 2

Click here to download Figure Fig.2 Final.tif

Figure 3

Click here to download Figure Fig.3 Final 1.tif

Figure 4-13

Click here to download Figure Figs. 4-13.tif

Figure 14-16

Click here to download Figure Figs. 14-16.tif

Table I

Click here to download Table Table I.docx

TABLE I. Localities where poeciliids and profundulids were sampled in Mexico, Guatemala, Honduras, and Costa Rica for specimens of Paracreptotrema, including geographical coordinates, host species and sample size (N). Locality number corresponds with Fig. 1. Locality

Geographical Coordinates N W

Fish Species

N

Mexico El Platanar, Putla de Guerrero, Oaxaca (1) Río San José, Santiago Jamiltepec, Oaxaca (2) Río Santa Cruz, Santiago Jamiltepec, Oaxaca (3) Río Pichuaca, Santiago Jocotepec, Oaxaca (4) Río Templo, San Juan del Río, Oaxaca (5) Río Santa María Huatulco, Pochutla, Oaxaca (6) Río PuebloViejo, San Gabriel Mixtepec, Oaxaca (7) Río San Carlos, Chiapas (8) Río Pedregal, Tres Picos, Chiapas (9) Río Suchiapan, La Esperanza, Chiapas (10) Río San Juan, Cristobal Obregón, Chiapas (11) Río Huixtla, Chiapas (12)

16°44´55˝ 16°24´19˝ 16°21´06.1˝ 16°05´34.2˝ 16°53´56.3˝ 15°50´14.2˝ 16°06´22.3˝ 16°19´10˝ 15°55´1.2˝ 16°23´27.6˝ 16°21´00˝ 15°10´18˝

97°59´32˝ 97°44´20˝ 97°45´38.3˝ 97°24´18.1˝ 96°09´57.3˝ 96°19´30.8˝ 97°03´47.8˝ 91°58´06˝ 93°32´45.6˝ 93°17´24˝ 93°30´54˝ 92°25´24˝

Profundulus balsanus Profundulus balsanus Profundulus balsanus Profundulus balsanus Profundulus sp. 2 Profundulus balsanus Profundulus balsanus Profundulus candalarius Profundulus punctatus Profundulus labialis Profundulus punctatus Profundulus punctatus

4 7 8 4 2 5 10 14 15 15 8 20

Río Malila, Hidalgo (13)

20°44'

98°43'

Xiphophorus malinche

22

Río Escuintla (14) Río Primavera (15) Río Nahualate (16) Puente Sansare (17)

14°19´41.51˝ 14°22´19.20˝ 14°26´44˝ 14°44´52˝

91°42´57.35˝ 91°09´60˝ 91°22´56˝ 90°06´33˝

Profundulus guatemalensis Profundulus punctatus Profundulus punctatus Profundulus guatemalensis

19 9 1 6

Quebrada el Paraiso (18) Los Potrerillos (19)

15°01´26˝ 14°32´31˝

88°59´32˝ 87°52´55˝

Profundulus kreiseri Profundulus portillorum

28 9

Quebrada Plata, El Aguacate (20) Río Orosí (21)

10°33´38˝ 11°02´50˝

84°56´24˝ 85°22´48˝

Priapichthys annectens Priapichthys annectens

3 7

Guatemala

Honduras

Costa Rica

Table II

Click here to download Table Table II.docx

TABLE II. Species of allocreadids for which sequences of the 28S rRNA gene are available in the GenBank dataset. Species

Allocreadium lobatum A. isoporum A. neotenicum Auriculostoma astyanace A. totonacapanensis

Bunodera luciopercae Bunodera sp. Crepidostomum cooperi C. cornutum C. farionis C. metoecus C. nemachilus C. illinoiense C. auriculatum Creptotrema funduli Creptotrematina aguirrepequenoi Megalogonia ictaluri Paracreptotrema heterandriae Wallinia chavarriae Wallinia mexicana

Authority name (publication date)

Wallin, 1909 (Looss, 1849) Peters, 1957 Scholz, Aguirre-Macedo and Choudhury, 2004 Razo-Mendivil, MendozaGarfias, Pérez-Ponce de León and Rubio-Godoy, 2014 (Müller, 1776) Lühe, 1909 Hopkins, 1931 (Osborn, 1903) Stafford, 1904 (Müller, 1784) Braun, 1900 Krotov, 1959 Faust, 1918 (Wedl, 1858) Mueller, 1934 Jiménez-Guzman, 1973 Surber, 1928 Salgado-Maldonado, CaspetaMandujano and Vázquez, 2012 Choudhury, Harvigtsen and Brooks, 2002 Pérez-Ponce de León, Razo-

GenBank Number

EF032693 GU462126 JX977132 HQ833707 KF631417

GU462122-24 HQ833704 DQ029328 EF032695 FR821403 FR821406 FR821409 HQ833705 FR821398 JQ425256 HQ833708, KF631421 EF032694 KF697693KF697694 HQ833703 KJ535504-05

Prosthenhystera obesa Nagmia floridensis Phyllodistomum lacustri Paracreptotrematina limi

Mendivil, Mendoza-Garfias, Rubio-Godoy and Choudhury, 2015 (Diesing, 1850) Travassos, 1922 Markell, 1953 14°32´31˝ (Loewen, 1929) Lewis, 1935 Amin and Myer, 1982

AY222206 EF032691 EF032692 HQ833706

Table III

Click here to download Table Table III.docx

TABLE III. Estimated genetic divergence range among species of some allocreadiids based on 28s rRNA. Kimura 2-parameter distance (K2P) are expressed as percentages. Percentages in bold correspond to genetic intraspecific divergence. The species P. “blancoi” refers to that originally recorded by Salgado-Maldonado et al. (2011) as a parasite of killifishes in Oaxaca, Mexico.

1. Paracreptotrema heterandriae 2. Auriculostoma astyanace 3. A. totonacapanensis 4. Creptotrematina aguirrepequenoi 5. Wallinia chavarriae 6. W. mexicana 7. Paracreptotrema rosenthali 8. P. blancoi 9. P. profundulusi 10. P. “blancoi”

1 0

2 3 4 4.3 5.9 4.9 0 2.5 4.4 0 5.3 0

5 4.3 2.9 4.4 4.6 0

6 5.4 4.1 6.2 5.6 3.7 0

7 5.6 5.4 6.5 6.8 5.7 7.2 0

8 4.2-4.4 4.6-4.9 5.9-6.2 5.9-6.2 4.4-4.6 5.3-5.6 4.7-5.0 0-0.4

9 5.0 5.7 7.5 7.0 6.0 7.8 7.0 6.0-6.3 0

10 4.6-5.3 4.7-5.3 5.6-6.0 6.8-7.3 5.0-5.7 7.0-7.6 6.3-7.0 4.9-5.7 3.9-4.4 0-0.9

Table IV

Click here to download Table Table IV.docx

TABLE IV. Species of allocreadiids recognized in this study as parasites of poeciliids and profundulids from Mexico, Guatemala, Honduras, and Costa Rica, after morphological and molecular analyses, including prevalence and abundance data, locality, host and specimens deposition in the GenBank database and the Colección Nacional de Helmintos. Species

Infected/Analyzed Locality (worms collected) 62/101 (767) Several localities, upper basin of Rio La Antigua 3/3 (131) Quebrada Plata, El Aguacate, Costa Rica 6/7 (26) Río Orosí, Costa Rica

Pseudoxiphophorus bimaculatus Priapichthys annectens

Paracreptotrema rosenthali

2/22 (8)

Río Malila, Hgo.

Xiphophorus malinche

Pseudoparacreptotrema profundulusi n. gen.

4/7 (5)

Profundulus balsanus

2/2 (4)

Río San José, Santiago Jamiltepec, Oax. Río Templo, San Juan del Río, Oax.

4/4 (16)

El Platanar, Putla de Guerrero, Oax.

Profundulus balsanus

4/7 (5)

Río San José, Santiago Jamiltepec, Oax. Río Santa Cruz, Santiago Jamiltepec, Oax. Río Pichuaca, Santiago Jocotepec, Oax. Río Templo, San Juan del Río, Oax. Río Santa María Huatulco, Pochutla, Oax Río PuebloViejo, San Gabriel Mixtepec, Oax.

Profundulus sp. 2 Profundulus balsanus

Paracreptotrematoides heterandriae n. gen.* Paracreptotrema blancoi

Pseudoparacreptotrema macroacetabulata n. gen., n.sp.

6/8 (9) 4/4 (6) 2/2 (3) 1/5 (26) 7/10 (45)

Host

Priapichthys annectens

Profundulus sp. 2

GenBank 28S KF697693– KF697697 KT833279– KT833281 KT833282– KT833286 KT833287– KT833288 KT833289

CNHE

9884 9882 9883 --------

KT833290– KT833281 KT833292– KT833293

--------

Profundulus balsanus

KT833294

--------

Profundulus balsanus

KT833295– KT833296 KT833297– KT833298 KT833299 KT833300– KT833301 KT833302– KT833303

9880

Profundulus balsanus

Profundulus balsanus

9881

9862

9863 9864

11/14 (48)

Río San Carlos, Chia.

Profundulus candalarius

2/15 (7)

Río Pedregal, Tres Picos, Chia.

Profundulus punctatus

1/15 (2)

Río Suchiapan, La Esperanza, Chia.

Profundulus labialis

4/8 (19)

Río San Juan, Cristobal Obregón, Chia.

Profundulus punctatus

4/20 (9)

Río Huixtla, Chia.

Profundulus punctatus

9/19 (21)

Río Escuintla, Guatemala

Profundulus guatemalensis

6/9 (42)

Río Primavera, Guatemala

Profundulus punctatus

1/1 (1) 6/6 (29)

Río Nahualate, Guatemala Puente Sansare, Guatemala

Profundulus punctatus Profundulus guatemalensis

4/28 (7)

Quebrada el Paraiso, Honduras Los Potrerillos, Honduras

Profundulus kreiseri

1/9 (1)

* Data from Salgado-Maldonado et al. (2011)

Profundulus portillorum

KT833304– KT833305 KT833306– KT833307 KT833308– KT833309 KT833310– KT833311 KT833312– KT833313 KT833314– KT833315 KT833316– KT833317 KT833318 KT833319– KT833320 KT833321– KT833322 KT833323

9878, 9879 9865 -------9866 9867 9868 9869 -------9870 9871 ---------

Copyright Form

Click here to access/download

Copyright Form JP_Copyright_Form-signed.pdf

Response letter

Click here to access/download

Cover Letter Response Letter.pdf