184
TIBTECH - JULY 1990 [Vol. 8]
Phosphate control sequences involved in transcriptional regulation of antibiotic biosynthesis Paloma Liras, Juan A. Asturias and Juan F. Martin The expression of genes encoding enzymes involved in antibiotic and other secondary metabolite biosynthesis is down-regulated by easily assimilable phosphate, carbon and nitrogen sources. Phosphate control of antibiotic production appears to act at the transcriptional level by a mechanism similar to that involved in control of phosphatases and other phosphate-regulated enzymes. A phosphate control (PC) sequence, strikingly similar to the phosphate control (pho) boxes of many bacterial genes, has been isolated from the phosphate regulated promoter that controls biosynthesis of the antibiotic candicidin, and characterized. From computer analysis of sequence data, PC sequences appear to be associated with promoter regions of several phosphate-controlled antibiotic biosynthetic genes. Biosynthesis of antibiotics and other secondary metabolites is regulated negatively by easily utilizable phosphate, carbon and nitrogen sources at the level of transcription. Little is known about the mechanism of carbon catabolite and nitrogen regulation of antibiotic biosynthesis at the transcriptional level. Recognition of particular promoters by different forms of RNA polymerase carrying specific sigma subunits may explain the changes in transcriptional activity of carbon or nitrogenregulated promoters. With phosphate, biosynthesis of many antibiotics is repressed by concentrations of above 1 mM. Production of these metabolites takes place only w h e n the producer cells reach phosphatestarvation conditions. We have identified a 114 bp phosphate-regulated promoter involved in phosphate control of ~ the biosynthesis of the antibiotic candicidin. It contains a phosphate control (PC) sequence which bears extreme homology to the reported phosphate control (pho) box of many genes in Escherichia
P. Liras, J. A. Asturias and J. F. Martin are at the Section of Microbiology, Department of Ecology, Genetics and Microbiology, University of Le6n, 24071 Le6n, Spain. (~ 1990, Elsevier Science Publishers Ltd (UK)
coli, Pseudomonas aeruginosa, Enterobacter cloacae, Klebsiella pneumoniae and Zymomonas mobilis. Northern analysis of the transcripts formed from the 114 bp promoter revealed that phosphate control takes place at the transcriptional level. Computer analysis of upstream sequences of several antibiotic biosynthetic genes, known to be regulated by phosphate, revealed the presence of PC sequences associated with the promoter regions of these genes. It seems likely that phosphate control of antibiotic expression is exerted at the transcriptional level by a mechanism similar to that involved in phosphate repression of phosphatases and other phosphate-regulated enzymes.
Production of secondary metabolites occurs at low specific growth rates In rich medium, producer organisms only form secondary metabolites (including antibiotics, alkaloids, mycotoxins, pigments, ionophores, organic acids, etc.), at low specific growth rates, after most cell growth has already occurred 1. In a few cases, this increased production at low specific growth rate has been confirmed in chemostat cultures. In defined media, growth limitations and, therefore, formation of second-
0167 - 9430/90/$2.00
ary metabolites, may occur from the beginning of the culture. The delay in formation of antibiotics and other secondary metabolites until the growth rate has decreased below a certain threshold is genetically determined and probably results in increased survivorship in the producer strains 1. Some of the secondary metabolites have antimicrobial activity and may serve to control the growth of competing microorganisms under starving conditions. Other metabolites are scavengers of phosphate, iron and other ions, or play a variety of ecological roles in the rhizosphere or in the interaction of microorganisms with plants and animals. Many other secondary metabolites may serve as triggers of the differentiation of the prcducer strains or as effectors of secondary metabolism 2. Therefore, it seems likely that formation of secondary metabolites is not necessary if abundant nutrients are available. In general, supplementation of a culture committed to antibiotic biosynthesis with an easily utilizable nutrient (e.g. glucose, phosphate, ammonium) results in suppression of secondary metabolite formation and a burst of growth. Conversely, a nutritional shift down usually produces a rapid onset of the biosynthesis of these metabolites. How does the cell control the differential expression of the genetic information required for growth and for antibiotic biosynthesis? After several years of research this is beginning to be understood at the molecular level. In this article we mainly discuss the phosphate control of biosynthesis of secondary metabolites; however, very similar conclusions are emerging from initial studies on carbon catabolite control and nitrogen regulation.
Regulation of antibiotic production Several enzymes involved in antibiotic biosynthesis are either inhibited or repressed by easily assimilable phosphate, carbon or nitrogen sources. Phosphate control of the formation of secondary metabolites is commonly observed in bacteria, fungi and plants (see review by Martin3). Inorganic phosphate concentrations greater than 3-5 mM are frequently inhibitory for the production of plant, fungal and bacteria] secondary
TIBTECH- JULY 1990 [Vol. 8]
--Table
185
I
Enzymes regulated by phosphate that are involved in antibiotic biosynthesis Antibiotic
Producing organism
Target enzyme
Candicidin
Streptomyces griseus Acremonium chrysogenum Streptomyces clavuligerus
p-Aminobenzoate synthase Deacetoxycephalosporin C synthetase b o~-Aminoadipyl-cysteinyl-valine-synthase Deacetoxycephalosporin C synthetase b Isopenicillin N synthetase b Deacetoxycephalosporin C synthase b Gramicidin S synthetase Neomycin phosphate phosphotransferase Streptomycin-6-phosphate phosphotransferase An hydrotetracycline oxygenase Valine dehydrogenase MethylmalonyI-CoA: pyruvate transcarboxylase PropionyI-CoA carboxylase Protylonolide synthetase dTDP-D-g lucose-4,6-dehydratase dTDP-mycarose synthetase Macrocin O-methyltransferase
Cephalosporin Cephamycin Cephamycin Gramicidin S
Neomycin Streptomycin Tetracycline Tylosin
Nocardia lactamdurans Bacillus brevis Streptomyces fradiae Streptomyces griseus Streptomyces aureofaciens Streptomyces fradiae
Streptomyces T59-235
Mechanism of regulation a R
D D I I I
D R R R
D D D D R R R
aR, repression; I, inhibition; D, depression of the enzyme occurs but the evidence does not prove unequivocally the existence of a repression mechanism. bEnzymes involved in cephamycin and cephalosporin biosynthesis are less sensitive to phosphate control than other antibiotic biosynthetic enzymes. Antibiotic synthetases require ATP whereas synthases do not.
metabolites in liquid culture, although the growth of the producer cells is progressively stimulated by increasing phosphate concentrations, up to 300 mM (Ref. 4). Many of the enzymes of the central pathways of primary metabolism (e.g. phosphofructokinase, glucose-6phosphate dehydrogenase) are stimulated by phosphate, thus providing greater amounts of intermediates required for macromolecule biosynthesis during the increased growth that occurs in the presence of elevated phosphate concentrations 4. Phosphate addition greatly stimulates formation of RNA (mainly ribosomal) in Streptomyces griseus 5'6. In summary, it seems that phosphate stimulates expression of genes involved in the biosynthesis of macromolecules and house-keeping genes (i.e. those genes that are required for growth and proper working of the cell machinery), whereas it frequently inhibits expression of genes encoding enzymes for the biosynthesis of secondary metabolites. Phosphate-mediated stimulation of growth may be a complex phenomenon whereas phosphate repression of individual genes or clusters of genes appears to be a specific phenomenon. The biosynthesis of several groups
of antibiotics, including aminoglycosides, tetracyclines, macrolides, polyenes, anthracyclines, ansamycins and polyethers, is particularly sensitive to phosphate regulation. These compounds are synthesized by different biosynthetic pathways; they may play very different roles in the producer organisms and their only common feature is that they are all typical secondary metabolites. However, not all antibiotics and other secondary metabolites are equally sensitive to phosphate control 7. The biosynthesis of [3lactam antibiotics, and peptide secondary metabolites in general, is poorly sensitive to high concentrations of inorganic phosphate but very sensitive to carbon and nitrogen catabolite regulation. For example, biosynthesis of clavulanic acid by Streptomyces clavuligerus (a strain that synthesizes several unrelated antibiotics) is very sensitive to phosphate regulation, whereas production of the ~-lactam antibiotic cephamycin by the same strain is not affected by 25 mM phosphate. It is, therefore, possible to dissociate cephamycin from clavulanic acid biosynthesis by adjusting the phosphate level in the medium s . Sequential formation of thienamycin and other different antibiotics in a cul-
ture of Streptomyces cattleya has been reported to be due to different degrees of nutrient limitation 9, indicating that even though a general phenomenon of phosphate control of secondary metabolism gene expression exists, different genes are modulated to different extents. Whether there is a mechanism common to different antibiotic-producing Streptomyces is an open question. Phosphate control of the expression of a candicidin-synthesizing gene from S. griseus is also exerted when the gene is introduced into S. lividans 1°. An important conclusion that is emerging from recent studies on phosphate regulation is that expression of genes encoding diverse antibiotic synthetases, which catalyse reactions in which orthophosphate is neither a substrate nor a product of the reaction, are repressed by phosphate 3. In addition, some other enzymes are inhibited (but not repressed) by phosphate, e.g. deacetoxycephalosporin C synthase in
Streptomyces clavuligerus, Nocardia lactamdurans 11 and Acremonium chrysogen um 12, indicating that there are at least two different levels at which phosphate control is exerted (Table 1). Regulation of antibiotics by easily assimilated carbon and nitrogen
186
sources has been observed, and probably operates by a mechanism similar to that of phosphate control ~3,~4. Phenoxazinone synthase (PHS), the enzyme of S. antibioticus that forms the phenoxazinone nucleus of actinomycin, is controlled by carbon catabolite regulation 15. Synthesis of PHS is initiated after cellular growth, and its specific activity increases after glucose depletion 16. High glucose levels severely repress production of PHS in S. antibioticus, but not in S. lividans. Nitrogen regulation of antibiotic biosynthesis is a well-known phenomenon 17-a9 but the molecular mechanism is not known.
Phosphate and carbon catabolite control at the transcriptional level The biosynthesis of the polyene macrolide antibiotic candicidin has been intensively studied as a model of phosphate control 4'2°-22. The precursor of the p-aminoacetophenone moiety of candicidin, p-aminobenzoic acid (PABA), is formed from chorismic acid by a specific PABA synthase for secondary metabolism. Formation of PABA synthase is strongly repressed by phosphate 22. Phosphate control is exerted at the transcriptional level 5'6. The specific mRNA for PABA synthase in S. griseus was quantified using an internal fragment of the pabS gene as a probe. In batch cultures of S. griseus, synthesis of mRNA for PABA synthase was derepressed early in the fermentation and reached a peak at 12 h of incubation. A decrease of 95% in the formation of specific mRNA for PABA synthase was observed when the cultures were supplemented with 7.5raM phosphate, even though formation of total RNA was greatly stimulated 6. Similarly, carbon catabolite regulation is exerted in some cases at the transcription level. Jones TM has reported that carbon catabolite regu-
TIBTECH - JULY 1990 [Vol. 8]
lation of actinomycin biosynthesis 15 is exerted by repression of the formation of mRNA for PHS. PHS mRNA levels appear to increase only after all the glucose in the medium has been used 14.
Phosphate control of candicidin biosyn thesis The gene encoding PABA synthase (pabS) together with its own promoter was cloned in a 4.5 kb BamHI fragment of DNA from S. griseus 23. Expression of the pabS gene is strongly repressed by phosphate when the gene is transcribed from its own promoter 5'1°. More than 50% repression of PABA synthase formation from the cloned pabS gene was observed in medium supplemented with 0.1mM phosphate. A 114 bp promoter (Pl14) was isolated from the upstream region of the structural pabS gene using the promoter probe vector pIJ424 (Fig. 1)TM. It is an AT-rich fragment (46% G+C versus 70-73% for the genome of Streptomyces), that shows a good homology in the - 1 0 region with other Streptomyces promoters 2 but lacks a standard - 3 5 region.
phate-regulated promoters revealed the presence in Pl14 of a PC sequence (Fig. 1 and Table 2) that is strikingly similar to the reported phosphate boxes of the phoB, phoR, phoS (pstS), phoE (omp) and phoA of E. coil24-27. It contains 12 nucleotides that are identical to the 18 existing in the consensus E. coli pho box. The similarity is even more surprising if the disparity in G+C content of Streptomyces and E. co]i is taken into account. Interestingly, the E. coli gene encoding phoS has two similar phosphate boxes in tandem 28. Both the S. griseus Pl14 PC sequence and the E. coil pho box show a tandem repeat structure that is abbreviated in the PC sequence. Although the similarity of the PC sequence with other bacterial phosphate boxes is striking, in vitro mutagenesis studies are being carried out to confirm its role in phosphate control (J. A. Asturias, unpublished).
Phosphate control sequences in E. coli, Pseudomonas, Enterobacter
and other organisms E. coli has a very complex regu-
latory mechanism for genes involved in uptake and metabolism of Phosphate control sequences phosphate 29. phoA encodes the periA phosphate control sequence in plasmic alkaline phosphatase and phosphate-regulated Streptomyces phoE codes for an outer membrane promoters pore protein that is induced under The structural Tn5 gene for kana- phosphate limitation. At least three mycin phosphotransferase, when genes, phoB, phoR and phoM, are fused to the pabS Pl14 promoter, was implicated in the regulation of the efficiently expressed in conditions pho regulon. The phoB protein of phosphate starvation, but expres- functions as an activator of transion was decreased by increasing scription of the structural genes of concentrations of phosphate TM. The the pho regulon, whereas phoB ex114 bp phosphate-regulated pro- pression is in turn modulated by the moter was trimmed down to a 35 bp products of the phoR and phoM. In core sequence which was still sensi- addition, phoB expression appears tive to phosphate control. We pro- to be autoregulated 3°. posed that a phosphate control (PC) Comparison of the nucleotide sequence was present in the up- sequences of the promoter regions of stream region of the phosphate- phoA (Ref. 24), phoE (Refs 25, 27) regulated Pl14 promoter 5'1°. and phoB (Ref. 26) revealed the presSequence analysis of the P114 ence of a consensus 18 bp sequence promoter and other known phos- in the sense strand (phosphate box)
~Fig. 1 5' TCTTATCCATTCTGTAGCTGATGAGATTAATATCCCAGGCG
-10 .-~ I I I I CACAATCGGGGGGCATGGTACCCCCACATCTATTGAATCCGCAACGCGCAGTATCATGACAGCTAAAGA
3' AGAATAGGTAAGACATCGACTACTCTAA~rATAGGGTCCGCAAAAGTG~AGCCCCCCGTACCATGGGGGTGAGATAACTTAGGCGT][GCGCGTCATAGTACTGTC]GA~TCT
3' 5'
PC sequence
Nucleotide sequence of the P714 phosphate-regulated promoter w. The first transcribed nucleotide according to $1 mapping studies is indicated by a thick arrow. The PC sequence (Table 2) is boxed. An inverted repeat is overlined. The ORF Of the structural p a b S gene is located downstream in the upper strand (5' to3"). A putative -10 region is indicated.
TIBTECH - JULY 1990 [Vol. 8]
187
~Table 2
Phosphate control sequences existing in phosphate-regulated promoters in different microorganisms Microorganisms
E. coli E. cloacae K. pneumoniae Z. mobilis P. aeruginosa P. aeruginosa S. griseus S. lividans S. griseus
Gene
Protein
Sequence
[phoB |phoR hoA
PhoB (regulator) PhoR (regulator) Alkaline phosphatase
| phoS (pstS) [phoE ~, u g p B phoE phoE phoC plC oprP pabS
Phosphate-binding protein CTGTCAT,aU&AACTGTCAT Outer-membrane porin T T T C Glycerol-3-P binding protein Outer-membrane porin 5, TTGTCATA.tufAGTTTCAT 3, Outer-membrane porin TTGTCATAAATATTTAAT Acid phosphatase TTGTCTTATTATAGCCAC Phospholipase C AGGTCATATCGAAGTCGC Periplasmic porin TTGCAGTCTCGCTGTCAC PABA synthase CTGTCATGATACTGCGCG Unknown product CTTGCACCTCACGTCACG Streptomycin phosphotransferase CTGTGCCGACATCTGGCAT
~p
ORFX b
sph=aphD
~ l
Consensus 5' --> 3'
% Homology 95 a 95a 89 95 83 89 83 77 66 61 61 66 66 72
aphoB and phoR form an operon with a common promoter and pho box. The homology is given as the percentage of nucleotides identical to the consensus E. colipho box. All the E. coil sequences show small differences with respect to the E. coliconsensus box (83 to 95% homology). The tamden repeat in the E. coli pho box is indicated by arrows. bORFX is expressed from the P143promoter region of the tipA gene but in the opposite orientation. The nucleotides in bold type are conserved with respect to the E. coliconsensus pho box.
(Table 2). The pho box was followed 11 bp downstream by a potential Pribnow box, suggesting that the pho box functions as an aberrant -35 region in E. coli phosphatecontrolled promoters 3°. Similarly, a pho box has been identified in the sense strand in the promoter region of the phoA gene of Zymononas mobi]Js31. In the promoter regions of phoE genes of E. coli 3°, Klebsiella pneumoniae and Enterobacter cloacae 32, a second upstream element that is required for efficient expression of the phoE gene shows homology to the pho box but in the opposite orientation. Pseudomonas aeruginosa has a pho regulon that contains a phosphate-starvation inducible periplasmic phosphate-binding protein (that functions as an outer membrane porin) (oprP) and carries a pho box upstream of the oprP (Ref. 33). A similar pho box was found in another phosphate-regulated gene of Pseudomonas aeruginosa that encodes a heat-labile secreted hemolysin (phospholipase C)34. The two Pseudomonas pho boxes show 61% homology with the E. coli consensus sequence (Table 2). Since P. aeruginosa and E. coli belong to different bacterial families and have quite different G+C contents, the available evidence suggests a strong evol-
utionary conservation of the regulatory elements of the pho regulon.
Phosphate-control sequences in other an tibiotic-biosyn th etic genes from Streptomyces Several genes involved in antibiotic biosynthesis have been cloned 2. Expression of some of the genes involved in streptomycin biosynthesis, e.g. the sph (=aphD) gene encoding the streptomycin phosphotransferase, is known to be regulated by phosphate (Table 1). Computer analysis of the upstream region of the published sequence of the sph gene of S. gFiseus 37 revealed a previously unreported putative PC sequence in the sph P2 promoter, 324 nucleotides upstream of the ATG initiation triplet of the sph gene of S. griseus. A pseudo PC sequence at 347 nucleotides was also found, and both of them were located in the long transcribed region between the transcription initiation site and the ATG translation initiation triplet 38. The sph PC box is located in the sense strand and contains 13 out of 18 nucleotides identical to the pho box of E. coli (Table 2). Recently, a gene (tipA) induced by thiostrepton in S. lividans has been cloned 39. The promoter (P143) of the tipA gene shows promoter activity in both orientations. In the orientation
opposite to the tipA, expression of an u n k n o w n open reading flame X is regulated by phosphate (C. Thompson, pers. commun.). We have found a putative PC sequence located in the P143 promoter region, upstream of the tipA gene, in the strand opposite to that carrying the phosphateregulated open reading flame X. It has 12 out of 18 identical nucleotides (Table 2). Similarly, the PC sequence of the pabS gene is also located in the strand opposite to that carrying the ORF of the pabS gene and overlaps with the Pl14 promoter (Fig. 1). The mechanism of PC regulation We can only speculate at this stage on the mechanism by which transcription is selectively blocked at phosphate-regulated promoters. One possibility involves specific DNAbinding proteins. A DNA-binding protein (the product of the phoB gene) that recognizes and binds the phoS promoter region and other pho box-containing promoters has been isolated from E. coli 35'36. Further studies on the role of these boxes in phosphate control are needed. The location and orientation of the phosphate boxes with respect to the phosphate-regulated promoters is not constant, as is the case with operator regions in glucose-
188
regulated promoters in E. coll. This suggests that the h y p o t h e s i s that these boxes function as aberrant - 3 5 regions m a y be untrue. Rather, it seems likely that they act by changing the specificity of RNAp o l y m e r a s e - D N A interaction w h e n the p h o boxes are r e c o g n i z e d b y DNA-binding proteins, w h i c h m a y result in DNA bending. If a PC sequence-binding protein exists (similar to the p h o B product), the interaction of this protein w i t h the PC sequences will p r e v e n t transcription by RNA polymerase. In this. regard, the location of the PC seq u e n c e either in the sense or in the opposite strand is not critical, as long as it prevents R N A - p o l y m e r a s e interaction with phosphate-regulated promoters. Indeed, in yeasts, the p h o s p h a t e control s e q u e n c e (UAS) of the acid p h o s p h a t a s e gene (1317o5) m o d u l a t e s p h o s p h a t e control w h e n u s e d in the opposite orientation 28. Alternatively, PC sequences m a y confer s e q u e n c e - i n d u c e d b e n d i n g characteristics o n the DNA (Ref. 40) or a change in s u p e r h e l i c i t y that will affect formation of the o p e n c o m p l e x and therefore initiation of transcription. This b e n d i n g c o u l d be further m o d i f i e d by binding of proteins; p r o t e i n - i n d u c e d bends in DNA seems to be a c o m m o n feature in regions of DNA subjected to regulation of gene e x p r e s s i o n 41. Selective transcription of carbon ca tabolite an d nitrogen-regula ted promoters It is well established that u p s t r e a m sequences are i n v o l v e d in m o d u l a t ing expression of the carbon catabolite regulated genes in yeasts 42 a n d the nitrogen regulated genes (e.g. glnA) in enterobacteria 43. H o w e v e r , v e r y little is k n o w n about the molecular m e c h a n i s m s of carbon or nitrogen regulation at the transcription level. The RNA p o l y m e r a s e of Streptomyces shows a great heterogeneity of sigma factors 44 and this m a y explain the selective use of different p r o m o t e r s observed in t r a n s c r i p t i o n of the Streptomyces coelicolor agarase gene 45 and the galactose o p e r o n 46. It is not k n o w n w h e t h e r different sigma subunits are i n v o l v e d in transcription of carbon-, nitrogen- or p h o s p h a t e - r e g u l a t e d p r o m o t e r s of antibiotic b i o s y n t h e t i c genes. The glutamine s y n t h e t a s e gene of S. coelicolor has b e e n
TIBTECH - JULY 1990 [Vol. 8]
c l o n e d TM but the m e c h a n i s m of nitrogen control of the g l u t a m i n e synthetase in Streptomyces remains obscure.
Conclusions and prospects The c o n c l u s i o n from the e v i d e n c e psesently available is that p h o s p h a t e and carbon catabolite control of antibiotic biosynthesis occurs at the transcription level, a l t h o u g h inhibition of antibiotic synthesizing e n z y m e s m a y also occur in some cases. P h o s p h a t e - c o n t r o l s e q u e n c e s similar to the p h o s p h a t e - b o x of E. coil, P s e u d o m o n a s , Zymononas, Klebsiella and E. cloacae have b e e n f o u n d u p s t r e a m of some of the m a n y antibiotic b i o s y n t h e t i c genes and t h e y are likely to be present in m a n y others. Such PC sequences m a y affect the b i n d i n g kinetics of the RNA-polymerase, possibly t h r o u g h interaction with ancillary PC s e q u e n c e - b i n d i n g proteins, as occurs in E. coil, or w i t h specific sigma subunits of the RNA polymerase. T h e intracellular effector that mediates p h o s p h a t e control (probably by interaction w i t h the PC sequencebinding protein) might be a highly p h o s p h o r y l a t e d n u c l e o t i d e or a sugar-phosphate that acts as a sensor of the p h o s p h a t e levels in the culture medium.
References 1 Martin, J. F. and Demain, A. L. (1980) Microbio]. Rev. 44, 230-251 2 Martfn, J. F. and Liras, P. (1989) Annu. Rev. Microbiol. 43, 173-206 3 Martin, J. F. (1989) in Regulation of Secondary Metabolism in Actinomycetes (Shapiro, S., ed.), pp. 213-237, CRC Press 4 Liras, P., Villanueva, J. R. and Martin, J. F. (1977) J. Gen. Microbio]. 102, . 269-277 5 Martin, J. F., Daza, A., Asturias, J. A., Gil, J. A. and Liras, P. (1988) in Biology of Actinomycetes '88 (Okami, Y., Beppu, T. and Ogawara, H., eds), pp. 424-430, Japan Scientific Societies Press 6 Asturias, J. A., Liras, P. and Martin, J. F. Gene (in press) 7 Martin, J. F. (1977) Adv. Biochem. Eng. 6, 105-127 8 Romero, J., Liras, P. and Martin, J. F. (1984) App]. Microbio]. Biotechnol. 20, 318-325 9 Lilley, G., Clark, A; E. and Lawrence, G. C. (1981) J. Chem. Tech. Biotechnol. 31, 127-134 10 Rebollo, A., Gil, J. A., Asturias, J. A., Liras, P. and Martin, J. F. (1989) Gene
79, 47-58 11 Cort6s, J., Martin, J. F., Castro, J. M., L~iz, L. and Liras, P. (1987) J. Gen. Microbiol. 133, 3165-3174 12 Zhang, J., Wolfe, S. and Demain, A. L. (1989) FEMS Microb. Letts. 57, 145-150 13 Fisher, S. H. (1989)/. Bacteriol. 171, 2372-2377 14 Jones, G. H. (1985) J. Bacteriol. 163, 1215-1221 15 Gallo, M. and Katz, E. (1972) J. Bacteriol. 109, 659-667 16 Marshall, R., Redfield, B., Katz, E., Weisbach, H. (1968) Arch. Biochem. Biophys. 123,317-323 17 Aharonowitz, Y. (1980) Annu. Rev. Microbiol. 34, 209-233 18 Bascar~in, V., Hardisson, C. and Brafla, A. F. (1989) J. Gen. Microbio]. 135, 2475-2482 19 Wray, L. V. and Fisher, S. H. (1988) Gene 71,247-256 20 Martin, J. F. and Demain, A. L. (1976) Biochem. Biophys. Res. Commun. 71, 1103-1109 21 Martin, J. F. and Demain, A. L. (1977) Can./. Microbio]. 23, 1334-1339 22 Gil, J. A., Naharro, G., Villanueva, J. R. and Martin, J. F. (1985) J. Gen. Microbio]. 131, 1279-1287 23 Gil, I. A. and Hopwood, D. A. (1983) Gene 25, 119-132 24 Kikuchi, Y., Yoda, K., Yamasaki, M. and Tamura, G. (1981) Nucleic Acids Res. 9, 5671-5678 25 Overbeeke, N., Bergmans, H., Van Mansfelt, F. and Lugtenberg, B. (1983) J. Mo]. Biol. 163, 513-532 26 Makino, K. H., Shinagawa, H., Amemura, M. and Nakata, A. (1986) J. Mol. Biol. 190, 37-44 27 Magota, K., Otsuji, N., Miki, T., Horiuchi, T., Tsunasawa, S., Kondo, J., Sakiyama, F., Amemura, M., Morita, T., Shinagawa, H. and Nakata, A. (1984) J. Bacteriol. 157, 909-917 28 Sengstag, C. and Hinnen, A. (1988) Gene 67,223-228 29 Torriani, A. and Ludtke, D. N. (1985) in The Molecular Biology of Bacterial Growth (Schaechter, M., Neidhart, F. C., Ingraham, J. and Kjeldgaard, N. O., eds), pp. 224-242, Jones and Bartlett Publishers 30 Tommansen, J., Koster, M. and Overduin, P. (1987) J. Mol. Biol. 198, 633-641 31 Pond, J. L., Eddy, C. K., Mackenzie, K. F., Conway, T., Borecky, D. J. and Ingrain, L. O. (1989) J. Bacterio]. 171, 767-774 32 Van der Ley, P., Bekkers, S. A., van Meersbergen, J. and Tommassen, J. (1987) Eur. J. Biochem. 164,469-475 33 Siehnel, R. J., Worobec, E. A. and Hancock, R. E. W. (1988) Mol. Microbiol. 2,347-352 34 Pritchard, A. E. and Vasil, M. L.
TIBTECH - JULY 1990 [Vol. 8]
189
(1986) ]. Bacterio]. 167, 291-298 35 Kimura, S., Makino, K., Shinagawa, H., Amemura, M. and Nakata, A. (1989) Mol. Gen. Genet. 215,374-380 36 Yamada, M., Makino, K., Amemura, M., Shinagawa, H. and Nakat, A. (1989) J. Bacterio]. 171, 5601-5606 37 Ohnuki, T., Imanaka, T. and Aiba, S. (1985) J. BacterioL 164, 85-94 38 Distler, J., Ebert, A., Mansouri, K., Pissowotzki, K., Stockmann, M. and
[]
[]
[]
Piepesberg, W. (1987) Nucleic Acids Res. 15, 8041-8056 39 Murakami, T., Holt, T. G. and Thompson, C. ]. (1989) J. Bacterio]. 171, 1459-1466 40 P6rez-Martin, J., Del Solar, G. H., de la Campa, A. G. and Espinosa, M. (1988) Nucleic Acids Res. 16, 9113-9126 41 Plaskon, R. R. and Wartell, R. M. (1987) Nucleic Acids Res. 15,
[]
[]
[]
[]
[]
[]
Immunotoxins: status and prospects Robert A. Spooner and J. Michael Lord Immunotoxins, which are conjugates of cell-binding antibodies and toxins, show considerable promise in the treatment of certain cancers. Genetic engineering is increasingly being used to refine and modify these conjugates, and it is now possible to design, express and purify completely recombinant therapeutic molecules. Most of the therapeutic drugs available for treatment of cancer rely on uptake by rapidly dividing cells, a poor basis for selectivity since it will still result in significant damage to normal cells. Tumour cells, though, differ not only in freedom from normal growth constraints, but also in an altered spectrum of gene expression. Where this results in expression of tumour-specific or tumour-associated antigens at the cell surface, antibodies recognizing these may be considered for use as therapeutic agents. Such antibodies may be directly cytotoxic, stimulating complement fixation that results in cell lysis or marshalling a variety of white cells to a tumour. However, despite these characteristics, there is no convincing evidence of any cancer being cured exclusively by administration of antibodies, although some remissions have been observed. Nevertheless, the impressive ability of antibodies to differentiate be-
R. A. Spooner is at the Imperial Cancer Research Fund, Clare Hall Laboratories, South Mimms, Potters Bar EN6 3LD, UK and I. M. Lord is at the Department of Biological Sciences, University of Warwick, Coventry CV4 7AL, UK. ~) 1990, Elsevier Science Publishers Ltd (UK)
tween closely related antigens makes them very attractive targeting devices, particularly since the required specificity can often be elicited by immunizing appropriate animals with the target tumour tissue. The animal's B lymphocytes, dedicated to the production of antibodies, can be fused with related plasmacytoma cells to produce hybridomas, which are capable of making antibodies in cell culture 1. Each individual hybridoma provides a virtually unlimited source of a monoclonal antibody that can be highly purified and screened for reactivity against the initiating tumour immunogen. If a tumour-specific monoclonal antibody is chemically linked to suitable drugs, toxins or radionuclides then cytotoxic agents with a high degree of selectivity are formed. Such molecules fit the description of 'Zauberkugeln' or 'magic bullets' proposed at the turn of this century by Paul Ehrlich, so the idea is by no means new. In this article we concentrate on the production and uses of one particular subset of magic bullets, immunotoxins, comprising a monoclonal antibody coupled to a naturally occurring plant or bacterial toxin.
0167 - 9430/90/$2.00
785-796 42 Struhl, K. (1985) Nature 317, 822-824 43 Reitzer, L. J. and Magasanik, B. (1986) Cell 45, 785-792 44 Buttner, M. J. (1989) Mol. Microbiol. 3, 1653-1659 45 Buttner, M. ]., Smith, A. M. and Bibb, M. J. (1988) Cell 52,599-609 46 Westpheling, J. and Brawner, M. (1989) J. Bacteriol. 171, 1355-1360
[]
[]
[]
Toxins A wide range of organisms, including bacteria, fungi and higher plants, produce protein toxins. Such toxins presumably have either a defensive role against predators or an offensive role against host or 'prey' cells. The majority of enzyme toxins produced are directed against protein translation, either against translation factors or ribosome function. In principle, any of quite a wide variety of toxins capable of acting against the target cell may be used, but bacterial toxins such as diphtheria toxin and plant toxins such as ricin have been used most frequently in the design of immunotoxins. Toxins fall into two broad categories: those with both an A (or active) chain(s) that has enzymatic activity and a B (or binding) chain(s) that binds to cell surfaces and may be involved in uptake, and those which have only A chains - for use in immunotoxins the latter type must be delivered to the cell by other means for them to have a cytotoxic effect. Bacterial toxins
Diphtheria toxin is secreted by the bacterium Corynebacterium d i p h theriae lysogenic for the fito×+ bacteriophage. It is produced as a preproprotein that is trimmed to a mature form consisting of a cytotoxic A chain disulphide-linked to a cellbinding B chain. In spite of considerable effort, the identity of its receptor on sensitive cells remains uncertain. After binding, its receptors become clustered in coated pits that are endocytotically invaginated. The endosome becomes increasingly acidified and at pH 5.3 the toxic A chain is released from the receptorbound B chain, and is translocated
TIBTECH - JULY 1990 [Vol. 8]
Phosphate control sequences involved in transcriptional regulation of antibiotic biosynthesis Paloma Liras, Juan A. Asturias and Juan F. Martin The expression of genes encoding enzymes involved in antibiotic and other secondary metabolite biosynthesis is down-regulated by easily assimilable phosphate, carbon and nitrogen sources. Phosphate control of antibiotic production appears to act at the transcriptional level by a mechanism similar to that involved in control of phosphatases and other phosphate-regulated enzymes. A phosphate control (PC) sequence, strikingly similar to the phosphate control (pho) boxes of many bacterial genes, has been isolated from the phosphate regulated promoter that controls biosynthesis of the antibiotic candicidin, and characterized. From computer analysis of sequence data, PC sequences appear to be associated with promoter regions of several phosphate-controlled antibiotic biosynthetic genes. Biosynthesis of antibiotics and other secondary metabolites is regulated negatively by easily utilizable phosphate, carbon and nitrogen sources at the level of transcription. Little is known about the mechanism of carbon catabolite and nitrogen regulation of antibiotic biosynthesis at the transcriptional level. Recognition of particular promoters by different forms of RNA polymerase carrying specific sigma subunits may explain the changes in transcriptional activity of carbon or nitrogenregulated promoters. With phosphate, biosynthesis of many antibiotics is repressed by concentrations of above 1 mM. Production of these metabolites takes place only w h e n the producer cells reach phosphatestarvation conditions. We have identified a 114 bp phosphate-regulated promoter involved in phosphate control of ~ the biosynthesis of the antibiotic candicidin. It contains a phosphate control (PC) sequence which bears extreme homology to the reported phosphate control (pho) box of many genes in Escherichia
P. Liras, J. A. Asturias and J. F. Martin are at the Section of Microbiology, Department of Ecology, Genetics and Microbiology, University of Le6n, 24071 Le6n, Spain. (~ 1990, Elsevier Science Publishers Ltd (UK)
coli, Pseudomonas aeruginosa, Enterobacter cloacae, Klebsiella pneumoniae and Zymomonas mobilis. Northern analysis of the transcripts formed from the 114 bp promoter revealed that phosphate control takes place at the transcriptional level. Computer analysis of upstream sequences of several antibiotic biosynthetic genes, known to be regulated by phosphate, revealed the presence of PC sequences associated with the promoter regions of these genes. It seems likely that phosphate control of antibiotic expression is exerted at the transcriptional level by a mechanism similar to that involved in phosphate repression of phosphatases and other phosphate-regulated enzymes.
Production of secondary metabolites occurs at low specific growth rates In rich medium, producer organisms only form secondary metabolites (including antibiotics, alkaloids, mycotoxins, pigments, ionophores, organic acids, etc.), at low specific growth rates, after most cell growth has already occurred 1. In a few cases, this increased production at low specific growth rate has been confirmed in chemostat cultures. In defined media, growth limitations and, therefore, formation of second-
0167 - 9430/90/$2.00
ary metabolites, may occur from the beginning of the culture. The delay in formation of antibiotics and other secondary metabolites until the growth rate has decreased below a certain threshold is genetically determined and probably results in increased survivorship in the producer strains 1. Some of the secondary metabolites have antimicrobial activity and may serve to control the growth of competing microorganisms under starving conditions. Other metabolites are scavengers of phosphate, iron and other ions, or play a variety of ecological roles in the rhizosphere or in the interaction of microorganisms with plants and animals. Many other secondary metabolites may serve as triggers of the differentiation of the prcducer strains or as effectors of secondary metabolism 2. Therefore, it seems likely that formation of secondary metabolites is not necessary if abundant nutrients are available. In general, supplementation of a culture committed to antibiotic biosynthesis with an easily utilizable nutrient (e.g. glucose, phosphate, ammonium) results in suppression of secondary metabolite formation and a burst of growth. Conversely, a nutritional shift down usually produces a rapid onset of the biosynthesis of these metabolites. How does the cell control the differential expression of the genetic information required for growth and for antibiotic biosynthesis? After several years of research this is beginning to be understood at the molecular level. In this article we mainly discuss the phosphate control of biosynthesis of secondary metabolites; however, very similar conclusions are emerging from initial studies on carbon catabolite control and nitrogen regulation.
Regulation of antibiotic production Several enzymes involved in antibiotic biosynthesis are either inhibited or repressed by easily assimilable phosphate, carbon or nitrogen sources. Phosphate control of the formation of secondary metabolites is commonly observed in bacteria, fungi and plants (see review by Martin3). Inorganic phosphate concentrations greater than 3-5 mM are frequently inhibitory for the production of plant, fungal and bacteria] secondary
TIBTECH- JULY 1990 [Vol. 8]
--Table
185
I
Enzymes regulated by phosphate that are involved in antibiotic biosynthesis Antibiotic
Producing organism
Target enzyme
Candicidin
Streptomyces griseus Acremonium chrysogenum Streptomyces clavuligerus
p-Aminobenzoate synthase Deacetoxycephalosporin C synthetase b o~-Aminoadipyl-cysteinyl-valine-synthase Deacetoxycephalosporin C synthetase b Isopenicillin N synthetase b Deacetoxycephalosporin C synthase b Gramicidin S synthetase Neomycin phosphate phosphotransferase Streptomycin-6-phosphate phosphotransferase An hydrotetracycline oxygenase Valine dehydrogenase MethylmalonyI-CoA: pyruvate transcarboxylase PropionyI-CoA carboxylase Protylonolide synthetase dTDP-D-g lucose-4,6-dehydratase dTDP-mycarose synthetase Macrocin O-methyltransferase
Cephalosporin Cephamycin Cephamycin Gramicidin S
Neomycin Streptomycin Tetracycline Tylosin
Nocardia lactamdurans Bacillus brevis Streptomyces fradiae Streptomyces griseus Streptomyces aureofaciens Streptomyces fradiae
Streptomyces T59-235
Mechanism of regulation a R
D D I I I
D R R R
D D D D R R R
aR, repression; I, inhibition; D, depression of the enzyme occurs but the evidence does not prove unequivocally the existence of a repression mechanism. bEnzymes involved in cephamycin and cephalosporin biosynthesis are less sensitive to phosphate control than other antibiotic biosynthetic enzymes. Antibiotic synthetases require ATP whereas synthases do not.
metabolites in liquid culture, although the growth of the producer cells is progressively stimulated by increasing phosphate concentrations, up to 300 mM (Ref. 4). Many of the enzymes of the central pathways of primary metabolism (e.g. phosphofructokinase, glucose-6phosphate dehydrogenase) are stimulated by phosphate, thus providing greater amounts of intermediates required for macromolecule biosynthesis during the increased growth that occurs in the presence of elevated phosphate concentrations 4. Phosphate addition greatly stimulates formation of RNA (mainly ribosomal) in Streptomyces griseus 5'6. In summary, it seems that phosphate stimulates expression of genes involved in the biosynthesis of macromolecules and house-keeping genes (i.e. those genes that are required for growth and proper working of the cell machinery), whereas it frequently inhibits expression of genes encoding enzymes for the biosynthesis of secondary metabolites. Phosphate-mediated stimulation of growth may be a complex phenomenon whereas phosphate repression of individual genes or clusters of genes appears to be a specific phenomenon. The biosynthesis of several groups
of antibiotics, including aminoglycosides, tetracyclines, macrolides, polyenes, anthracyclines, ansamycins and polyethers, is particularly sensitive to phosphate regulation. These compounds are synthesized by different biosynthetic pathways; they may play very different roles in the producer organisms and their only common feature is that they are all typical secondary metabolites. However, not all antibiotics and other secondary metabolites are equally sensitive to phosphate control 7. The biosynthesis of [3lactam antibiotics, and peptide secondary metabolites in general, is poorly sensitive to high concentrations of inorganic phosphate but very sensitive to carbon and nitrogen catabolite regulation. For example, biosynthesis of clavulanic acid by Streptomyces clavuligerus (a strain that synthesizes several unrelated antibiotics) is very sensitive to phosphate regulation, whereas production of the ~-lactam antibiotic cephamycin by the same strain is not affected by 25 mM phosphate. It is, therefore, possible to dissociate cephamycin from clavulanic acid biosynthesis by adjusting the phosphate level in the medium s . Sequential formation of thienamycin and other different antibiotics in a cul-
ture of Streptomyces cattleya has been reported to be due to different degrees of nutrient limitation 9, indicating that even though a general phenomenon of phosphate control of secondary metabolism gene expression exists, different genes are modulated to different extents. Whether there is a mechanism common to different antibiotic-producing Streptomyces is an open question. Phosphate control of the expression of a candicidin-synthesizing gene from S. griseus is also exerted when the gene is introduced into S. lividans 1°. An important conclusion that is emerging from recent studies on phosphate regulation is that expression of genes encoding diverse antibiotic synthetases, which catalyse reactions in which orthophosphate is neither a substrate nor a product of the reaction, are repressed by phosphate 3. In addition, some other enzymes are inhibited (but not repressed) by phosphate, e.g. deacetoxycephalosporin C synthase in
Streptomyces clavuligerus, Nocardia lactamdurans 11 and Acremonium chrysogen um 12, indicating that there are at least two different levels at which phosphate control is exerted (Table 1). Regulation of antibiotics by easily assimilated carbon and nitrogen
186
sources has been observed, and probably operates by a mechanism similar to that of phosphate control ~3,~4. Phenoxazinone synthase (PHS), the enzyme of S. antibioticus that forms the phenoxazinone nucleus of actinomycin, is controlled by carbon catabolite regulation 15. Synthesis of PHS is initiated after cellular growth, and its specific activity increases after glucose depletion 16. High glucose levels severely repress production of PHS in S. antibioticus, but not in S. lividans. Nitrogen regulation of antibiotic biosynthesis is a well-known phenomenon 17-a9 but the molecular mechanism is not known.
Phosphate and carbon catabolite control at the transcriptional level The biosynthesis of the polyene macrolide antibiotic candicidin has been intensively studied as a model of phosphate control 4'2°-22. The precursor of the p-aminoacetophenone moiety of candicidin, p-aminobenzoic acid (PABA), is formed from chorismic acid by a specific PABA synthase for secondary metabolism. Formation of PABA synthase is strongly repressed by phosphate 22. Phosphate control is exerted at the transcriptional level 5'6. The specific mRNA for PABA synthase in S. griseus was quantified using an internal fragment of the pabS gene as a probe. In batch cultures of S. griseus, synthesis of mRNA for PABA synthase was derepressed early in the fermentation and reached a peak at 12 h of incubation. A decrease of 95% in the formation of specific mRNA for PABA synthase was observed when the cultures were supplemented with 7.5raM phosphate, even though formation of total RNA was greatly stimulated 6. Similarly, carbon catabolite regulation is exerted in some cases at the transcription level. Jones TM has reported that carbon catabolite regu-
TIBTECH - JULY 1990 [Vol. 8]
lation of actinomycin biosynthesis 15 is exerted by repression of the formation of mRNA for PHS. PHS mRNA levels appear to increase only after all the glucose in the medium has been used 14.
Phosphate control of candicidin biosyn thesis The gene encoding PABA synthase (pabS) together with its own promoter was cloned in a 4.5 kb BamHI fragment of DNA from S. griseus 23. Expression of the pabS gene is strongly repressed by phosphate when the gene is transcribed from its own promoter 5'1°. More than 50% repression of PABA synthase formation from the cloned pabS gene was observed in medium supplemented with 0.1mM phosphate. A 114 bp promoter (Pl14) was isolated from the upstream region of the structural pabS gene using the promoter probe vector pIJ424 (Fig. 1)TM. It is an AT-rich fragment (46% G+C versus 70-73% for the genome of Streptomyces), that shows a good homology in the - 1 0 region with other Streptomyces promoters 2 but lacks a standard - 3 5 region.
phate-regulated promoters revealed the presence in Pl14 of a PC sequence (Fig. 1 and Table 2) that is strikingly similar to the reported phosphate boxes of the phoB, phoR, phoS (pstS), phoE (omp) and phoA of E. coil24-27. It contains 12 nucleotides that are identical to the 18 existing in the consensus E. coli pho box. The similarity is even more surprising if the disparity in G+C content of Streptomyces and E. co]i is taken into account. Interestingly, the E. coli gene encoding phoS has two similar phosphate boxes in tandem 28. Both the S. griseus Pl14 PC sequence and the E. coil pho box show a tandem repeat structure that is abbreviated in the PC sequence. Although the similarity of the PC sequence with other bacterial phosphate boxes is striking, in vitro mutagenesis studies are being carried out to confirm its role in phosphate control (J. A. Asturias, unpublished).
Phosphate control sequences in E. coli, Pseudomonas, Enterobacter
and other organisms E. coli has a very complex regu-
latory mechanism for genes involved in uptake and metabolism of Phosphate control sequences phosphate 29. phoA encodes the periA phosphate control sequence in plasmic alkaline phosphatase and phosphate-regulated Streptomyces phoE codes for an outer membrane promoters pore protein that is induced under The structural Tn5 gene for kana- phosphate limitation. At least three mycin phosphotransferase, when genes, phoB, phoR and phoM, are fused to the pabS Pl14 promoter, was implicated in the regulation of the efficiently expressed in conditions pho regulon. The phoB protein of phosphate starvation, but expres- functions as an activator of transion was decreased by increasing scription of the structural genes of concentrations of phosphate TM. The the pho regulon, whereas phoB ex114 bp phosphate-regulated pro- pression is in turn modulated by the moter was trimmed down to a 35 bp products of the phoR and phoM. In core sequence which was still sensi- addition, phoB expression appears tive to phosphate control. We pro- to be autoregulated 3°. posed that a phosphate control (PC) Comparison of the nucleotide sequence was present in the up- sequences of the promoter regions of stream region of the phosphate- phoA (Ref. 24), phoE (Refs 25, 27) regulated Pl14 promoter 5'1°. and phoB (Ref. 26) revealed the presSequence analysis of the P114 ence of a consensus 18 bp sequence promoter and other known phos- in the sense strand (phosphate box)
~Fig. 1 5' TCTTATCCATTCTGTAGCTGATGAGATTAATATCCCAGGCG
-10 .-~ I I I I CACAATCGGGGGGCATGGTACCCCCACATCTATTGAATCCGCAACGCGCAGTATCATGACAGCTAAAGA
3' AGAATAGGTAAGACATCGACTACTCTAA~rATAGGGTCCGCAAAAGTG~AGCCCCCCGTACCATGGGGGTGAGATAACTTAGGCGT][GCGCGTCATAGTACTGTC]GA~TCT
3' 5'
PC sequence
Nucleotide sequence of the P714 phosphate-regulated promoter w. The first transcribed nucleotide according to $1 mapping studies is indicated by a thick arrow. The PC sequence (Table 2) is boxed. An inverted repeat is overlined. The ORF Of the structural p a b S gene is located downstream in the upper strand (5' to3"). A putative -10 region is indicated.
TIBTECH - JULY 1990 [Vol. 8]
187
~Table 2
Phosphate control sequences existing in phosphate-regulated promoters in different microorganisms Microorganisms
E. coli E. cloacae K. pneumoniae Z. mobilis P. aeruginosa P. aeruginosa S. griseus S. lividans S. griseus
Gene
Protein
Sequence
[phoB |phoR hoA
PhoB (regulator) PhoR (regulator) Alkaline phosphatase
| phoS (pstS) [phoE ~, u g p B phoE phoE phoC plC oprP pabS
Phosphate-binding protein CTGTCAT,aU&AACTGTCAT Outer-membrane porin T T T C Glycerol-3-P binding protein Outer-membrane porin 5, TTGTCATA.tufAGTTTCAT 3, Outer-membrane porin TTGTCATAAATATTTAAT Acid phosphatase TTGTCTTATTATAGCCAC Phospholipase C AGGTCATATCGAAGTCGC Periplasmic porin TTGCAGTCTCGCTGTCAC PABA synthase CTGTCATGATACTGCGCG Unknown product CTTGCACCTCACGTCACG Streptomycin phosphotransferase CTGTGCCGACATCTGGCAT
~p
ORFX b
sph=aphD
~ l
Consensus 5' --> 3'
% Homology 95 a 95a 89 95 83 89 83 77 66 61 61 66 66 72
aphoB and phoR form an operon with a common promoter and pho box. The homology is given as the percentage of nucleotides identical to the consensus E. colipho box. All the E. coil sequences show small differences with respect to the E. coliconsensus box (83 to 95% homology). The tamden repeat in the E. coli pho box is indicated by arrows. bORFX is expressed from the P143promoter region of the tipA gene but in the opposite orientation. The nucleotides in bold type are conserved with respect to the E. coliconsensus pho box.
(Table 2). The pho box was followed 11 bp downstream by a potential Pribnow box, suggesting that the pho box functions as an aberrant -35 region in E. coli phosphatecontrolled promoters 3°. Similarly, a pho box has been identified in the sense strand in the promoter region of the phoA gene of Zymononas mobi]Js31. In the promoter regions of phoE genes of E. coli 3°, Klebsiella pneumoniae and Enterobacter cloacae 32, a second upstream element that is required for efficient expression of the phoE gene shows homology to the pho box but in the opposite orientation. Pseudomonas aeruginosa has a pho regulon that contains a phosphate-starvation inducible periplasmic phosphate-binding protein (that functions as an outer membrane porin) (oprP) and carries a pho box upstream of the oprP (Ref. 33). A similar pho box was found in another phosphate-regulated gene of Pseudomonas aeruginosa that encodes a heat-labile secreted hemolysin (phospholipase C)34. The two Pseudomonas pho boxes show 61% homology with the E. coli consensus sequence (Table 2). Since P. aeruginosa and E. coli belong to different bacterial families and have quite different G+C contents, the available evidence suggests a strong evol-
utionary conservation of the regulatory elements of the pho regulon.
Phosphate-control sequences in other an tibiotic-biosyn th etic genes from Streptomyces Several genes involved in antibiotic biosynthesis have been cloned 2. Expression of some of the genes involved in streptomycin biosynthesis, e.g. the sph (=aphD) gene encoding the streptomycin phosphotransferase, is known to be regulated by phosphate (Table 1). Computer analysis of the upstream region of the published sequence of the sph gene of S. gFiseus 37 revealed a previously unreported putative PC sequence in the sph P2 promoter, 324 nucleotides upstream of the ATG initiation triplet of the sph gene of S. griseus. A pseudo PC sequence at 347 nucleotides was also found, and both of them were located in the long transcribed region between the transcription initiation site and the ATG translation initiation triplet 38. The sph PC box is located in the sense strand and contains 13 out of 18 nucleotides identical to the pho box of E. coli (Table 2). Recently, a gene (tipA) induced by thiostrepton in S. lividans has been cloned 39. The promoter (P143) of the tipA gene shows promoter activity in both orientations. In the orientation
opposite to the tipA, expression of an u n k n o w n open reading flame X is regulated by phosphate (C. Thompson, pers. commun.). We have found a putative PC sequence located in the P143 promoter region, upstream of the tipA gene, in the strand opposite to that carrying the phosphateregulated open reading flame X. It has 12 out of 18 identical nucleotides (Table 2). Similarly, the PC sequence of the pabS gene is also located in the strand opposite to that carrying the ORF of the pabS gene and overlaps with the Pl14 promoter (Fig. 1). The mechanism of PC regulation We can only speculate at this stage on the mechanism by which transcription is selectively blocked at phosphate-regulated promoters. One possibility involves specific DNAbinding proteins. A DNA-binding protein (the product of the phoB gene) that recognizes and binds the phoS promoter region and other pho box-containing promoters has been isolated from E. coli 35'36. Further studies on the role of these boxes in phosphate control are needed. The location and orientation of the phosphate boxes with respect to the phosphate-regulated promoters is not constant, as is the case with operator regions in glucose-
188
regulated promoters in E. coll. This suggests that the h y p o t h e s i s that these boxes function as aberrant - 3 5 regions m a y be untrue. Rather, it seems likely that they act by changing the specificity of RNAp o l y m e r a s e - D N A interaction w h e n the p h o boxes are r e c o g n i z e d b y DNA-binding proteins, w h i c h m a y result in DNA bending. If a PC sequence-binding protein exists (similar to the p h o B product), the interaction of this protein w i t h the PC sequences will p r e v e n t transcription by RNA polymerase. In this. regard, the location of the PC seq u e n c e either in the sense or in the opposite strand is not critical, as long as it prevents R N A - p o l y m e r a s e interaction with phosphate-regulated promoters. Indeed, in yeasts, the p h o s p h a t e control s e q u e n c e (UAS) of the acid p h o s p h a t a s e gene (1317o5) m o d u l a t e s p h o s p h a t e control w h e n u s e d in the opposite orientation 28. Alternatively, PC sequences m a y confer s e q u e n c e - i n d u c e d b e n d i n g characteristics o n the DNA (Ref. 40) or a change in s u p e r h e l i c i t y that will affect formation of the o p e n c o m p l e x and therefore initiation of transcription. This b e n d i n g c o u l d be further m o d i f i e d by binding of proteins; p r o t e i n - i n d u c e d bends in DNA seems to be a c o m m o n feature in regions of DNA subjected to regulation of gene e x p r e s s i o n 41. Selective transcription of carbon ca tabolite an d nitrogen-regula ted promoters It is well established that u p s t r e a m sequences are i n v o l v e d in m o d u l a t ing expression of the carbon catabolite regulated genes in yeasts 42 a n d the nitrogen regulated genes (e.g. glnA) in enterobacteria 43. H o w e v e r , v e r y little is k n o w n about the molecular m e c h a n i s m s of carbon or nitrogen regulation at the transcription level. The RNA p o l y m e r a s e of Streptomyces shows a great heterogeneity of sigma factors 44 and this m a y explain the selective use of different p r o m o t e r s observed in t r a n s c r i p t i o n of the Streptomyces coelicolor agarase gene 45 and the galactose o p e r o n 46. It is not k n o w n w h e t h e r different sigma subunits are i n v o l v e d in transcription of carbon-, nitrogen- or p h o s p h a t e - r e g u l a t e d p r o m o t e r s of antibiotic b i o s y n t h e t i c genes. The glutamine s y n t h e t a s e gene of S. coelicolor has b e e n
TIBTECH - JULY 1990 [Vol. 8]
c l o n e d TM but the m e c h a n i s m of nitrogen control of the g l u t a m i n e synthetase in Streptomyces remains obscure.
Conclusions and prospects The c o n c l u s i o n from the e v i d e n c e psesently available is that p h o s p h a t e and carbon catabolite control of antibiotic biosynthesis occurs at the transcription level, a l t h o u g h inhibition of antibiotic synthesizing e n z y m e s m a y also occur in some cases. P h o s p h a t e - c o n t r o l s e q u e n c e s similar to the p h o s p h a t e - b o x of E. coil, P s e u d o m o n a s , Zymononas, Klebsiella and E. cloacae have b e e n f o u n d u p s t r e a m of some of the m a n y antibiotic b i o s y n t h e t i c genes and t h e y are likely to be present in m a n y others. Such PC sequences m a y affect the b i n d i n g kinetics of the RNA-polymerase, possibly t h r o u g h interaction with ancillary PC s e q u e n c e - b i n d i n g proteins, as occurs in E. coil, or w i t h specific sigma subunits of the RNA polymerase. T h e intracellular effector that mediates p h o s p h a t e control (probably by interaction w i t h the PC sequencebinding protein) might be a highly p h o s p h o r y l a t e d n u c l e o t i d e or a sugar-phosphate that acts as a sensor of the p h o s p h a t e levels in the culture medium.
References 1 Martin, J. F. and Demain, A. L. (1980) Microbio]. Rev. 44, 230-251 2 Martfn, J. F. and Liras, P. (1989) Annu. Rev. Microbiol. 43, 173-206 3 Martin, J. F. (1989) in Regulation of Secondary Metabolism in Actinomycetes (Shapiro, S., ed.), pp. 213-237, CRC Press 4 Liras, P., Villanueva, J. R. and Martin, J. F. (1977) J. Gen. Microbio]. 102, . 269-277 5 Martin, J. F., Daza, A., Asturias, J. A., Gil, J. A. and Liras, P. (1988) in Biology of Actinomycetes '88 (Okami, Y., Beppu, T. and Ogawara, H., eds), pp. 424-430, Japan Scientific Societies Press 6 Asturias, J. A., Liras, P. and Martin, J. F. Gene (in press) 7 Martin, J. F. (1977) Adv. Biochem. Eng. 6, 105-127 8 Romero, J., Liras, P. and Martin, J. F. (1984) App]. Microbio]. Biotechnol. 20, 318-325 9 Lilley, G., Clark, A; E. and Lawrence, G. C. (1981) J. Chem. Tech. Biotechnol. 31, 127-134 10 Rebollo, A., Gil, J. A., Asturias, J. A., Liras, P. and Martin, J. F. (1989) Gene
79, 47-58 11 Cort6s, J., Martin, J. F., Castro, J. M., L~iz, L. and Liras, P. (1987) J. Gen. Microbiol. 133, 3165-3174 12 Zhang, J., Wolfe, S. and Demain, A. L. (1989) FEMS Microb. Letts. 57, 145-150 13 Fisher, S. H. (1989)/. Bacteriol. 171, 2372-2377 14 Jones, G. H. (1985) J. Bacteriol. 163, 1215-1221 15 Gallo, M. and Katz, E. (1972) J. Bacteriol. 109, 659-667 16 Marshall, R., Redfield, B., Katz, E., Weisbach, H. (1968) Arch. Biochem. Biophys. 123,317-323 17 Aharonowitz, Y. (1980) Annu. Rev. Microbiol. 34, 209-233 18 Bascar~in, V., Hardisson, C. and Brafla, A. F. (1989) J. Gen. Microbio]. 135, 2475-2482 19 Wray, L. V. and Fisher, S. H. (1988) Gene 71,247-256 20 Martin, J. F. and Demain, A. L. (1976) Biochem. Biophys. Res. Commun. 71, 1103-1109 21 Martin, J. F. and Demain, A. L. (1977) Can./. Microbio]. 23, 1334-1339 22 Gil, J. A., Naharro, G., Villanueva, J. R. and Martin, J. F. (1985) J. Gen. Microbio]. 131, 1279-1287 23 Gil, I. A. and Hopwood, D. A. (1983) Gene 25, 119-132 24 Kikuchi, Y., Yoda, K., Yamasaki, M. and Tamura, G. (1981) Nucleic Acids Res. 9, 5671-5678 25 Overbeeke, N., Bergmans, H., Van Mansfelt, F. and Lugtenberg, B. (1983) J. Mo]. Biol. 163, 513-532 26 Makino, K. H., Shinagawa, H., Amemura, M. and Nakata, A. (1986) J. Mol. Biol. 190, 37-44 27 Magota, K., Otsuji, N., Miki, T., Horiuchi, T., Tsunasawa, S., Kondo, J., Sakiyama, F., Amemura, M., Morita, T., Shinagawa, H. and Nakata, A. (1984) J. Bacteriol. 157, 909-917 28 Sengstag, C. and Hinnen, A. (1988) Gene 67,223-228 29 Torriani, A. and Ludtke, D. N. (1985) in The Molecular Biology of Bacterial Growth (Schaechter, M., Neidhart, F. C., Ingraham, J. and Kjeldgaard, N. O., eds), pp. 224-242, Jones and Bartlett Publishers 30 Tommansen, J., Koster, M. and Overduin, P. (1987) J. Mol. Biol. 198, 633-641 31 Pond, J. L., Eddy, C. K., Mackenzie, K. F., Conway, T., Borecky, D. J. and Ingrain, L. O. (1989) J. Bacterio]. 171, 767-774 32 Van der Ley, P., Bekkers, S. A., van Meersbergen, J. and Tommassen, J. (1987) Eur. J. Biochem. 164,469-475 33 Siehnel, R. J., Worobec, E. A. and Hancock, R. E. W. (1988) Mol. Microbiol. 2,347-352 34 Pritchard, A. E. and Vasil, M. L.
TIBTECH - JULY 1990 [Vol. 8]
189
(1986) ]. Bacterio]. 167, 291-298 35 Kimura, S., Makino, K., Shinagawa, H., Amemura, M. and Nakata, A. (1989) Mol. Gen. Genet. 215,374-380 36 Yamada, M., Makino, K., Amemura, M., Shinagawa, H. and Nakat, A. (1989) J. Bacterio]. 171, 5601-5606 37 Ohnuki, T., Imanaka, T. and Aiba, S. (1985) J. BacterioL 164, 85-94 38 Distler, J., Ebert, A., Mansouri, K., Pissowotzki, K., Stockmann, M. and
[]
[]
[]
Piepesberg, W. (1987) Nucleic Acids Res. 15, 8041-8056 39 Murakami, T., Holt, T. G. and Thompson, C. ]. (1989) J. Bacterio]. 171, 1459-1466 40 P6rez-Martin, J., Del Solar, G. H., de la Campa, A. G. and Espinosa, M. (1988) Nucleic Acids Res. 16, 9113-9126 41 Plaskon, R. R. and Wartell, R. M. (1987) Nucleic Acids Res. 15,
[]
[]
[]
[]
[]
[]
Immunotoxins: status and prospects Robert A. Spooner and J. Michael Lord Immunotoxins, which are conjugates of cell-binding antibodies and toxins, show considerable promise in the treatment of certain cancers. Genetic engineering is increasingly being used to refine and modify these conjugates, and it is now possible to design, express and purify completely recombinant therapeutic molecules. Most of the therapeutic drugs available for treatment of cancer rely on uptake by rapidly dividing cells, a poor basis for selectivity since it will still result in significant damage to normal cells. Tumour cells, though, differ not only in freedom from normal growth constraints, but also in an altered spectrum of gene expression. Where this results in expression of tumour-specific or tumour-associated antigens at the cell surface, antibodies recognizing these may be considered for use as therapeutic agents. Such antibodies may be directly cytotoxic, stimulating complement fixation that results in cell lysis or marshalling a variety of white cells to a tumour. However, despite these characteristics, there is no convincing evidence of any cancer being cured exclusively by administration of antibodies, although some remissions have been observed. Nevertheless, the impressive ability of antibodies to differentiate be-
R. A. Spooner is at the Imperial Cancer Research Fund, Clare Hall Laboratories, South Mimms, Potters Bar EN6 3LD, UK and I. M. Lord is at the Department of Biological Sciences, University of Warwick, Coventry CV4 7AL, UK. ~) 1990, Elsevier Science Publishers Ltd (UK)
tween closely related antigens makes them very attractive targeting devices, particularly since the required specificity can often be elicited by immunizing appropriate animals with the target tumour tissue. The animal's B lymphocytes, dedicated to the production of antibodies, can be fused with related plasmacytoma cells to produce hybridomas, which are capable of making antibodies in cell culture 1. Each individual hybridoma provides a virtually unlimited source of a monoclonal antibody that can be highly purified and screened for reactivity against the initiating tumour immunogen. If a tumour-specific monoclonal antibody is chemically linked to suitable drugs, toxins or radionuclides then cytotoxic agents with a high degree of selectivity are formed. Such molecules fit the description of 'Zauberkugeln' or 'magic bullets' proposed at the turn of this century by Paul Ehrlich, so the idea is by no means new. In this article we concentrate on the production and uses of one particular subset of magic bullets, immunotoxins, comprising a monoclonal antibody coupled to a naturally occurring plant or bacterial toxin.
0167 - 9430/90/$2.00
785-796 42 Struhl, K. (1985) Nature 317, 822-824 43 Reitzer, L. J. and Magasanik, B. (1986) Cell 45, 785-792 44 Buttner, M. J. (1989) Mol. Microbiol. 3, 1653-1659 45 Buttner, M. ]., Smith, A. M. and Bibb, M. J. (1988) Cell 52,599-609 46 Westpheling, J. and Brawner, M. (1989) J. Bacteriol. 171, 1355-1360
[]
[]
[]
Toxins A wide range of organisms, including bacteria, fungi and higher plants, produce protein toxins. Such toxins presumably have either a defensive role against predators or an offensive role against host or 'prey' cells. The majority of enzyme toxins produced are directed against protein translation, either against translation factors or ribosome function. In principle, any of quite a wide variety of toxins capable of acting against the target cell may be used, but bacterial toxins such as diphtheria toxin and plant toxins such as ricin have been used most frequently in the design of immunotoxins. Toxins fall into two broad categories: those with both an A (or active) chain(s) that has enzymatic activity and a B (or binding) chain(s) that binds to cell surfaces and may be involved in uptake, and those which have only A chains - for use in immunotoxins the latter type must be delivered to the cell by other means for them to have a cytotoxic effect. Bacterial toxins
Diphtheria toxin is secreted by the bacterium Corynebacterium d i p h theriae lysogenic for the fito×+ bacteriophage. It is produced as a preproprotein that is trimmed to a mature form consisting of a cytotoxic A chain disulphide-linked to a cellbinding B chain. In spite of considerable effort, the identity of its receptor on sensitive cells remains uncertain. After binding, its receptors become clustered in coated pits that are endocytotically invaginated. The endosome becomes increasingly acidified and at pH 5.3 the toxic A chain is released from the receptorbound B chain, and is translocated
