Phenotypic characterization and genetic diversity of Flavobacterium columnare isolated from red tilapia, Oreochromis sp., in Thailand.

doi:10.1111/jfd.12304

Journal of Fish Diseases 2014

Phenotypic characterization and genetic diversity of Flavobacterium columnare isolated from red tilapia, Oreochromis sp., in Thailand H T Dong1, B LaFrentz2, N Pirarat3 and C Rodkhum1 1 Department of Veterinary Microbiology, Faculty of Veterinary Science, Chulalongkorn University, Bangkok, Thailand 2 United States Department of Agriculture-Agricultural Research Service, Aquatic Animal Health Research Unit, Auburn, AL, USA 3 Department of Veterinary Pathology, Faculty of Veterinary Science, Chulalongkorn University, Bangkok, Thailand

Abstract

Flavobacterium columnare is the aetiological agent of columnaris disease and severely affects various freshwater aquaculture fish species worldwide. The objectives of this study were to determine the phenotypic characteristics and genetic variability among F. columnare isolates isolated from red tilapia in Thailand. Forty-four F. columnare isolates were recovered from diseased fish in different geographical locations. The isolates exhibited homologous phenotypic characteristics but exhibited genetic diversity. One isolate was assigned to genomovar I, and the remainder were assigned to genomovar II, indicating the coexistence of these genomovars but predominance of genomovar II. Phylogenetic analysis of the 16S-23S ISR sequences revealed that a subset of the Thai isolates (n = 25) contained a smaller intergenic spacer region (ISR) (523–537 bp) and formed a unique ISR phylogenetic group. Phylogenetic analysis of the 16S rRNA gene supported the unique cluster of Thai isolates. This is the first description of the phenotypic and molecular characteristics of F. columnare isolated from red tilapia in Thailand as well as five isolates of F. columnare derived from other fish species including Nile tilapia, koi carp and striped catfish. Correspondence C Rodkhum, Department of Veterinary Microbiology, Faculty of Veterinary Science, Chulalongkorn University, Bangkok 10330, Thailand (e-mail: [email protected]) Ó 2014 John Wiley & Sons Ltd

1

Keywords: 16S rRNA, 16S-23S rRNA intergenic spacer region, Flavobacterium columnare, genetic diversity, phenotypic characterization.

Introduction

Flavobacterium columnare, formerly known as Bacillus columnaris, Chondrococcus columnaris, Cytophaga columnaris, or Flexibacter columnaris, is a Gramnegative, slender filamentous bacterium that produces flexirubin pigment and forms yellow rhizoid colonies as a result of gliding motility (Bernardet & Bowman 2006; Declercq et al. 2013). Since the pioneering discovery in 1922 (Davis 1922), F. columnare has been recognized as the causal agent of columnaris, one of the oldest known diseases of various freshwater fish species (Declercq et al. 2013). Columnaris has been documented as myxobacterial disease, peduncle disease, saddleback, fin rot, cotton wool disease, or black patch necrosis (Noga 2010). It has a worldwide distribution, causes remarkable economic losses, and severely affects cold and warm freshwater fish such as channel catfish, Ictalurus punctatus (Rafinesque), Nile tilapia, Oreochromis niloticus (L.), common carp, Cyprinus carpio L., Indian carp, Catla catla (Hamilton), climbing perch, Anabas testudineus (Bloch), striped catfish, Pangasianodon hypophthalmus (Sauvage), and rainbow trout, Oncorhynchus mykiss (Walbaum) (Amin et al. 1988; Figueiredo et al. 2005; Kubilay et al. 2008; Shoemaker et al. 2008; Dash


et al. 2009; Eissa, Zaki & Aziz 2010; Rahman et al. 2010; LaFrentz et al. 2012; Tien et al. 2012; Kumar Verma & Rathore 2013). Phenotypically homologous characteristics among F. columnare isolates were described in some previous studies that lead to a limitation in phenotypic classification (Bernardet 1989; Triyanto & Wakabayashi 1999; Figueiredo et al. 2005). However, molecular characterization has revealed genetic variability among F. columnare isolates. The term ‘genomovar’ has been used for a group of phenotypically homologous but genotypically distinct isolates. Three genomovars (referred as genotypes) I, II and III were first described based on the restriction fragment length polymorphism of the 16S rRNA gene (16S-RFLP) (Triyanto & Wakabayashi 1999). The 16S-RFLP technique has been used as a standard for F. columnare genotypic classification (Darwish & Ismaiel 2005; Olivares-Fuster et al. 2007b; LaFrentz et al. 2014). Phylogenetic analyses based on 16S rRNA gene sequences identified three phylogenetic clusters that corresponded to the three originally described genomovars (Darwish & Ismaiel 2005). Recently, two new genomovars I/II and II-B have been proposed based on new 16S-RFLP patterns (LaFrentz et al. 2014). In addition to 16S-RFLP, genetic diversity of F. columnare has been explored indepth by the analysis of intergenic spacer region (ISR) (Arias et al. 2004; Darwish & Ismaiel 2005), amplified fragment length polymorphism (AFLP) fingerprinting (Arias et al. 2004), random amplified fragment length polymorphic DNA (RAPD) (Thomas-Jinu & Goodwin 2004), single-

H T Dong et al. Characterization of F. columnare from red tilapia

strand conformation polymorphism (SSCP) (Olivares-Fuster et al. 2007b) and pulse-field gel electrophoresis (Soto, Mauel & Lawrence 2008). The majority of these characterization studies have focused on F. columnare derived from cold water fish in Europe or channel catfish in the USA (Arias et al. 2004; Darwish & Ismaiel 2005; Suomalainen et al. 2006). There is limited information regarding the characterization of F. columnare isolated from South-East Asia, especially with isolates from red tilapia, an economically valuable freshwater fish in this region. In Thailand, disease outbreaks resembling columnaris have been observed in fry and fingerling red tilapia cultured in hatcheries and floating cage systems. However, there has been no diagnostic confirmation and characterization of the causative agent in Thailand. Therefore, the objectives of this study were to isolate and investigate phenotypic and molecular characterization of F. columnare isolates from red tilapia in Thailand.

Materials and methods

Fish samples The outbreaks of columnaris-like disease occurred at numerous red tilapia farms in Thailand during 2012–2013. Mortality rates ranged from 10% to 70% in both floating cage cultured systems and hatcheries. Diseased (n = 69) and healthy (n = 37) fish were collected from 6 provinces in the middle, west and east regions of Thailand for bacterial isolation (Fig. 1). Only fish showing

Figure 1 The map of geographic locations was sampled in this study. Ó 2014 John Wiley & Sons Ltd

2



suspected clinical signs of columnaris disease such as gill necrosis, fin erosion, or skin lesions were collected from 10 affected farms and 1 affected hatchery. Five to ten fish from 4 farms without any clinical signs of disease were collected for comparison. All fish samples were transported to the laboratory for bacterial isolation (Table 1).

based on species-specific PCR (Welker et al. 2005) and exhibited highly homologous 16S rRNA gene and 16S-23S ISR sequences with F. columnare ATCC 49512. These sequences have been deposited in GenBank under Accession Number KF274043 and KF279288, respectively. Phenotypic characterization

Bacterial isolation Anacker and Ordal (AO) medium supplemented with neomycin (Sigma) 0.5 mg ml1 and polymyxin B (Sigma-Aldrich) 200 UI ml1 (Anacker & Ordal 1955) and modified Shield Agar (MSA) supplemented with 1 lg ml1 tobramycin (Sigma) (Decostere, Haesebrouck & Devriese 1997) were used as selective media for primary isolation. Fish were killed using cold ice before dissecting for bacterial isolation. Isolation of bacteria was attempted from the gill, skin and kidney from each fish. Individual tissues were plated, streaked for isolation, and were incubated at 30 °C for 24–48 h. Putative F. columnare colonies were subcultured on the same media without antibiotic. A single colony of each bacterial isolate was cultured in 3 mL AO broth for 24 h, and then, the bacterial suspension was mixed with preservers to final concentration of 10% glycerol and 20% bovine serum and frozen at 80 °C for further analysis. All archived isolates were designated with the organism code, CUVET (Table 2). Three putative F. columnare isolates recovered from striped catfish, Pangasianodon hypophthalmus (Sauvage) (provided by Dr. Dang Thi Hoang Oanh, Cantho University, Vietnam), one isolate from koi carp, Cyprinus carpio L. and one isolate from Nile tilapia, Oreochromis niloticus (L.), were included in this study for comparative purposes. Flavobacterium columnare CUVET1232/M1W was used as a positive control for all PCR experiments. This isolate was confirmed as F. columnare

Forty-nine putative F. columnare isolates in this study were identified based on conventional tests according to Bernardet (1989) and Buller (2004) with slight modification. All isolates were observed for colony morphology, bacterial cell shape, Gram staining and growth capacity on MacConkey and tryptic soy agar (TSA) media. The presence of flexirubin pigment was determined using the 20% KOH. Modified Anacker and Ordal (MAO) containing tryptone 0.5% and yeast extract 0.5% was used as basal medium for all biochemical tests. Carbohydrate metabolism was determined using MAO slant containing 0.2% phenol red as indicator and 1% carbohydrate (glucose, sucrose, lactose, mannitol, arabinose, maltose, trehalose). Presence of decarboxylase was determined using MAO broth containing 1% L-lysine, L-ornithine, or L-arginine. For degradation of gelatin, casein, starch, esculine, AO agar supplement with 1% gelatin, 5% skim milk or 5% starch was used. To test for NaCl tolerance, bacteria were incubated in tubes of AO broth containing 0, 0.5, 1 and 2% NaCl at 30 °C for 5 days (Song, Fryer & Rohovec 1988). DNA extraction and identification by PCR The genomic DNA of each isolate was extracted according to Arias et al. (2004). Each isolate was cultured in 5 mL AO broth at 30 °C for 48 h, centrifuged at 6600 g rpm for 5 min and discarded supernatant. Cell pellets were suspended in

Table 1 Description of fish samples collected in this study Geographic location

Number of farm/hatchery

Health status

Ratchaburi Phetchaburi Kanchanaburi

2 2 2 4 1 1 2 2

Columnaris-like Columnaris-like Columnaris-like Columnaris-like Columnaris-like Healthy fish Healthy fish Healthy fish

Chachoengsao Samut Songkhram Samut Sakhon

Ó 2014 John Wiley & Sons Ltd

3

disease disease disease disease disease

Number of fish

Collection date

8 9 10 22 20 10 12 15

25/07/2012 30/09/2012 27/02/2013 28/09/2013 19/07/2013 19/07/2013 27/08/2013 28/03/2013



Table 2 Flavobacterium columnare isolates used in this study GenBank accession number Isolates

Host

Geographic origin

Organ

Year isolated

CUVET1201 CUVET1202 CUVET1203 CUVET1204 CUVET1212 CUVET1213 CUVET1214 CUVET1215 CUVET1336 CUVET1338 CUVET1340 CUVET1341 CUVET1343 CUVET1344 CUVET1221 CUVET1337 CUVET1339 CUVET1342 CUVET1345 CUVET1346 CUVET1347 CUVET1348 CUVET1349 CUVET1350 CUVET1351 CUVET1352 CUVET1353 CUVET1354 CUVET1355 CUVET1357 CUVET1358 CUVET1359 CUVET1360 CUVET1361 CUVET1362 CUVET1363 CUVET1364 CUVET1365 CUVET1367 CUVET1368 CUVET1369 CUVET1370 CUVET1371 CUVET1372 CUVET1373 CUVET-BU/BU CUVET1231/C31B CUVET1232/M1W M1B

RT RT RT RT RT RT RT RT RT RT RT RT RT RT KC RT RT RT RT RT RT RT RT RT RT RT RT RT RT RT RT RT RT RT RT RT RT RT RT RT RT RT RT RT RT NT SCF SCF SCF

Ratchaburi Ratchaburi Ratchaburi Ratchaburi Phetchaburi Phetchaburi Phetchaburi Phetchaburi Kanchanaburi Kanchanaburi Kanchanaburi Kanchanaburi Kanchanaburi Kanchanaburi Bangkok Kanchanaburi Kanchanaburi Kanchanaburi Chachoengsao Chachoengsao Chachoengsao Chachoengsao Chachoengsao Chachoengsao Chachoengsao Chachoengsao Chachoengsao Chachoengsao Chachoengsao Chachoengsao Chachoengsao Kanchanaburi Kanchanaburi Kanchanaburi Kanchanaburi Kanchanaburi Kanchanaburi Kanchanaburi Kanchanaburi Kanchanaburi Kanchanaburi Kanchanaburi Kanchanaburi Kanchanaburi Kanchanaburi Chachoengsao Cantho, Vietnam Cantho, Vietnam Cantho, Vietnam

Gill Gill Gill Tail Tail Kidney Gill Kidney Skin Gill Liver Gill Skin Gill Ulcer Gill Gill Gill Gill Gill Gill Gill Gill Skin Skin Gill Skin Skin Skin Skin Skin Gill Gill Kidney Gill Gill Gill Gill Kidney Skin Gill Kidney Gill Skin Unknown Skin Unknown Unknown Unknown

2012 2012 2012 2012 2012 2012 2012 2012 2013 2013 2013 2013 2013 2013 2012 2013 2013 2013 2013 2013 2013 2013 2013 2013 2013 2013 2013 2013 2013 2013 2013 2013 2013 2013 2013 2013 2013 2013 2013 2013 2013 2013 2013 2013 2013 2012 2012 2012 2012

Specific PCR

Genomovar

16S rDNA

16S-23S rDNA

+ + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + +

II II II II II II II I II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II

KF274033 KF274034 ND ND ND KF274038 KF274039 KF274040 ND KF274045 ND ND ND KF274049 ND ND ND ND KF774289 KF774290 ND ND ND KF774291 ND ND ND ND ND ND ND ND ND ND ND ND ND ND ND ND ND ND ND ND ND ND KF274042 KF274043 ND

KF279278 KF279279 KF279280 KF279281 KF279282 KF279283 KF279284 KF279285 KF279289 KF279290 KF279291 KF279292 KF279293 KF279294 KF279286 ND ND ND KF873594 KF873595 KF873596 KF873597 KF873598 KF873599 KF873600 ND ND ND KF873601 ND ND ND KF873602 ND KF873603 KF873604 ND KF873605 KF873606 KF873607 ND ND KF873608 KF873609 ND KF873610 KF279287 KF279288 ND

RT, red tilapia, Oreochromis sp.; KC, koi carp, Cyprinus carpio L.; SCF: striped catfish, Pangasianodon hypophthalmus (Sauvage); NT, Nile tilapia, Oreochromis niloticus (L.); ND, not determined.

200 lL sterile water, boiled for 10 min, cooled rapidly on ice and then centrifuged briefly. Supernatant was used as DNA template or kept at 20 °C until needed. All putative F. columnare isolates (n = 49) were confirmed by species-specific PCR after performing presumptive biochemical tests. Flavobacterium Ó 2014 John Wiley & Sons Ltd

4

columnare-specific primers FCISRR and FCISRR1 (Table 3) were used to amplify the partial sequence of 16S-23S ISR as described by Welker et al. (2005). Amplification was performed in a 25 lL reaction volume containing 12.5 lL Master Mix (GoTaqâGreen; Promega), 0.2 lM of each PCR primer and 5 lL DNA template



Table 3 Primers used in this study Primer name

Primer sequence (50 –30 )

Usage

UN-20/20F R1438 16S14F 23S1R FCISRFL FCISRR1 F582 F1274 R1117 R584

AGAGTTTGATC(AC)TGGCTCAG GCCCTAGTTACCAGTTTTAC CTTGTACACACCGCCCGTC GGGTTTCCCCATTCGGAAATC TGCGGCTGGATCACCTCCTTTCTAGAGACA TAATYRCTAAAGATGTTCTTTCTACTTGTTTG CAGTGGTGAAATCTGGT AGTTCGGATCGGAGTCTGC AACCATGCAGCACCTTGAA GAGCGACCAGATTTCACCAC

Amplification and sequencing of 16S rRNA gene Amplification and sequencing of ISR Specific primers for species identification Primers for 16S rRNA gene sequencing

(100–400 ng genomic DNA). The PCR programme was performed in the thermocycler (TC-96/G/H(b), Bioer) with following steps: denaturation at 94 °C for 5 min; followed by 30 cycles of amplification at 94 °C for 30 s, annealing at 45 °C for 45 s; extension at 72 °C for 7 min and 4°C indefinitely. Template DNA from F. columnare CUVET1232 was used as the positive control, and no template was used as the negative control. PCR products were electrophoresed with 1% agarose in TBE buffer at 100 V, stained with Red Safe and detected under UV light of gel documentation system (Vilber Lourmat). Amplification of the 16S rRNA gene and RFLP analysis Nearly full length of 16S rRNA gene of 49 F. columnare isolates was amplified using universal primers UN-20/20F and R1438 (Table 3). The PCRs were performed as described above. Thermocycler conditions were denaturation at 94 °C for 10 min, followed by 30 cycles of amplification at 94 °C for 30 s, annealing at 45 °C for 30 s and extension at 72 °C for 2 min (Darwish & Ismaiel 2005). The isolate F. columnare CUVET1232 was used as the positive control, and a negative control without DNA template also was included. To assign the F. columnare isolates to genomovar, PCR products were digested with restriction endonucleases HaeIII according to manufacture instructions (Thermo Scientific). Then, the digested products were stained with Red Safe and separated by electrophoresis with 3% agarose in TBE buffer at 100 V. The results were detected under UV light of gel documentation system (Vilber Lourmat). Genomovars of examined isolates were assigned based on DNA banding patterns of Ó 2014 John Wiley & Sons Ltd

5

Size of PCR product 1450 bp

References

750–850 bp

Darwish & Ismaiel (2005) Zavaleta et al.1996;

400–500 bp

Welker et al. 2005; Darwish & Ismaiel (2005)

digested products as described in previous publications (Triyanto & Wakabayashi 1999; Darwish & Ismaiel 2005; LaFrentz et al. 2014). 16S-23S rRNA intergenic spacer region (ISR) sequencing and phylogenetic analysis

Intraspecific genetic diversity of the 16S-23S ISR sequences among F. columnare isolates was investigated. Thirty randomly chosen isolates recovered from red tilapia and four isolates recovered from other hosts (Table 2) were examined. Full length of ISR was amplified by PCR using universal primer 16S14F and 23S1R (Table 3) as described by Zavaleta, Martinezmurcia & Rodriguezvalera (1996). PCR mixtures were prepared in the same manner mentioned above. The amplification cycles were as follows: denaturation at 94 °C for 5 min, 35 cycles of 94 °C for 1 min, 55 °C for 1 min and 72 °C for 2 min and a final extension at 72 °C for 3 min. Amplified products were cleaned up using NucleoSpinâ Extract II Kit (Macherey-Nagel) and submitted for sequencing (1st BASE Pte Ltd) using the same pair of primers. Forward and reverse sequences of each isolate were assembled using ContigExpress software VNTI version 10.1 (Invitrogen Coporation, 2006). Following assembly, 16S rRNA and 23S rRNA gene sequences were discarded and the resultant ISR sequence obtained was used for phylogenetic analysis. All nucleotide sequences have been deposited in GenBank (Table 2). The phylogenetic tree was constructed based on ISR sequences from F. columnare isolates (n = 34) in this study and published sequences (n = 16) retrieved from GenBank (Table 4). The ISR sequences of F. johnsoniae ATCC 17061 and



Table 4 Reference sequences of 16S rRNA gene and intergenic spacer region (ISR) of Flavobacterium columnare isolates from various geographic locations used for phylogenetic analysis

Isolate name

16S rRNA accession number

ISR accession number

Flavobacterium columnare ATCC49512 ATCC49513 FK 401

AY635167 AB023660 AB010952

GU079952 AB031219 AB031216

ATCC 23463 clone GI-1

KC912651

AY754372

F10-HK-A clone GI/II-1 ALG-00-530 clone GII-18

KC912679 KC912656

– AY754370

IAM 14820/EK28

AB16515

AB031217

AB015480 AY842900 – – – – KC912659

AB031221 GU079967 AY753071 AY754375 AY754376 AY754377 –

KC912664

AY754378

KC912668 AB015481

AY754371 AB031218

AY842899

LP 8 LV-339-01 BZ-01 BZ-02 BZ-04 BZ-05 PT-14-00-151 clone GIIB-1 GA-02-14 clone GIII-1 ARS-1 clone GIA-1 PH-97028 AU-98-24 Flavobacterium spp. F. johnsoniae ATCC 23107, ATCC 17061 F. psychrophilum strain ATCC 49418 F. branchiophilum NBRC 15030

Year isolated

Collection location

Genomovar

1987 1987 1978

France France Japan

I I I

Unknown

USA

I

2012 2000

Indiana, USA Alabama, USA

I/II II

1967

Japan

II

1966 2001 2002 2002 2002 2002 2000

Japan Arkansas, USA Brazil Brazil Brazil Brazil Mississippi, USA

II II II II II II II-B

2002

Georgia, USA

III

1996 1997

Alabama, USA Japan

III III

AY842905

Oncorhynchus mykiss (Walbaum) I. punctatus (Rafinesque) Plecoglossus altivelis (Temminck & Schlegel) I. punctatus (Rafinesque)

1998

Alabama, USA

III

NR044738

AY753067

–

–

–

–

AY662493

AY757361

–

–

–

–

AY680752

–

–

–

–

–

Host/Sources

Salmo trutta L. Ameiurus melas (Rafinesque) Anguilla japonica Temminck & Schlegel Oncorhynchus tshawytscha (Walbaum) Perca flavescens (Mitchill) Ictalurus punctatus (Rafinesque) A. japonica Temminck & Schlegel Misgurnus sp. I. punctatus (Rafinesque) Oreochromis niloticus (L.) O. niloticus (L.) O. niloticus (L.) O. niloticus (L.) I. punctatus (Rafinesque)

F. psychrophilum ATCC 49418 were used as out of group. Multiple sequence alignment was performed using Clustal W method of the Molecular Evolutionary Genetic Analysis (MEGA 5.21) package (Tamura, Peterson, Stecher, Nei, and Kumar, 2011). The phylogenetic relationship was generated by the neighbour-joining method with p-distance model of the same software package after discarding gaps and unidentified bases (pairwise deletion option). Bootstrap value was 1000 replicates. 16S rRNA gene sequencing and phylogenetic analysis

Intraspecific genetic diversity of 16S rRNA gene sequences among a subset of the F. columnare isolates was also investigated. Nine genomovar II isolates (randomly selected from unique ISR phylogenetic cluster), two genomovar II Vietnamese Ó 2014 John Wiley & Sons Ltd

6

isolates and one genomovar I isolate from this study were selected for sequencing. Universal primers UN-20/20F and R1438 (Table 3) were used for 16S rRNA amplification as described by Darwish & Ismaiel (2005). PCR products were cleaned up using NucleoSpinâ Extract II Kit (Macherey-Nagel, Germany) and submitted for sequencing (1st BASE Pte Ltd). Six primers were used for Sanger sequencing method (Table 3) to get high-quality nucleotide sequences without gaps. The sequences of each sequencing reaction were assembled using ContigExpress (VNTI version 10.1). All nucleotide sequences have been deposited in GenBank (Table 2). The nucleotide similarity of the 16S rRNA gene sequences from these isolates was compared with F. columnare ATCC 49512 using Nucleotide BLAST program from National Center for Biotechnology Information (NCBI). The phylogenetic tree was constructed based on 1180 nucleotides of 16S rRNA


gene sequences (position 90-1278 Escherichia coli numbering), using the same software and conditions as described above. Seventeen published sequences retrieved from GenBank were included for genetic relationship comparison (Table 4), and these represented each of the five described genomovars of F. columnare.

Results

Isolation, characterization and identification Forty-five putative F. columnare isolates were successfully recovered from diseased red tilapia (n = 44) and koi carp (n = 1). Flavobacterium columnare was not isolated from any of the healthy fish sampled in this study. Additionally, four putative isolates were obtained from other laboratories and originated from Nile tilapia (n = 1) and striped catfish (n = 3) (Table 2). All putative F. columnare isolates (n = 49) were Gram-negative, slender long rod-shaped bacteria that formed yellowish, flat, rhizoid or non-rhizoid colonies on AOA and MSA media. The phenotypic characterizations were homologous among F. columnare isolates except the morphology appearance of non-rhizoid colonies of F. columnare CUVET1215, CUVET1370, CUVET1371 and CUVET1372 isolates on AOA. All isolates produced flexirubin pigment and performed positive reaction with cytochrome oxidase and catalase tests. Each isolate was capable of degrading gelatin and casein and incapable of degrading esculin and starch or growing on MacConkey and TSA media. Negative reactions were also found in three decarboxylases, eight tested carbohydrates, indole and urease tests. All bacterial isolates could grow in AO broth containing 0–0.5% of sodium chloride but could not grow at higher concentrations (Table 5). The phenotypic and biochemical characteristics observed for each isolate (n = 49) were consistent with F. columnare. PCR amplification of DNA from each isolate with species-specific primers resulted in definitive identification as F. columnare as evidenced by the presence of one PCR product with approximate size of 400–500 bp. Genotypic classification of Flavobacterium columnare by 16S-RFLP analysis An amplified fragment of approximately 1450 bp was obtained from all F. columnare isolates Ó 2014 John Wiley & Sons Ltd

7


Table 5 Biochemical columnare

characteristics

of

Flavobacterium

Characteristics

Result

Gram Flexirubin pigment Cytochrome oxidase Catalase Gliding motility Growth on tryptic soy agar Growth on MacConkey agar Oxidation–Fermentation (O-F) Degradation of Casein Gelatin Esculin Starch Decarboxylase (arginine, lysine, ornithine) Acid from carbohydrates (Glucose, Sucrose, lactose, arabinose, trehalose, mannose, mannitol, maltose) Nitrate reduction Indole Urease NaCl 0–0.5% NaCl 1%

Negative + + + + Oxidation + +

+ +

(): negative; (+): positive.

(n = 49). The 16S-RFLP generated two DNA banding patterns corresponding to two different genomovars. Genomovar II pattern isolates (n = 48) included red tilapia isolates (n = 43), koi carp (n = 1), Nile tilapia (n = 1) and striped catfish (n = 3), whereas only F. columnare CUVET1215 isolate exhibited the genomovar I pattern (Fig. 2). Sequence analysis of 16S-23S ISR Amplification of 16S-23S ISR using universal primers 16S14F and 23S1R yielded an amplicon with approximate size of 750 bp for 25 isolates and an amplicon with approximate size of 850 bp for nine isolates. After direct sequencing and discarding 16S rRNA and 23S rRNA gene nucleotides, the approximate 750 bp amplicons had variable ISR length from 523 bp to 537 bp while the larger 850 bp amplicons contained ISR length from 587 bp to 651 bp. All 16S-23S ISR (n = 34) contained two tRNA genes coding tRNAIle (position 94-167, CUVET1232 numbering) and tRNAAla (position 291-364, CUVET1232 numbering). The phylogenetic tree based on ISR sequences demonstrated that all F. columnare isolates shared the same ancestor node but were split into two different branches (Fig. 3). The first branch included four clusters that were supported



Figure 2 DNA banding patterns of 16S rRNA gene of Flavobacterium columnare isolates following digestion with HaeIII. Lane M: DNA ladder; lanes 1–9 were representatives of genomovars II isolates: CUVET1201, CUVET1202, CUVE1213, CUVET1214, CUVET1338, CUVET1344, CUVET1345, CUVET1346 and CUVET1350, respectively; lane 10 was genomovar I isolate: CUVET1215.

by bootstrap values of 68, 77 and 96. The first cluster (A) contained four previously published genomovar III isolates and the genomovar I isolate (CUVET1215) from this study; the second cluster (B) formed by previously published genomovar I isolates; the third cluster (C) contained three published genomovar II isolates (EK 28, LP 8, LV-399-01) and 6 genomovar II isolates from red tilapia in this study; and the last cluster (D) contained two genomovar II isolates originating from striped catfish in this study and one genomovar II isolate from channel catfish (ALG-00-530). Interestingly, the second branch included three clusters that were supported by bootstrap values of 83 and 99. The first cluster (E) contained one genomovar II isolate from Brazil; the second cluster (F) contained three genomovar II isolates from Brazil; the third cluster (G) contained 25 genomovar II isolates from this study, including 23 isolates from red tilapia, one from koi carp and one from Nile tilapia. The Thai isolates from this study in cluster G was formed by two subclusters, supported by bootstrap value of 50 (Fig. 3). Sequence analysis 16S rRNA gene Approximately 1420 bp of 16S rRNA gene sequences without gaps was obtained from all selected isolates after assembly forward and reverse sequences and discarded unqualified nucleotides. The BLAST results showed that all genomovar II isolates shared of 98–99% similarity with F. columnare ATCC 49512, while only genomovar I isolate CUVET1215 shared the lowest similarity of 97%; however, it shared 99% similarity with other genomovar III sequences from GenBank. Ó 2014 John Wiley & Sons Ltd

8

The phylogenetic tree was constructed based on 1180 bp of 16S rRNA gene sequences (position 90-1278 E. coli numbering) (Fig. 4). It generated three clusters A, B and C, which were supported by bootstrap values of 93 and 100. The cluster A contained five published genomovar I sequences and one genomovar I/II (F. columnare F10-HKA) sequence. Cluster C contained previously published genomovar III sequences and one genomovar I sequence from this study (CUVET1215). Remaining isolates in this study were grouped into cluster B. Sequenced isolates in cluster B were separated into two subclusters B-I and B-II with a bootstrap value of 59. Subcluster B-I contained five published genomovar II sequences, one published genomovar II-B sequence (F. columnare PT-14-00-151) and two genomovar II sequences from this study (CUVET1231 and CUVET1232; striped catfish isolates). Subcluster B-II contained all nine genomovar II isolates from Thailand in this study. Discussion

Flavobacterium columnare, the causative agent of columnaris disease, can cause remarkable financial losses in freshwater fish farms throughout the world (Declercq et al. 2013). Numerous fish species are impacted by columnaris disease yearly; however, most published literature has focused on the molecular characterization of F. columnare derived from cold water fish in Europe or channel catfish in the USA (Arias et al. 2004; Darwish & Ismaiel 2005; Suomalainen et al. 2006; LaFrentz et al. 2014). This study is the first to describe the genotypic and molecular characterization of F. columnare isolates recovered primarily from red



Figure 3 Phylogenetic tree based on 16S-23S intergenic spacer region (ISR) of Flavobacterium columnare isolates.


9



Figure 4 Phylogenetic trees was constructed based on 1180 bp of 16S rDNA sequences (position 90-1278 Escherichia coli numbering) of Flavobacterium columnare isolates.

tilapia and a few other freshwater fish species in Thailand and Vietnam. From our observation, it is clear that red tilapia are very susceptible to F. columnare during the raining season in Thailand and columnaris disease frequently occurs in floating cultured cages. Most diseased fish showed severe gill necrosis that leaded to anoxia and death as a result. A greater understanding of F. columnare from red tilapia is important because this is an economically valuable species in Thailand. Previous reports have indicated that the phenotypic and biochemical characteristics among F. columnare strains isolated from various hosts in different geographical areas are homologous. (Bernardet 1989; Triyanto & Wakabayashi 1999; Ó 2014 John Wiley & Sons Ltd

10

Figueiredo et al. 2005; Bernardet & Bowman 2006). The F. columnare isolates characterized in the present study also revealed identical biochemical characteristics between our isolates and isolates from previously published articles. One exception is the observation that four isolates in this study formed non-rhizoid colonies on AOA medium; however, we observed that the colony morphology of the others changed from rhizoid to non-rhizoid after preserving in AO broth for several weeks. Additionally, we observed colony morphology differences following growth of the bacteria in two types of media, AOA and MSA (unpublished data). The change in colony morphology of F. columnare is not clearly understood. Colony


morphology changing under laboratory conditions after several passages was previously described by Kunttu et al. (2009). Some other factors affecting F. columnare colony morphology change have been explored recently and include starvation and exposure to phage infection (Laanto et al. 2012; Zhang et al. 2014). Research has shown that the non-rhizoid colonies are less virulent, and this may be due to differences in the organization of cells during growth, secreted proteins and production of outer membrane vesicles (Laanto et al. 2014). The 16S rRNA gene and 16S-23S ISR are the most common target genes for molecular analysis of bacteria (Yildirim, Yildirim & Kocak 2011). The 16S rRNA gene is highly conserved in all bacteria but also contains variable regions that allow for species identification (Yildirim et al. 2011). The ISR sequence exists between the 16S rRNA and 23S rRNA genes and can provide a greater genetic diversity than other sequences like 16S rRNA because this region is under less evolutionary pressure to be conserved (Zavaleta et al. 1996). Arias et al. (2004) firstly investigated intraspecific diversity of F. columnare based on ISR. Interestingly, four Brazilian strains clustered in a unique genetic group and separated with two clusters of genomovar I and II isolates. Unfortunately, original isolates of genomovar II (F. columnare EK 28, LP 8) and genomovar III isolates were not included for phylogenetic analysis in that study. In the present study, sixteen ISR sequences of well-known F. columnare isolates from France, Japan, USA and Brazil were analysed together with 34 isolates derived from Thailand and Vietnam. Interestingly, size of the ISR amplicon was correlated to phylogenetic clusters; 6 genomovar II isolates from Thailand (ISR 850 bp amplicon) were located in the same cluster (ISR-C) with previously published genomovar II sequences, whereas the remaining 25 genomovar II isolates (ISR 750 bp amplicon) from Thailand clustered in a unique genomic group G (ISR-G). Although cluster ISR-G was most closely related to the Brazilian isolates (cluster ISR-E and ISR-F), the nucleotide similarity between isolates of these three clusters still lower than 96% (Nucleotide Blast). The only genomovar I (CUVET1215) in present study was contained in the same cluster (A) as the genomovar III isolates. Even Thailandoriginated F. columnare isolates formed in several clusters; however, the majority of them (ISR-G) Ó 2014 John Wiley & Sons Ltd

11


appear to be genetically different from other isolates that have been analysed in this study. Another highly conserved gene, the 16S rRNA gene, was chosen to further explore the genetic variability of a subset of the F. columnare isolates. Nine isolates randomly selected from the unique cluster ISR-G, two Vietnamese isolates and one genomovar I isolate (CUVET1215) were phylogenetically investigated. Interestingly, the 16S rRNA phylogeny results support the ISR sequencing and suggest the Thai isolates are genetically novel. The isolate F. columnare CUVET1215, classified as genomovar I based on 16S-RFLP, was clustered in the same group with genomovar III isolates in 16S rRNA and ISR phylogenetic trees. An explanation for this is CUVET1215 exhibited higher nucleotide similarity with published genomovar III sequences but exhibited different HaeIII restriction sites which are the basis for genomovar assignment. In this study, amplification of 16S rRNA gene was carried out using either reverse universal primer R1438 (Darwish & Ismaiel 2005) or 1500R (Weisburg et al. 1991). However, 16S rRNA amplification using primer 1500R was successful in only isolate CUVET1215 of 49 isolates in the present study. The similar failure with some isolates of F. columnare was reported in two other studies by Arias et al. (2004), Darwish & Ismaiel (2005). Consequently, universal primers UN-20/ 20F and R1438 were used for amplification of 16S rRNA in the present study. 16S-RFLP assigned all F. columnare isolates to either genomovar I or II. Genomovar I and II isolates coexisted in Thailand; however, genomovar II was the predominant genetic type as only one isolate of genomovar I was detected. The three isolates from Vietnamese striped catfish were assigned to genomovar II. Previous studies indicated that genomovar I is dominant in Europe, while genomovar II has been referred to as an Asian genomovar (Michel, Messiaen & Bernardet 2002; Darwish & Ismaiel 2005; LaFrentz et al. 2014). Recently, an isolate of F. columnare originating from India was characterized and assigned to genomovar II (Kumar Verma & Rathore 2013). The factors driving this potential association between genomovar I and II isolates and geography are not known; however, one potential explanation is temperature. Genomovar I isolates have been recovered from both cold and warm fish species, while genomovar II isolates have been


recovered from warm water fish (Darwish & Ismaiel 2005; Schneck & Caslake 2006; OlivaresFuster et al. 2007a). Another potential explanation is the number of isolates typed by 16S-RFLP from Europe and Asia has not been adequate to encompass the diversity of genomovars present in these regions. This explanation is supported by the observation that many F. columnare isolates have been typed from the USA and all five genomovars have been reported (Darwish & Ismaiel 2005; LaFrentz et al. 2014). In summary, this is the first report of phenotypic and genetic characterization of F. columnare isolated from red tilapia, Nile tilapia and koi carp in Thailand as well as three isolates of F. columnare derived from striped catfish in Vietnam. Especially, the unique genetic variability of Thai isolates was firstly described. Future research will explore the relationship between Thai genetic cluster and virulence of F. columnare, pathogenesis and development of prevention and control strategies. Acknowledgements This research was supported by the graduate scholarship programme of Chulalongkorn University for faculty members from neighbouring countries and The 90th anniversary of Chulalongkorn University fund (Ratchadaphiseksomphot Endowment Fund) Grant No. GCUGR1125572134M. The authors would like to thank Dr. Dang Thi Hoang Oanh and Dr. Praparsiri Barnette for providing bacterial isolates (C31B, M1W, M1B, BU). We also thank staffs in the Department of Veterinary Microbiology, Faculty of Veterinary Science, Chulalongkorn University for technical help. References Amin N.E., Abdallah I.S., Faisal M., Easa M.E., Alaway T. & Alyan S.A. (1988) Columnaris infection among cultured Nile tilapia Oreochromis niloticus. Antonie van Leeuwenhoek 54, 509–520. Anacker R.L. & Ordal E.J. (1955) Study of a bacteriophage infecting the myxobacterium Chondrococcus columnaris. Journal of Bacteriology 70, 738–741. Arias C.R., Welker T.L., Shoemaker C.A., Abernathy J.W. & Klesius P.H. (2004) Genetic fingerprinting of Flavobacterium columnare isolates from cultured fish. Journal of Applied Microbiology 97, 421–428. Bernardet J.-F. (1989) “Flexibacter columnaris”: first description in France and comparison with bacterial strains from other origins. Diseases of Aquatic Organisms 6, 37–44. Ó 2014 John Wiley & Sons Ltd

12


Bernardet J.-F. & Bowman J.P. (2006) The Genus Flavobacterium. In: The Prokaryotes (ed. by M. Dworkin, S. Falkow, E. Rosenberg, K. H. Schleifer & E. Stackebrandt.), pp. 481–531. Springer, New York. Buller N.B. (2004) Bacteria from Fish and Other Aquatic Animals. A Practical Identification Manual, 361p. CABI Publishing, Wallingford, UK. Darwish A.M. & Ismaiel A.A. (2005) Genetic diversity of Flavobacterium columnare examined by restriction fragment length polymorphism RNA gene and the and sequencing of the 16S ribosomal 16S-23S rDNA spacer. Molecular and Cellular Probes 19, 267–274. Dash S.S., Das B.K., Pattnaik P., Samal S.K., Sahu S. & Ghosh S. (2009) Biochemical and serological characterization of Flavobacterium columnare from freshwater fishes of Eastern India. Journal of the World Aquaculture Society 40, 236–247. Davis H.S. (1922) A new bacterial disease of fresh-water fishes. Bulletin of the US Bureau of Fisheries 38, 261–280. Declercq A.M., Haesebrouck F., Van Den Broeck W., Bossier P. & Decostere A. (2013) Columnaris disease in fish: a review with emphasis on bacterium-host interactions. Veterinary Research 44, 27. Decostere A., Haesebrouck F. & Devriese L.A. (1997) Shieh medium supplemented with tobramycin for selective isolation of Flavobacterium columnare (Flexibacter columnaris) from diseased fish. Journal of Clinical Microbiology 35, 322– 324. Eissa A.E., Zaki M.M. & Aziz A.A. (2010) Flavobacterium columnare/Myxobolus tilapiae Concurrent Infection in the Earthen Pond Reared Nile Tilapia (Oreochromis niloticus) during the Early Summer. IBC Interdisciplinary Bio Central 2, 1–10. Figueiredo H.C., Klesius P.H., Arias C.R., Evans J., Shoemaker C.A., Pereira D.J. Jr & Peixoto M.T. (2005) Isolation and characterization of strains of Flavobacterium columnare from Brazil. Journal of Fish Diseases 28, 199–204. Kubilay A., Altun S., Diler O. & Ekici S. (2008) Isolation of Flavobacterium columnare from cultured rainbow trout (Oncorhynchus mykiss) fry in Turkey. Turkish Journal of Fisheries and Aquatic Sciences 8, 165–169. Kumar Verma D. & Rathore G. (2013) Molecular characterization of Flavobacterium columnare isolated from a natural outbreak of columnaris disease in farmed fish, Catla catla from India. Journal of General and Applied Microbiology 59, 417–424. Kunttu H.M., Suomalainen L.R., Jokinen E.I. & Valtonen E.T. (2009) Flavobacterium columnare colony types: connection to adhesion and virulence? Microbial Pathogenesis 46, 21–27. Laanto E., Bamford J.K., Laakso J. & Sundberg L.R. (2012) Phage-driven loss of virulence in a fish pathogenic bacterium. PLoS One 7, e53157. Laanto E., Penttinen R.K., Bamford J.K. & Sundberg L.R. (2014) Comparing the different morphotypes of a fish pathogen – implications for key virulence factors in Flavobacterium columnare. BMC Microbiology 14, 170, in press.


LaFrentz B.R., Lapatra S.E., Shoemaker C.A. & Klesius P.H. (2012) Reproducible challenge model to investigate the virulence of Flavobacterium columnare genomovars in rainbow trout Oncorhynchus mykiss. Diseases of Aquatic Organisms 101, 115–122. LaFrentz B.R., Waldbieser G.C., Welch T.J. & Shoemaker C.A. (2014) Intragenomic heterogeneity in the 16S rRNA genes of Flavobacterium columnare and standard protocol for genomovar assignment. Journal of Fish Diseases 37, 657–669. Michel C., Messiaen S. & Bernardet J.F. (2002) Muscle infections in imported neon tetra, Paracheirodon innesi Myers: limited occurrence of microsporidia and predominance of severe forms of columnaris disease caused by an Asian genomovar of Flavobacterium columnare. Journal of Fish Diseases 25, 253–263. Noga E.J. (2010) Fish Disease: Diagnosis and Treatment. 2nd ed, 536p. Wiley-Blackwell Publication, Ames, Iowa. Olivares-Fuster O., Baker J.L., Terhune J.S., Shoemaker C.A., Klesius P.H. & Arias C.R. (2007a) Host-specific association between Flavobacterium columnare genomovars and fish species. Systematic and Applied Microbiology 30, 624–633. Olivares-Fuster O., Shoemaker C.A., Klesius P.H. & Arias C.R. (2007b) Molecular typing of isolates of the fish pathogen, Flavobacterium columnare, by single-strand conformation polymorphism analysis. FEMS Microbiology Letters 269, 63–69. Rahman M.M., Ferdowsy H., Kashem M.A. & Foysal M.J. (2010) Tail and Fin rot disease of Indian major carp and climbing perch in Bangladesh. Journal of Biological Sciences 10, 800–804. Schneck J.L. & Caslake L.F. (2006) Genetic diversity of Flavobacterium columnare isolated from fish collected from warm and cold water. Journal of Fish Diseases 29, 245–248. Shoemaker C.A., Olivares-Fuster O., Arias C.R. & Klesius P.H. (2008) Flavobacterium columnare genomovar influences mortality in channel catfish (Ictalurus punctatus). Veterinary Microbiology 127, 353–359. Song Y.L., Fryer J.L. & Rohovec J.S. (1988) Comparison of gliding bacteria isolated from fish in North America and other areas of the Pacific rim. Fish Pathology 23, 197–202.


13


Soto E., Mauel M. & Lawrence M. (2008) Improved pulsedfield gel electrophoresis procedure for the analysis of Flavobacterium columnare isolates previously affected by DNA degradation. Veterinary Microbiology 128, 207–212. Suomalainen L.R., Kunttu H., Valtonen E.T., Hirvela-Koski V. & Tiirola M. (2006) Molecular diversity and growth features of Flavobacterium columnare strains isolated in Finland. Diseases of Aquatic Organisms 70, 55–61. Thomas-Jinu S. & Goodwin A.E. (2004) Morphological and genetic characteristics of Flavobacterium columnare isolates: correlations with virulence in fish. Journal of Fish Diseases 27, 29–35. Tien N.T., Dung T.T., Tuan N.A. & Crumlish M. (2012) First identification of Flavobacterium columnare infection in farmed freshwater striped catfish Pangasianodon hypophthalmus. Diseases of Aquatic Organisms 100, 83–88. Triyanto A. & Wakabayashi H. (1999) Genotyping of strains of Flavobacterium columnare from diseased fishes. Fish Pathology 34, 65–71. Weisburg W.G., Barns S.M., Pelletier D.A. & Lane D.J. (1991) 16S ribosomal DNA amplification for phylogenetic study. Journal of Bacteriology 173, 697–703. Welker T.L., Shoemaker C.A., Arias C.R. & Klesius P.H. (2005) Transmission and detection of Flavobacterium columnare in channel catfish Ictalurus punctatus. Diseases of Aquatic Organisms 63, 129–138. Yildirim I.H., Yildirim S.C. & Kocak N. (2011) Molecular methods for bacterial genotyping and analyzed gene regions. Journal of Microbiology and Infectious Diseases 1, 42–46. Zavaleta A.I., Martinezmurcia A.J. & Rodriguezvalera F. (1996) 16S-23S rDNA intergenic sequences indicate that Leuconostoc oenos is phylogenetically homogeneous. Microbiology 142, 2105–2114. Zhang J., Laakso J., Mappes J., Laanto E., Ketola T., Bamford J.K., Kunttu H. & Sundberg L.R. (2014) Association of colony morphotypes with virulence, growth and resistance against protozoan predation in the fish pathogen Flavobacterium columnare. FEMS Microbiology Ecology in press. doi: 10.1111/1574-6941.12356. Received: 21 May 2014 Revision received: 8 July 2014 Accepted: 26 July 2014

Lack of association between Flavobacterium columnare genomovar and virulence in hybrid tilapia Oreochromis niloticus (L.)×Oreochromis aureus (Steindachner).

Genetic characterization of a betanodavirus isolated from a clinical disease outbreak in farm-raised tilapia Oreochromis niloticus (L.) in Thailand.

Molecular characterization and virulence gene profiling of pathogenic Streptococcus agalactiae populations from tilapia ( Oreochromis sp.) farms in Thailand.

Draft Genome Sequences of Streptococcus agalactiae Strains Isolated from Nile Tilapia (Oreochromis niloticus) Farms in Thailand.

Flavobacterium maotaiense sp. nov., isolated from freshwater.

Ultrastructural effects on gill tissues induced in red tilapia Oreochromis sp. by a waterborne lead exposure.

Flavobacterium ahnfeltiae sp. nov., a new marine polysaccharide-degrading bacterium isolated from a Pacific red alga.

Effects of Genotype by Environment Interaction on Genetic Gain and Genetic Parameter Estimates in Red Tilapia (Oreochromis spp.).

Feed-based vaccination regime against streptococcosis in red tilapia, Oreochromis niloticus x Oreochromis mossambicus.

Growth and survival of the fish pathogenic bacterium, Flavobacterium columnare, in tilapia mucus and porcine gastric mucin.

Flavobacterium suzhouense sp. nov., isolated from farmland river sludge.

Flavobacterium palustre sp. nov., isolated from wetland soil.

Phenotypic and Genetic Diversity of Aeromonas Species Isolated from Fresh Water Lakes in Malaysia.

Marine Collagen Peptides from the Skin of Nile Tilapia (Oreochromis niloticus): Characterization and Wound Healing Evaluation.

Characterization and Genetic Variation of Vibrio cholerae Isolated from Clinical and Environmental Sources in Thailand.

Streptomyces ferrugineus sp. nov., isolated from mangrove soil in Thailand.

Activities of wogonin analogs and other flavones against Flavobacterium columnare.

Flavobacterium oryzae sp. nov., isolated from a flooded rice field, and emended descriptions of Flavobacterium flevense, Flavobacterium yonginense and Flavobacterium myungsuense.

Antimicrobial Susceptibility of Escherichia coli Isolated from Fresh-Marketed Nile Tilapia (Oreochromis niloticus).

Phenotypic and genetic characterization of rhizobia isolated from Hedysarum flexuosum in Northwest region of Morocco.

Cortisol directly impacts Flavobacterium columnare in vitro growth characteristics.

Metacercarial infection of wild Nile tilapia (Oreochromis niloticus) from Brazil.

Complete Genome Sequence of the Fish Pathogen Flavobacterium columnare Pf1.

Experimental early pathogenesis of Streptococcus agalactiae infection in red tilapia Oreochromis spp.